##gff-version 3 ##date Tue Nov 28 11:03:34 CET 2023 ## exported from the transgeneomics system molecule_59059123 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59059123 mpicbg region 9631 20483 . + . Name=dmel-5.43-3L;type=genome;start=19596079;end=19606931;strand=- molecule_59059123 mpicbg region 20484 20556 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59059123 mpicbg region 20557 21545 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59059123 mpicbg region 21546 48162 . + . Name=dmel-5.43-3L;type=genome;start=19569462;end=19596078;strand=- molecule_59059123 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59059123 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59059123 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59059123 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59059123 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59059123 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59059123 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59059123 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59059123 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59059123 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59059123 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59059123 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59059123 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59059123 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59059123 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59059123 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59059123 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59059123 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59059123 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59059123 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59059123 coding_transcript gene 9973 11002 . - . identifier=FBgn0036893;id=50846375;Name=CG9376;ensembl=FBgn0036893 molecule_59059123 coding_transcript gene 11269 15614 . + . id=50846246;Name=Lon;ensembl=FBgn0036892;alias=Lon;identifier=FBgn0036892;alias=anon-WO0118547.350;alias=Lon protease;alias=CG8798 molecule_59059123 coding_transcript gene 15094 17252 . - . alias=SP34;identifier=FBgn0036891;alias=c-SP34;id=50880024;ensembl=FBgn0036891;Name=CG9372 molecule_59059123 coding_transcript gene 17372 19064 . + . alias=DmelObp76a;alias=76c(LUSH);alias=LUSH;identifier=FBgn0020277;alias=obp76a;ensembl=FBgn0020277;Name=lush;alias=76c;alias=76a;alias=lush;alias=Obp76a;alias=Lush;id=51147198;alias=CG8807 molecule_59059123 coding_transcript gene 19342 22888 . - . identifier=FBgn0036890;alias=BcDNA:RH51268;id=50846161;Name=CG9368;ensembl=FBgn0036890 molecule_59059123 coding_transcript mrna 19342 22888 . - . id=50846167;parent=50846161;Name=FBtr0074942 molecule_59059123 coding_transcript mrna 19342 22870 . - . id=50846191;Name=FBtr0074943;parent=50846161 molecule_59059123 coding_transcript mrna 19342 22869 . - . parent=50846161;Name=FBtr0074944;id=50846209 molecule_59059123 coding_transcript exon 19342 22482 . - . parent=50846191 molecule_59059123 coding_transcript three_prime_utr 19342 22346 . - . parent=50846191 molecule_59059123 coding_transcript exon 19342 21868 . - . parent=50846209 molecule_59059123 coding_transcript exon 19342 21853 . - . parent=50846167 molecule_59059123 coding_transcript three_prime_utr 19342 20480 . - . parent=50846167 molecule_59059123 coding_transcript three_prime_utr 19342 20480 . - . parent=50846209 molecule_59059123 coding_transcript cds 20481 21868 . - . parent=50846209 molecule_59059123 coding_transcript cds 20481 21853 . - . parent=50846167 molecule_59059123 CLC misc_recomb 20557 20590 . - . Name=FRT molecule_59059123 CLC cds 20598 20669 . - . Name=BLRP molecule_59059123 CLC cds 20670 20690 . - . Name=TEV molecule_59059123 CLC cds 20691 20714 . - . Name=Precision cut site molecule_59059123 CLC cds 20715 20756 . - . Name=V5 molecule_59059123 CLC cds 20763 21479 . - . Name=SGFP molecule_59059123 CLC cds 21486 21545 . - . Name=2xTY1 molecule_59059123 coding_transcript intron 21854 22463 . - . parent=50846167 molecule_59059123 coding_transcript intron 21869 22463 . - . parent=50846209 molecule_59059123 coding_transcript cds 22347 22482 . - . parent=50846191 molecule_59059123 coding_transcript exon 22464 22482 . - . parent=50846167 molecule_59059123 coding_transcript cds 22464 22482 . - . parent=50846167 molecule_59059123 coding_transcript exon 22464 22482 . - . parent=50846209 molecule_59059123 coding_transcript cds 22464 22482 . - . parent=50846209 molecule_59059123 coding_transcript intron 22483 22547 . - . parent=50846167 molecule_59059123 coding_transcript intron 22483 22547 . - . parent=50846191 molecule_59059123 coding_transcript intron 22483 22547 . - . parent=50846209 molecule_59059123 coding_transcript exon 22548 22888 . - . parent=50846167 molecule_59059123 coding_transcript exon 22548 22870 . - . parent=50846191 molecule_59059123 coding_transcript exon 22548 22869 . - . parent=50846209 molecule_59059123 coding_transcript cds 22548 22751 . - . parent=50846167 molecule_59059123 coding_transcript cds 22548 22751 . - . parent=50846209 molecule_59059123 coding_transcript cds 22548 22747 . - . parent=50846191 molecule_59059123 coding_transcript five_prime_utr 22748 22870 . - . parent=50846191 molecule_59059123 coding_transcript five_prime_utr 22752 22888 . - . parent=50846167 molecule_59059123 coding_transcript five_prime_utr 22752 22869 . - . parent=50846209 molecule_59059123 coding_transcript gene 23142 25437 . - . alias=TBP-associated factor 60;alias=l(3)76BDf;alias=TAFII60(62);alias=Taf60;alias=TAF60/62;alias=TBP associated factor 60;alias=dmTAF6;alias=TAF[[II]]60;alias=dTAF[[II]]62;alias=TBP-associated factor 6;alias=taf60;alias=Taf[[II]]60;alias=TAF[[II]];alias=dTAF62;alias=CG9348;alias=TAF[[II]]60/62;alias=TAFII62;alias=Suppressor of Ras85D 3-4B;alias=TBP-associated factor 60kD;alias=TAF60;alias=TAF[[II]]62;alias=TBP-associated factor;Name=Taf6;ensembl=FBgn0010417;alias=p62;alias=TAF6;alias=dme-TAFII60;identifier=FBgn0010417;alias=dTAFII62;alias=CG32211;alias=Taf-6;alias=dTAF6;alias=dTAF[[II]]262;alias=TAFII60;alias=TFIID;alias=d60;alias=TAF;alias=SR3-4B;id=51253382;alias=Taf62;alias=TFIID 62;alias=dTAF[[II]]60 molecule_59059123 coding_transcript gene 25769 33751 . + . alias=ash-1;alias=Absent;alias= small;alias=l(3)SG29a;alias=ash;alias=Ash 1;alias= or homeotic-1;alias=ASH1;alias=l(3)76BDb;alias=absent small or homeotic 1;alias=discs absent;alias=Ash1;alias= small or homeotic discs 1;alias= small or homeotic discs 1;identifier=FBgn0005386;alias= small;alias=absent;alias= or homeotic disc 1;alias=discs absent;alias=Ash;Name=ash1;alias=absent, small, or homeotic discs 1;alias=CG8887;alias=dash;ensembl=FBgn0005386;alias= small;alias= or homeotic;alias=Absent;id=50758120 molecule_59059123 coding_transcript gene 34009 35452 . + . ensembl=FBgn0036889;identifier=FBgn0036889;id=50771387;Name=CG14100 molecule_59059123 coding_transcript gene 35413 38269 . - . id=51377489;Name=CG9330;identifier=FBgn0036888;ensembl=FBgn0036888 molecule_59059123 coding_transcript gene 38296 39431 . + . identifier=FBgn0036887;ensembl=FBgn0036887;id=51377231;Name=CG9231 ##FASTA >molecule_59059123 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACTGATGAAGAAGACTACTGGG AGCCCAATGAAAACTATGTGGGCCAACGGTGTCTACTGGAGGATGAGAGC TTTGTAATGGCAGTTAAAGCTTAAGATGTTTGTCAAGTGGTGTCATTAAA TTATATGTTATCGTCTATCAGTTATGATATGCTAAAAATGGTATTGTCAT TTCATTGAGTTTAAGTTTAAAAAATTTGTAAGCTTTTTGCCCCTCTGCAT GTGAAAATGTATATTTCACGGGCAAAAGTACCCTATTCCTTGATTAAGAA GCTGCGCATAAAACAAATAAGTCCTGATTGGGAAAGTAATTAGGTGTTAT GGTTTATAAGCCGTCTTTGGTTAAATTCATAATTTGTTAGTTTATTATTG ATTGATTTAAAAAGAATTCATTAATAATCCACGCTAGTAATATGATTAAA CATGTAACATTAAAGTGGTAATTGCTTTTTGGTAGTTCCTAAGCTGCTGA CTAGACGGGATGATGACGTGGTTCTTAGTGGATGAGTGGATTTCAGTGGC AGCGCAACGTAATAATCTTGGTGGCAGAATGAAGAGTTTTATTATTAGAT TTAAGTGCGTTTCTTGGTCATGTAAACTCGAGCTGTGGCGTAGAGGACAT GCGTACAAGCGTATATATTGCCCAGAGCGCTTCCCAGCAGTGCTCCGATC ACGTTGGGAATGGGATAAGCCTGCCAGTCACGTCCCCAGTCTAGTGGAGC GACCACGCTCCCGGCCCAAGCTCCCAGAATACCGCCCAGTGCATTGTACT TGAACAGATTCAGAGCCGTGTCCTCGCACTTGGTCACAAAGTCCGGTTTC TCGCAGAAGCACACTTGTAGTGCTCCTCCGCCACCGAGGAGGAAAACCGT GGGTGACACCGTCAACAAGGTCATCAGTAAGGCCAAGACGAAGGTCTGCT CATAGTTGCCCAGCACCGGGGCTCCCAAAATTATGCAGATAAAGGCGTAG AGGAGTGTACACAGGAACTGCAGGGTGAATCCTCCGAGGAGCTCCCGCGG CGTAAAGTACGAGTTCTTTTTCTGGCGCTGTTTGGCGGTTAGGACGCCAT CCTCAACCTTCCCGTAGAAGCGAGCCAAAACAACTTTTAGCAGCTCTCCG AGGAAAACAATAGGGACGACAAGAGAATCCCAGAAGCTGCCGAGATGTGC CCAATTCCGGCGATACTGCATGTACGCCATGCAGATCAGGATGGTGGCGA GGCTGAGGGACACGTGGAAGAGCTGGTGCTTGGTCTTTTGTTGGTCGAAT CGGGAAACCATGATTAAATGCAGATAAATACAATTTTGGTAAATCTTAAA CTTGGACAATATTTTCCTGCCTTTCGTTTGTATTTCGCCGCCTATCAACA CTGAATGTACTGTGGGCTTAAAACACAAAGCTTCGGAAATTTTAAATCAC CGAATTTACATATAAAACAAAAAATTAAGATTTATTTTATAATGGATGCT TTTTACTTACAAAATTCAAAAAATTAATTCCAAAATTAAAAAAATGCTCT AAATAAGGGACAACGTTGTCGACGTCATTGGGTTCATGCGGTGTAGAACA AAAAAAAAATTTCACCGGTACCACTGTGCAACAATAGAAGAAATCGTTTT GCAGCACTGTCAGCCGCTGTCATTTCACCAGCCGTCACATAATCACTCAC CACACATTTGGACTGCAAATTGTTTTTCTACCATTTCTAGTTATTTCTAA GTAAATTGCGAGTGGATATTGCTTTCAATATGTTAGCCCGCGCTATCCGA GTGCGCCCCATGATGCGTGGCATCGCCTCGTCGTCAGTGTGGAACCGGAA TCGTCCCATTCAGAGTTCCCTGATGCAATACTGCCGGGATCGGTCGTTGC GCCTCCAGCGGCTCCACGGAGCCAATTTGATGGTGCAGCGCTTCTACAGC CGCAAGCGGGATGATTCCAACGGGGATATTATTATGGGACCCGATCTTAT GTCCGATCAAGATACCCATCTTCCGGCAACTGTGGCGGTGCCGGACGTGT GGCCACATGTTCCGTTGTTGGCCATGCGCAAGAATCCTCTCTTTCCCCGC TTTATGAAGATAGTGGAGGTAAGGTTTCATTTGACTGGATGAATAACTAC TCACTATCATGAATTGATTTAGTCAGTAAGCTTTTAATGAGCTAGACTTC TTATTAGTGTTTACAACATTTAAAAGTACGCCTTAATAATACTTTTTTCC TTGGCTTTGAAAAAATCCGATGTGCTAATAGGTATCCAATCCCATCATCA TGGATCTACTCCGTCGCAAAGTCAAGCTGAATCAACCTTACGTAGGCGTC TTCCTTAAGAAAACTGATGGCGAAGAGGAGCTTATCACCAATTTGAATGA TGTCTACAATCTCGGAACATTTGCACAAATCCAAGAGCTGCAGGATCTCG GTGATAAGCTGCGCATGGTTGTGGTGGCCCATCGTCGTATTCGTATAACA GGTCAGGTGGTAGAGGACGTGCCACCTCCTAAGCCCGGTAAGCATATTTT CCACACACCCACTAAGCGCCCAGATGTGTGACCTATGTTTCTGCCCTTAG TGAAAATGACAACTTTGCATTATCCTCTATTTAATATAAAATTACAAATC CCAGCTGAAGATCAAAGCACTGATCAAGCGGATGCGGCACCTATAAAATC AAGATCCGACCCAGCCCGAAAGCCCCGTGGCCGAATTCCCAGGAGTCGGA CCGGAAAATCACGTGAATCGGCGGCTGCTGAAGAACTTATACAAAACCAG ACTCTGGAGCCGCCACTGAAATCAGGCAAAGTCGAGTCATCGAGCTTGCC AAAGCCTCCAACAGAAGAAAAGATAGTGGAACCTGAGACTGGTGCCAAAG AAAATGTTAATCAATCTGCGCCCAGCGCCCAACCTGTTCTTATTGTTGAA GTGGAGAACGTAAAGCAACCGATCTATAAACAAACGGAAGAGGTGAAGGC ATTAACTCAGGAGATAATCAAGACTCTTCGGGACATAATCACAATGAATC CCTTGTATAGGTATGTTTTAAAATGATACAAACAACATGTTTATCTGCCA TTAATCATACTTTCCAGAGAGAGTCTACAGCAGATGCTGCACCAAAATCA ACGAGTTGTCGACAACCCCATTTATCTGTGCGATTTAGGAGCATCCCTTT CCGCTGGAGAACCAGCTGAGCTGCAAAAAATTCTTGAGGAAACAGATGTA ACTAAAATAAACTTATATCGGAAATAAAAATCTTATATATGTATCACTAT TTCAGATCCCAGAACGTCTACAATTGGCCTTAACTTTACTCAAAAAGGAG TTGGAACTCTCCAGGCTCCAACAAAAAATTGGACGCGAAGTAGAGGAAAA AGTCAAGCAGCAACATCGCAAATATATACTCCAGGAACAGTTGAAAGTCA TCAAAAAAGAACTGGGCATCGAAAAAGACGACAAGGATGCCATTGGTGAA AAGTACCGCGAAAAGCTGAAGGATAAGGTGGTTCCCGAAGCTATTATGAC GGTTATTGATGAAGAACTCACCAAGCTGAACTTCCTGGAGAGTCATAGTT CCGAGTTTAAGTGAGTTCTACAAAATATTTTGGAATTTAGCTTAACTAAT ATGCTCATACTACTTTTTTTTAGTGTAACTCGCAATTACCTCGACTGGCT TACTTCCCTACCTTGGGGCGTTATCAGCACCGAAAATCTCTGCCTGGAGA AGGCCACTGAAACACTAAACGACGATCACTACGGAATGGAGGATATCAAG AAGCGTATTTTAGAATTTATTGCCGTCAGTTCCCTCAAGGGCTCTACGCA GGGCAAGATCTTGTGCTTTCATGGACCCCCTGGTGTGGGCAAGACAAGCA TAGCAAAGTCCATTGCACGCGCTTTGAATCGCGAGTACTTCCGCTTTAGT GTGGGCGGCATGACAGACGTTGCTGAGATCAAGGGACATCGCCGCACCTA TGTGGGCGCAATGCCGGGTAAACTGATTCAGTGCCTGAAGAAGACTAAGA TTGAAAATCCTCTGGTACTCATCGACGAGGTGGACAAGATCGGCAAGTGA GTAAAAGGCTTTCATTAAGATATACTGTAATATAATAAATAACCTATTTT AGGGGCTACCAGGGAGATCCTAGCTCAGCATTGTTAGAGCTACTAGATCC CGAGCAGAATGCGAATTTCCTGGACCACTACCTCGATGTGCCGGTAGACC TCTCGCGAGTGCTCTTCATCTGCACAGCTAATGTGATCGACACTATTCCC GAGCCTTTAAGAGATCGCATGGAATTGATTGAGATGTCTGGGTATGTTGC CGAAGAGAAGATCGCCATCGCTCGTCAGTATCTGATGCCACAAGCGATGA AGGACTGTGGATTAACGGACAAGCATATCAACATTTCCGAGGATGCCCTA AACATGCTGATTCGCAGTTATTGCCGGGAATCCGGGGTGCGAAACCTGCA AAAGCATATCGAGAAAGTTATTCGCAAGGTGGCCTTCCGAGTGGTCAAAA AAGAAGGCGAGCACTTTCCGGTTAACGCTGATAATCTGACCACATTCCTG GGCAAACAAATCTTTAGCTCAGATCGCATGTACGCAACCACACCGGTGGG TGTAGTCATGGGTCTGGCCTGGACCGCCATGGGTGGTTCATCGCTTTACA TCGAAACCTCAAGGCGTCACATTCGCCAGGGGGCAAAAACAGATCCGAAC ACTGTCGCCGGATCGCTGCACATCACCGGAAATTTGGGAGATGTCATGAA GGAGTCGGCCCAAATAGCCTTAACGGTGGCGCGCAACTTTTTATATTCGC TGGAACCCAATAATCTGTTCTTAGAGCAAGAGTAAGTTTTTTAATTTGCG TTTTCTTATTTTCGTTAATCTATATATGTGGCCCTTACAGGCACATTCAC CTCCATGTTCCTGAAGGTGCCACACCGAAAGATGGCCCCAGTGCGGGCAT CACCATTATTACAGCTCTCGTATCGTTGGCCACTGGAAAGCCGGTGCGCC AAGATATCGCTATGACGGGCGAAGTATCCCTGAAGGGAAAAGTGCTACCC GTGGGTGGTATTAAGGAAAAGACGATTGCAGTAAGTAAAACAGAAATAAA TGATCTATTTGTGTGTAAATATAAATAAATCACCCTCATTCAGGCACGTC GTAGTGGAGTGAATTGTCTTATTCTGCCTGTGGATAACAAGAAAGACTTC GAGGAGTTGCCCACGTACATTACAGATGGTCTGGAGGTTCACTTTGCCAC CACCTACGAGGATGTCTACAAGATAGCGTTTACTGATGTAACCGAAACGA CAACCAACAATGTTGAAGAGCAGGAGCCGCTGCAGAAGCTTTCCAGTGCG GCCGCTGCCAAATCGGAGACGTGGCCTTATTCTTAGATTTAGCTTGGGGG TGTTGCGGGTGTTGATAGGTTTTATAAATATCTATCGTTATCAGGTTAAT TAGTTTATTTAGACCATAGCATTTGTTAATTCTAATGCCAAGTAAATTGA ATGTACCATCGAACTGAAGACAGTACTGCGTATATCCTAGACATCTGCAT TAGCCAAAATCCAGTCCAGGTAGCGATCCACGCGAGTGTAGATACCCGGG CGACCCCGCTGTCCGCAGCCGACGCCCCAGGACACGATGCCGATCGTGAC CCAGCGTTGGTTGGGAAGTTGTACCAACAGAGGACCTCCGCTATCGCCTT GACAGGAGTCCTGACCTCCTTCCGGAAATCCAGCGCACATGGCAGTGTCC GGAACGTGCTGTACAAATGACGACCTGCAATCGGACTGCTTCCAAACCGG CAGGTTAACCTGAAGATAGGAGTAATACATATTTTCTTAATTTAAAAAAG CTTTCTTTGTTATGTTCAGCTTGAGTTACTAAATTGCTGAAACCAATTTG TTTAGATCAATATAAGAAATTGAAAGCTTAAGAACAAAATAAAAACGCTG TATATAAAATGAAATATACTTTAATATGCGACCCACCTCCATGAGGATGT TAGAATGAGGACCGCCAAACTTTTGGGTGCCCCAACCGGTGACAATGGCG TTTCTATCCGACCAATCTTCGTTCACGGGCGGCATGCAAACTGGCCAGAT GTAGGTGTTGAATATAGTCGCCCTGTCGATTCTGACAATTGCAATATCAT TGTCGTAGTTCTGTGGATTATAATCGATATGGAGCACCATGTTGGCAATC CGGAAATCCCTCGCCCTCGTCTCATTCAGCATATGCGTGTTGTACTCGCC CAGACGCACGAAGATGTCCTCCTTGTTCTTCTTGTAGATGCAGTGAGCGG CAGTTAGGACATGACGGTCGGTGATCAGGACACCACCGCACCAAACGAAG GGCAGACCCTCCTGCAGCAGGGCCGCCATCCAAGGCCACTCGTCTGGCTC GGCTGGCCGTCCACCGGTGAGGCGGGGAAACTGCCTGGACGTGATCCCAC AACCTCGCTGCTCCGGCTTATTAACGATGCGCGGCTCATCACCGTCCGCA CTGGTCACGACTTGCGGACTAAATCGGTTGCTCGTCGACTGGTCAGTGCA GCAAATGCCTATGGAGCTGAAAGACAAATTATTTGTACATATAATACAAG GATGCCAAGCCATTAAGAAGAAAAATTCATATACCTTTTCTCAATGATGC AAAGCTGGGAGACCAGACGCCAGACATCATTCTTAAGTTCTGGCATGCGA CAGTAGATAATGTGGCGACATCGGCCGGATTCACCCAATGGAGTGCTACA TGCTCCATAATCCTTGTTCTCCTGCGGTTATCATTTGTAGTTACCTGATA CTGGTATGTATGCATAAGACATAAACTCACCAGCAATTGCGAGGTGGGAG CCTGTCGCTTGTTTAGGCGATGTTGGGACAGGAAACTTACGACGCGGTTT TCCCCAGTGCGATTTTCGTATACCTGATTCTCCGACTCCCCCCATTGAAA CTCATCATTATCGCTGAAGTCGAGAAGATCTGGGTGGTAGACGAAAATCT TTAGGTTTGGTTTACATTAGATTCTTGGAATTTGTCTTAGAAATATCAAG TATTTGGGTGAAATGAGTTTTAACTTTGATAAATAACTTTGCTATTAAAT GCACCTGCACAATTTTTTATGTTGGTATAAAAACGTGACTCACCTAAAAA ATCAGTGGATACAGTCTTGGCGATTGTACTCTGCGGGATATAGCCCAGTA AAATCACCAATGCCCAAAGAAATGCCTTCATTTTGAGTTATTTTCGCGAG TGCAGTGGGAATTTTAATCGCGTGTCGCTTCCGTTGCCCGCTGAATCAGT TCTGTTTTGACAGTTCTCCAACCAGCTAAAGCTACTTCTCCGATATGGAG CTGAGCTCAGATCGGCTCAATTTACATACGTCTTGCCTTGGATACTGCTG TTGAACCTGTTCGATGCGTCGACACTATGGGGTTTTCCTGGCTATTAAAG CGTCTTACTCCATGCTCAGTTCCCAGGCGAAAGCTTAATGGGATTGGAAC CGCTAGCGATATAGTAACTATTATATAATACTTGAGTTAATCCGAGCACT TGGCTTATCTGTAGGGCGGAAAGCGAGCCACTGAAATGACGTCCCCTTTA ATGCCTCTGAGCTTAGACCCAATTTGGTGTATTATCTCAATGTTGCTGGC AACAGCTTGGCAACATGTTGCCAGGGGCGAGTAGTGCCCATGATGATCAG TTTGGATTCTCCGAGGCGAACGTGATGTGCATCGCAAATGATCCGGTTCG GTGGGTTTTGATTCCATAGAAGTATCATCTCCGAAATACTAAGGAAGATT TTATACTCAGTTATATTCTCTATTTAATTGCCTTTTGACGCTTGCACATC AAAGTAGTAATAATAAATCAATTGCACGGCACAACCGGAATCGAAGAAAA CATTTGCGATGCACGGTTTGATTGTCACTGCAGAAATGATTTTAATGTCT TAATTTAAAACCCAACCCTTTAACATTTTAACATAATTTAAGTAATAGTA TTGAATGATGGAGGCGAAGAAAATGGAATGGGGCGACTTCAGTTGGCAGA TTATGTTATTATGTAATAAGACGAATACCGAATAAGTGTACTAAAAAATA AGTTTAAAATAGAAAGCGTCAAACAAATAATTAGTCAAAATATCCTTAAA AAATATTTAAAATATATTATTTTAATATTATTGCGAAGACCATATTTTTA TTATTTAACAATTTTTATAGGTAGAGCACTGGATTTGAATTTCTGGGAAT ATTATATGATCACATATACATATGAATATACATATATGCGGTGCTATAAA CTCATCGCTTACCCACTTTATCCTGAAAATTGGTTTAAAAATTATTATTT ATTATTTTTTAACAGGTATCTCTAAAATTCGACTATTGTCGTGTCATTCA AATGGTACAAATACAACTTCCTAGTCAACTCAAATGGCGTGCGAGTGTGT TACTTAATTATTAATCCCTGCGATTTAATTACCACCTTTCCCTGCCACCA TGATCACCTATAAAACTCTCCTACGACATGGTTACTCAACGTATTTAGCT TTCCGCCACCATGAAGCATTGGAAACGACGCTCTTCCGCTGTTTTCGCGA TCGTCCTGCAAGTGCTGGTACTCCTGCTACCCGATCCTGCAGTTGCCATG ACGATGGAGCAGTTCTTGACCTCGCTAGACATGATCCGCAGTGGCTGTGC GCCGAAGTTTAAGCTCAAAACAGAAGATCTCGATCGGCTTCGCGTGGGTG ATTTCAACTTTCCGCCATCGCAGGATCTTATGGTGAATGCCGCTTTCATT TTGCAGGCACCAGTGTTTGAATCCTTTATCCTTTTAGTGCTACACAAAGT GTGTGTCTTTGATGGCGGGCACTGTGAACAAAAAGGGGGAGTTCAACGCT CCCAAGGCGCTGGCCCAACTTCCGCATCTGGTTCCCCCGGAAATGATGGA GATGTCCAGGAAATCCGTTGAAGCTTGTCGGGATACGCGTAACTACACCC ACACTTACCTTTCATAGCTGTAAATATATGTAAGGTATATCTTTGCAGAT AAACAATTTAAGGAATCTTGCGAGAGGGTCTACCAGACGGCCAAGTGCTT CTCTGAAAACGCCGATGGGCAGTTCATGTGGCCTTAAAAATGTTTCTGGA AACTAAATTCATACTGGTTCATCCTTTAATGACCAATCCTTGGATGATTG CTTTATTATCTATGTTGAAATCATCAAATAGAATTGGAATTCGTAAAACA TAAATTATGACAAGAAAGGAAGTTAGCTTCAAAAAGCCGAAGTATATACT TATATACCCTTGCAGTAATATGATGTTGATTAAATTGAAACCAAAATTTA TATATTAAAGACAACTTATGTATACAGAATAACATCAATTTATGATTAAA AACGACGAAACTGTAGTTTGTGTTATATTATTTCATTCGAAACTCTATTT TCCGACTATTCGTATGCCTATATGACAAAGTCGTCCAATTCTGATTGAAT CAAAACTGAAATTATATATTGTCAAAGTAACAAAGAACATTTTGTTTAAA TTAATTTTTCGATTATGTATATACCCGCAATCGACTGAATTCGATAAGCA AATCTTTTTTTTTGAAAACAATCTTTAATCATATATTTGAAAACCTTTTT GTAGATTAAAATGGCACCCCAAAATATAAACACGCCGCATTGATTTCAAA CATGTTATAGTTTATTGCTGATATTATTAACTAAATACAACGGTTTTATG TTTGCATAACGCATACTTATACATTTTGTAATCGATAAACATCCAATTGG CTTAGCAATGCATTCAAACTTAGGGAGATCTTTGCATTCAAGAGGTTACA AAATAAATGCAAATCTTATACAAAATGGTTGCCTTGCAAATCTGCGTACA AAGTTCTCTGTAATCGAGAGTAATCGATATCTTAAATTTCGGTTTCGGTA TAGGAGTAGTGTCTTTATATATGTATGTAGATCTCTCCAAAAAGGGTCTC ACAAAAATATATCCGATTAGAGCGTGTGTGCGGATTAGTTGATGAATTTG ATGAGGATGTTCGAGGAAACCTGTGTAAACAACTAAGAGTCTAATGACAT TCACACGTATATATAGTAGTTAGTACATTGTATATAAAATCAGTACACAT TAATGCTTGTATATTGAACCGTTTGTTGTTAGCTGCTTTGGTTTGGTTTG GAAATACTTTTAACTGCTACACACACACATCTAAATAGGTTGGTGGTTCC GTAGACAACTATAGTCATACACATACACATATAGTTAGGTATATAATTTG ATATATCGTAGTTATAATTAGGTGGAGATTCGGGGCAAACCCTCGTCGAT TCCACTGGGATTGTGTAATGCCGTTGATTGTGTTGTGCGTGGGGACCAAA TAATGTCTGAGAGCTGGAGAGTGTATACAAATGTCGTATATAGGGGTTTT CTCCTTTCATAACTAGCCTAGAAGAGTTGCTTGTGCTTCGAGTTGAGTTT TCGTTAACATTACGATCTGGGATCACATTTGGGTATATCAAACAATATAG TAGAGAGCTAAAGCTTTTCCATCAGCCCTGTTCTATGCGATTTTAAGATT CCTTTGCAGGGCTTACACCATAAACTTGGTGGTCTTCAAGGGGAAGACGT AGAATTTGGTTTGTGCCTAAGACGTTTGAGCGAAGAAAATGCTTCTGGAC AGGATCCATTAAGGTGGTAAGATGACAGTAGACGATTGCTGAGTAAGAGT TCATTGTTCAGGAAGGGGTTGGTGGTAATTTTGATTATGTTTTCCCATTG CATGGACAACCATTGTCCATTATAGCTAGCTTACTTGTCGTCGTCATCCT TGTAGTCAATGTCATGATCTTTATAGTCTCCATCGTGGTCTTTATAATCT GTCGACGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCCGAGGATCC GCTGCCGCCGGCGTTGCTGCGCCACTCCATCTTCTGGCTATCCAGGATCT GGCGCAGGCTGCTGGCCATGCCCTGGAAGTACAGGTTCTCGGGGCCCTGG AACAGCACCTCCAGGGTGCTATCCAGGCCCAGCAGGGGGTTGGGGATGGG CTTGCCCTCGAGCTTGTACAGCTCATCCATGCCCAGGGTGATGCCGGCGG CGGTCACGAACTCCAGCAGCACCATGTGATCGCGCTTCTCGTTGGGGTCC TTGGACAGCACGCTCTGGGTGCTCAGGTAGTGGTTATCGGGCAGCAGCAC TGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGATCGGCCAGCTGCA CGGAGCCATCCTCCACATTGTGGCGGATCTTGAAGTTGGCCTTGATGCCG TTCTTCTGCTTATCGGCGGTGATGTACACGTTGTGGCTGTTGAAGTTGTA CTCCAGCTTGTGGCCCAGGATGTTGCCATCCTCCTTGAAATCGATGCCCT TCAGCTCGATGCGGTTCACCAGGGTATCGCCCTCGAACTTCACCTCGGCG CGGGTCTTGTAGGTGCCGTCATCCTTGAAGCTGATGGTGCGCTCCTGCAC GTAGCCCTCGGGCATGGCGCTCTTGAAGAAATCGTGCTGCTTCATGTGAT CGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTCAGGGTGGTCACCAGG GTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGT CAGCTTGCCGTTGGTGGCGTCGCCCTCGCCCTCGCCGCGCACGCTGAACT TGTGGCCGTTCACGTCGCCATCCAGCTCCACCAGGATGGGCACCACGCCG GTGAACAGCTCCTCGCCCTTGGACACCATGAATTCATCAAGTGGATCTTG GTTTGTGTGAACCTCGTCCAGCGGGTCCTGATTGGTATGCACTTCGTCCA TCAGTCGAACGCCGGCTTGAACGTCATCGGCCATGCTGACTCCCTTCTTT TTCTTGCCTTCGCCGGCGGGCTTCTTCTTGGTCAGGACTAGGGTTTCCGG CTCATTCTGCGACTGCTGACGCTTGCCATTTCCGCTGGCTCCGCCACCAC CACCTCCGCCGCCTCCCCCTCCGCCGCTGTTGCTTCTCAGCTTGAAACGC GTCGTGGCCGCCGCCGCATTGTTGTTGGCGCAATTGCATATGGCATCGAA GATCCGCACCACGAATCCTCGAGCGCGATTCACCACCTTGCCGTTCTTAA AATCTGGTATGGCGAAACCTGAGAGGTTAGTGCATGCGAGGCGCAGAGAG TACAAAAATACGGAAATAAAGATCAGTGATACGCAAAATACAAGTTAAGT GCAACAAAATATGGTCATGCAATCGAGCTGGCTGGGTTTTTTGGAAAATG GGTGAAAATGGCGTGCGAATGCGTTTATATATTCTAAATTATATGCTTTC CTCAGTTTTAATTGCCATCTGTTAACAACCGTGGAGGAGGCCCACAACGG TCGCCCTGTCATCAGTTAGTTAGGTCAGCCCACTTTTATCAAACAAGTTA CAACATTACGCGACAGTTCTCTTAATTTCAGCACGAAGATTATACTTTCC TAAATATTTGCAATATTTGAGATTTAGACCTCATCCACCAACTTTTAGCC TAGGCACTCTTAGGTGTCAAGCGAGTTCATTGCCACGAAAGTCATCGATA CAAAAATACTTAAGCAAGACTAAGAAAAGGATTTGTGCACAAGTGTCTAT TCAGCGGCCAGCACTTGGCAAGGGTTTGCGCTGAAGTGCTCGAAAGGGAA AAGCAATACACTATCCAAATAGCTAAGAAGTGAAATGTACTGAACCACAC TGCGTATACTTACTCGGTCGTTTTTCCTTGCCCTGCAAGGGAAGTTACAA GTTAGTTCAGTTAGCTCGAAAACGAATATTAGATATGTGTGGTCAACCTG TTGCGATTTCTGGCTCTCAACTGCCCGCCTGTTCGCCTCCGTCTCAGCCC GCAGGAGCACATCGTCGAGCGCCTCCCGCAACGCGGCCATGTTCTGGGGA TTTTGCTTGAAGGCCTCAATCCGCGCCTCCAGTGACTCCGTTTCGATTCC ATCAACGCTGTCCGGAGACGCTGGCTCGGGATCCGCAAATCTGGCATGCA TCTTTCCTGGGTTTTTGTGAGAATTCCTTTTTATCCTTTGAAAATGCTGC CAGAAGCGTTTCGAGCTTTGCCTTTGTCCTGCGATGGGTATCTACAAGGA GTGCTGAGCAGAGCTCTTTGTGCGTTCACCCAGCAATGCGCTGGAGAAAT CAATAGCAAGCCACTTGGGGGCCCATACCCGCACATGCGTGCTGACTGCG TGGGCAAGCTTTCGATTTGTGGGGTGGGAGAGCAGTCAGTTGATTTCAAC AGTTCGTTATTTACAGAACTGTAGCTTAATATTTCTATGGGAAATCCTTA AATAATGTTTTTTTTTTTGCTTGCTAAGAAGAACTAAATCCATTTTACAC AAAACGTGTGAAAATAATGATTTAATATTCTTCCTATTTGTGTGGTTACA TTTTTTTGGGGTAGGAACCCGCATTTTTTATTTTATTGCATACAATATGA CAAAATGTGGACTACGAACTAAGCTGGCTACTCCAGGTGCGAGAGATCGT CCAGCTCGGGCGGTGCGCGCACAATCTCCGTCTCAATGATCAGCGAGTTG GCGTCTAGGATGCTCTGAAAGATTGAACTGTTATACCATCAACTGCTGGC GCTTCGCTACCGGCAATAACACACACATTATCGCTGCTCCGCTGTGCAGC CGCTAGTAGACTGCCGCTCGAGCTTGAGTTCGAATTGGAGGCACTGGCAG CGTTGGAGGCCGCGGAGAGGACCACGCTGTGCGGAGAGCTGCCACGCCGC ACCACCTTCGCCTGGCCCTGCTGCGGCGAGTTCTGGGTGACTATCACAAA CTTTTGCGCCGGCTGGTTGGCCTGAATGGCTCTTATTTGCGGCAGGGACG AGACTCCGGGACTTCTAAAACAAAAGAATATTTAACCGCTTAGTAATGGG CATAAAAAGACATGTCAACATGGTTTCCATTAGGAATCAAATGCTTGGCT GGAATTTTATTTTATGCTTAAAAGTGTTATTTACCCCTGTCTCTGTGTGG TGGGCATGGACACTCGTCCGATGGTTGTTGCTGTTTGTGCTGCACTCGTG ATGGGTGCCGTGTTGATAGTGTTGGATGACAGGGTTACAATGCTTGAGGC GGGCGCATTTCGAACTTTGACTACTGCCTGGCACAGCGACGGCCCCAGGA AGCCAAAGTCGTTCTTGTAGTCCTCCGCTGTATCTGGCGCTGAGCGCATT TGCCTGAGAATCGGGGGACAGCACTTCTGAAGCATGGCGCGGATGTGACC TGCTGCTGTCTTGTCAGTGTTGCTGATGGAGGTGCCGAGCAGGTGAGGTT CAATGCGCTCCGATATGAACTTAAGGCGGGGTATGATGAAAACCTTTATG ACTTCGCCCCCCAGCTCCGAGAGACCCGCAATAGAGCCGTAAAGCGAGGA CAGGTGGGTCTTGTCGTTCTGCAGGGCCTTGCTGAAGATGCTGAAGGTTG GGAAATGGATGTTAAAAGGTTATTTAATTTAAGTGGATGTGATTTACCGG GTGACACGGGTTTGCAGATTGTTGGTTAGGGTATTGAAGTTCTTGCAGAT TTGAGCCATCAGTCGGGAGGCAAAGTCTCGCAGGGCCCAGTGATTGTCCA GCTCGGGGCGCATACACAGCTGTTTGGACACAATGCACGTCATCACCGAG GGTATCAGTTCGTGGAGCTATGCGGAGACAACATCGTTTTTATGAGAAAC AAAGAACAATACAATAAGAAATTTCTTACGTATTTCTCCAGAAACAGCGA AGGATTATCCAGAAGCGCACGAACCATGCGCATGAGGTAAATAAGCAACG CCAAGTTGTTCTGAACCACATTGACCTTAACTCCCTCGGCAATGAAGGTG CACATGCGGGGAAGCATTTCGTGCAGGCCAGGATCGGATCCCAGCGACTG CAGCGCTTCCCCGCGCCGCGGCTCATCAGATCCCACGCACGCCTCGGTGA TCTCCTTGTAGTACAACTGCTGCTCCACGGACAACTCGTGCGTGGCCAGT TGCTTGACATGAATGGTCTCCACGTTTTTCAGCTTGTGTATCTTGCCGGT GGTGGGTTTGCCTGCCGCATCTTTGTTTAGGCCTTGATCCATCTTAATAA CTGGATTGACCGAGTCCAGTAACTGGGAATCCTTCGAGAGCGGAGGGGGG TTTTCGGGCACAGTGGGTTGCACTCCCTCCACAACAAACCAATGGGAGCG CAGGGTGAGATCCAGGGGAATTTTTACAGAGTTGGTGGATGTGATTTCTC CTAGGTCGATTTCCTTGTCCTCGGTGAAGTGCAGCTCCCGTCCTCCGCCA GATGCGAAGCGGAATGGAATGAAGTCCTTGGCTACGAAACCGTACTGCGG CTCCACATTTCGCACCTTAAGGGACATGTCGATGTCCCGCACTGAGAGCT TCTGCCGCTTGGCGTGGTTCATGAACTTGGCCGCATCCTGTACAATCCTC TTCAGCTTGATGGACACATCCTCCGCTAGTTCCTTGGCGGCGTCATCCGA CAGGGAGCCCACTCCGATGCTCTCCGCGATCACCTTCATGGACTCCGCCG AGATGCTGGAGCCGTACAGCATGCTGCTGGAGGGGCTGCTCGGTTTCGAC GGTTTTCCACTCATTTCCCAGGTTTTTACAAATAAACAAATAATAATCGC CGAGCTGCTCGGCCAGTGTGCACACACCCAAAAGAGAAAATCTAGCTATT CTGGCTTTTTTGTTGTTTCATATCGTCTGCTATAATTAGTTTTATGGTCA CCTAAAATTTTGCTATTTGCGAGTTCATGTAAGGAATATATTCCCATAAC AAATATTTAGTTACAATAGTAAAAAAAATATAAGAATTCATTTTTAATTC ATAAAAAATGTCATATTAATATTACTGGTTTCACATTGTTATACAATAAT CGGCTTGTTTTTTTCCAGCTATTTTTGAATAGAATCCACTATTGTTCGCG ATAGTTGCCTGCTAAATTCCGCCGCAAGGTCACACTGTCGCGTAGACATC ACGTACACCCCAGCTGGGCACACTGAAACGCAGTCTTTTTCTTTATTTAT GTTCGTAAATTTTTGGTTGCCTGGCTTTTTGTTGTTGCGCCACATTAACA ATAACAATTGATGCGCCCCGCCACCGCCCACTAGTCGCGAAAAAAGTGAA TTATCGGTACCGCGGATTAATGTGCCACATGCGAGAAGCGTTGCAACGTT GCGCCGTCGTCGGGCGTCGAACAAAGCAGTTTTTGGGAAAGTGAAAACGG CGCCATTTTAGAAGCAGGCAAGCCACGGCCTAAGGCTCAAGAAAAGTGCA AATGCAATGTGTGCAGCAATAGATTGTCATTTCGGCACAAACGAAACCGA CTACTGAGGTCTACTACTAGCCCAGAAAACAATCAAGCGTAAGTGTGCTG TAGGTAATGGTTTTTTTTTTGGACGATGTCACCGCGGTTTGACCTACTTT AAAGGCGATTAAGAGTGCCACCAAATCGAATTAAAAACACTTGGCTAACA AAAGCGAACCTTTGCAGCTCCCCAGCGACTCCAAAATATGAGCTGTAGCC AAAATGAGACGGCAGCAGCAAAGGTTCTGGAAACGCAACGCGCACAAGAA TCCGGCAGTGAAAATGAGGCAAGTCTTTAAAATGGCACCCTTTATGCAAT GCTATATGTAAAGTGTGTTGTTCTCCTCAGGAAACCGATTCCATTACGGA TCAATCGAGCCAGTCGAAGTCGATCAAGTCAGCCACCCAGTTTAGCGTGC AGCGTTCGGACACCGATGGACTGCGAATGAGAATCTCGGCCATCCGCCCC ACGTTAGGAGTCGTAGCAACCAAGAAACCCCCAAAGTCCAGAAAAATGTC TACCCAGGACACCGAGTCCGGCTGCTCGGAGGCCAAAAATAGAGCGGTCA GCAAGAAAGTGAAGGTCAAGCGCAAGAAGCTGGCAAGTTCCAGTGGGATT AGTAAATCGGACAAAGTGTCTAAGTCTAAGAAGTCACAGATCTCGGCATT TTCCTCGGACTCAGAGGACGATCTGCCCTTGAAGGTGCATCAGCAGAGAG CTCCGCGAGTGCTGCTAAGTGCTATCATCCAGGCGGCACAGTCGGCCAGC AAACCCACCCTCGATATCGGAATCTCGTCCAGCGACAACGAGTTACCTAA CCTGGTGCAGGCGGCTATCAAGCGAGTGGAGAGCGATACGGAGGACACAA CTGTGGAAGGAAGTTTCCGCAAAGCGGCCAAGGACAAGAACCTACCCCAG TACCAGTCAACTTTGCTGCAAGACTTCATGGAGAAGACTCAGATGCTGGG GCAGACCGTCAATGCGAAGCTTGCGGAGGAGAAAGTGGCTAAAGCTAAGG AGGAGACCCTAGTCCAAACAGCTGTTCCTCGAAAGCGCAGAGGTAGACCC AAAAAAGTGGTTCCCACAGTTCCTGCCCCAGGAAACTCTGGCCCTGCTAT AAACGAATCTGCCGATTCGGGTGTGATAAGCACCACTAGCACAACGCAGA GCACTACTCCCTCCCCGAAAATGCAAAATGAGAATGCTGTGCCGACGGGA TCGCTGCCAATCGCCTCCAGCAGCAAGCCTAAGATCGACATGGCGTATCT GGACAAGCGAATGTATGCCACTGAGCGGGTGCTCTATCCACCGCCCAGGA GTAAGCGACGGCAGAACAATAAAAAGACAGCCTGCAGTTCATCCAACAAA GAGGAACTTCAGCTTGATCCGCTGTGGCGAGAGATCGACGTGAACAAGAA GTTTAGGCTGAGGAGTATGAGTGTGGGTGCGGCTAGTGGAACAGGAGCAA GCACCACTATTTGCAGTAAGGTCTTGGCCGCTAAGAGCGGTTACGTCTCG GATTACGGAAGCGTACGACATCAGCGGAGCAGCCACAACCACAACTCCGG TTACAAGTCCGATGCCAGCTGCAAGAGTCGATACAGCACCAAGAGTTGTA TGAGTCGCAGGAGCAGGGCAAAGAGCTGCGGCTACCGGAGTGATTGCAAG GAATCTGGAAAGTCAGGCCTAAGGATGAGGCGGAAGCGCCGGGCTTCCAT GCTCTTGAAGAGCTCAGCAGACGATACTGTCGAGGACCAGGACATCCTTC AGCTAGCTGGATTATCTCTGGGCCAGAGCAGTGAGGAGAGCAACGAATAC ATCAGTAAGCCGAGCCTTAAAAGCCTTCCCACGACAAGTGCCAGCAAGAA GTACGGCGAAATCAATCGCTATGTGACCACCGGGCAGTATTTCGGTCGAG GCGGTAGTTTGTCTGCCACCAACCCGGATAACTTCATTAGTAAAATGATG AACCAGCGTAAAGAAACCCCGGCTCCCAGCAAATCGTCCTGCAAGATTAA ATCTCGCCGCTCATCGGCAGCCAGTATGTGCAGCAGCTATGTGTCTGGGG TGTCTAGAATGCGTCGCAGACATCGCCGGAAGAGTTTCAGTCACAACAAA TCATTGAACATTGATTCCAAGCTGCTCACCGAAATCGAGATAATCACAAG CACCTTCAACTCAAGGTGTCGCATCCAAGATGATCGTTTGACCGGAAGCA GTGGCAAAGAGAAGCTATTGGCCGATGCCAACAAGCTGCAGGCCACCCTA GCAGCACCAAGCCCTGCCCAGCAGTTGACTCTGAATGGAGGAGGACCAGC TTCCACCCTTTCCAAACCATTAAAACGGGGCCTAAAGAAGAGAAAGCTGA GTGAGCCCCTAGTGGACTTCGCTATGCTATCAGCTAGCGCTAGTGGAACT CCCAATGGCAGCGGAAGCAGTAATGGAAATACCAAACGACGACACAAGAA ATCTCAAAGCAATGACAGTTCCAGTCCCGATGATCACAAGTTGCCGTTGA AAAAGCGCCACTATCTTTTGACTCCAGGAGAGCGTCCGCCGGCGGAAGTA GCATTCGCCAATGGGAAATTGAACGCAGAGGCCTGGGCTGCAGCCGCGGC GGCTGCTAAGAGCACTGCGTCTACCAAATCGCAAGCCCAGTTTAATGCTA GGAGCGTAAAATCTGCGCTAACGCCCAAAAAAAGACATCTCCTAGAGCAA CCTACGTCTGTGAGCGGAGCTGGCTCGTCGGCCAGTAATTCTCCCCTGAG AATTGTTGTCGATAATAATTCCATAAGTGGTGGAAAGTTGCTGGATATAA GTCCTAGTTCCTTGTGTTCCCTCAAACAGCAGAGGAGAGGAGGAGCAGCT AAACAGAAGGTGTCGGCAGCGAAGGACCTCGTTCAGCTTCAATCCCCAGC TGGTAGCTATCCTCCCCCCGGTGTGTTCGAGCCATCTGTGGAGCTGGAAA TCCAAATTCCTCTTAGTAAACTGAACGAATCCGTCATAACCAAAGCAGAG GTCGAATCTCCACTGCTCTCAGCATTGGACATTAAGGAGGATACGAAAAA GGAGGTTGGCCAGCGCGTTGTCGAAACCTTGCTACACAAAACGGGAGGCA ATCTTCTTCTGAAACGCAAGCGGAAAAAGATAAATCGAACTGGATTTCCC ACTGTTCGCAGGAAGAAACGTAAAGTTAGCGTGGAGCAGCAAACAACAGC CGTGATTGATGAGCACGAGCCGGAGTTTGATCCCGATGATGAGCCACTGC AATCCCTAAGAGAGACCAGGAGTAGCAATAATGTCAATGTGCAGGCGGCA CCTAATCCTCCACTGGATTGCGAGCGAGTTCCCCAAGCAGGCGAGGCCAG AGAAACCTTTGTGGCCAGGACCAATCAAAAAGCCCCTCGATTATCGGTGG TGGCCCTGGAGCGCCTACAGCGTCCTCAAACACCAGCTAGAGGAAGACCG CGAGGTAGAAAACCTAAGAACAGGGAACAAGCTGAAGCTGCACCTCAACC GCCGCCCAAATCGGAACCTGAGATAAGGCCAGCCAAAAAACGTGGCCGGC AACCCAAGCAGCCGGTACTGGAAGAGCCACCACCCACACCACCTCCTCAA CAGAAAAAAAACAAAATGGAACCAAATATTAGACTACCAGATGGCATCGA TCCCAATACGAATTTCAGCTGCAAGATTCGCTTGAAGCGGCGAAAGAACT TAGAGGCTGGAACCCAACCAAAAAAGGAGAAGCCAGTCCAGCCAGTGACG GTGGAAGAGATTCCACCAGAAATTCCCGTCAGTCAAGAAGAAATAGATGC AGAAGCAGAGGCTAAACGGCTAGACAGTATTCCTACCGAGCACGATCCCT TGCCTGCCAGTGAGTCCCACAACCCCGGTCCGCAGGACTATGCCAGTTGC AGTGAATCCAGCGAGGACAAGGCATCAACCACATCCTTGCGGAAACTATC TAAGGTCAAGAAGACCTATCTTGTAGCAGGACTCTTCTCGAATCATTACA AACAATCCCTGATGCCGCCCCCAGCAAAGGTGAACAAAAAACCAGGCCTG GAGGAGCAAGTGGGTCCTGCGAGCCTTCTACCACCACCTCCCTATTGCGA AAAGTACCTCCGAAGGACTGAAATGGACTTTGAGCTACCTTACGACATTT GGTGGGCTTACACTAATTCCAAATTACCCACTCGAAACGTTGTGCCATCC TGGAATTACCGAAAGATCCGCACCAATGTATACGCAGAGTCAGTGCGTCC AAATTTGGCGGGATTCGATCATCCCACCTGTAACTGTAAGAACCAGGGCG AGAAGTCTTGTTTGGACAACTGTCTCAACCGCATGGTTTATACGGAGTGC TCGCCCAGCAATTGCCCGGCTGGAGAGAAGTGCCGAAATCAGAAGATCCA GCGACATGCCGTCGCACCCGGAGTGGAGCGCTTTATGACGGCAGATAAAG GATGGGGAGTGCGAACTAAGCTACCCATTGCGAAGGGAACCTACATTCTG GAGTACGTGGGCGAGGTAGTCACGGAAAAGGAATTCAAGCAGAGGATGGC CAGCATCTACCTAAATGACACCCACCACTATTGCTTACATTTGGATGGAG GACTGGTTATCGACGGTCAGCGGATGGGCAGCGATTGTAGGTTTGTCAAC CATTCTTGCGAACCCAATTGCGAGATGCAAAAATGGAGTGTTAACGGCCT ATCTAGAATGGTTTTATTCGCCAAAAGAGCCATAGAGGAGGGGGAGGAGC TGACATACGATTACAACTTTTCGCTGTTCAATCCCTCAGAGGGTCAGCCC TGCAGGTGCAACACGCCCCAGTGTCGTGGTGTCATTGGTGGCAAGTCGCA GAGAGTTAAACCCCTTCCTGCTGTGGAGGCCAAGCCATCTGGAGAGGGAC TTTCTGGCCGAAACGGGCGCCAACGGAAGCAGAAGGCCAAAAAGCATGCT CAACGGCAGGCGGGAAAAGATATTTCATCAGCAGTGGCGGTGGCAAAGCT TCAACCATTGTCCGAAAAAGAAAAGAAACTGGTCAGACAATTCAACACAT TTCTAGTCAGGAACTTCGAAAAGGTTGGTTTACTTATTTTAATATACGAA ATATATATTAAAAAATATTTATTTATCTTTCATTAGATACGCAGATGCAA GGCCAAGCGGGCGTCAGATGCAGCGGCGACTGCATCCTCGCCAGCACTTG GCACCACTAATGGGGACATTCCTGGTAGACGTCCCTCCACACCATCTTCT CCTTCCTTGGCAGCGCAGATTTCCGCGCTCTGCTCGCCTCGCAACATAAA AACCCGTGGACTCACACAGGCAGTGCATGATCCCGAACTAGAGAAAATGG CCAAAATGGCTGTAGTTCTAAGGGATATTTGCAGTGCCATGGAGACCCTC AAAATGTCCGATTTGTTGACGACAGTGTCCAGCAAGAAAAAGAAGCCTAT AAAGACCACTTTGAGTGGAAAATTGGGTTCTACAGCTGCAACTTCAAAAG TGGAATTCAGATCGATACAAGCCCAGGTGGAGCAGGGACATTACAAAACG CCGCAGGAATTCGATGACCACATGCAGCAGCTCTTTGTGGAGGCCAAGCA GCAACACGGCGATGATGAGGGCAAGGAAAAAGCGCTGCAGTCCCTGAAGG ATAGCTATGAGCAACAGAAGATCGCCAGCTATGTTCAGCTGGTGGAGATT CTTGGTGATTCGGAATCGTTGCAGAGCTTTAAACCAAAGGAAGTGCTTTC GTCAGAGGAGGAACCTGGAAAGATAGCAGTGAAGAAATCACCAGGAGCAA AGGAAAGAGATTCCCCAATTGTGCCATTGAAAGTGACTCCGCCACCCCTG CTTCCTATTGAGGCCTCTCCTGATGAGGATGTAATCCGATGTATTTGTGG ATTGTACAAAGATGAAGGCTTGATGATTCAGTGCTCCAAATGCATGGTGT GGCAGCATACTGAATGTACCAAAGCTGACATCGATGCGGATAATTATCAG TGCGAGCGTTGCGAGCCAAGGGAAGTGGATCGAGAAATTCCCCTGGAGGA ATTTACCGAAGAGGGACACCGTTACTATCTCTCCCTAATGCGTGGTGATC TGCAGGTACGACAGGGCGATGCCGTCTATGTCCTACGAGACATCCCCATC AAGGATGAGTCCGGCAAGGTGTTACCGACGAAGAAGCACACCTATGAAAC GATCGGAGCCATTGATTACCAAGAGTGCGATATCTTTCGGGTGGAGCACT TGTGGAAAAACGAACTGGGAAAGCGTTTTATATTCGGACACCATTTCCTG CGTCCTCATGAAACTTTCCACGAACCATCGCGTCGTTTCTACCCCAATGA GGTGGTACGAGTTTCACTTTATGAGGTGGTACCCATTGAGTTGGTCATTG GACGCTGCTGGGTGTTGGATCGAACAACTTTCTGTAAAGGACGCCCCATG GAATGCAACGATGAGGATCATTGCTACATCTGCGAGCTGCGTGTGGACAA GACGGCAAGGTTCTTCTCAAAGGCCAAGGCCAACCATCCAGCCTGCACCA AGAGCTATGCCTTCAGAAAATTTCCCGAGAAGATTAAGATCTCCAAGAGC TATGCGGTAAGTTTAATATTTTAAATAATAATAACGCCAGTTAACTAATG AGCATTAATGTGTAGCCCCATGATGTGGATCCGTCGTTGCTGAAGACAAG GAAGCAAAAGACTGAATTAGACGTAGGAGCCGGGCCAACAACGATGCACA AGGTGTCTGGCAGGCAGGAACAGCATCAGGCCAAGATGGTTGGGCGAAAG CCTCGTGGGATCAGTGCCCCAGCGGATGCAACTGCTGTCCATGTCGTAAC ACCCGTGGCGCCCAATAAACAGGTGTGCAGAGTTTTGAACAAGTTTTGAA ATCAATCTATTACAATTAACTTTGTTTTCAATCTCCCTAAAGATGCTTAA GAAGAGGAAATCGCGTTTAGAGAACGTTTTGATAACTATGAAGCTTAAGT GTCTGGATGCACAAACGGCACAGGAGCAACCCATTGACTTGTCATACCTG CTGTCCGGACGCGGCGCCCGGCAGCGGAAGACCCAGCAGTCCAGTAGCAG TTCTACGGCCAACTCAACATAACCGATGTAACGCGAGTAGATTAAGCCGT GTATATACGCCTAAAGTTAGAGGCATTGATTAATATTTATGGAACTTCAA TTAACAATTAGCATTTAGCCATGTAAGATGTAACGGTGATAGTAGTAATC CTAAAGTGTACATTGTTATGAACAAACTTCGTGAAAGGACTCCGGTCCCG GCTAGGATGGAACAGATTATGAATTATGGTTAATATAAGGATTTATTTAA ATACTAGTGCTTACGCCACCGCACCAAGCCCCCAATTTAGATGAATTTCT TTTGTTTTTAATTGTTTATATTGGCTCTCCATATTAATTTTGTTTTACAA AACTATCCCCCTCTCGTCTTTGCAATTGAAGGCGTTTGACTTTTGCATTG TTATTTTAAATTATTGTATTATGTTATGGCTGCTTAATTATGTAACACCC GAGTAGGACAACTTATTGCGCTATTAGTTTTTAGTTATTTTCCAATTGTT ATTAACTGCTAACAAAAATTTTAAAAGTGAAATAAAAAATATATTTTTAT TAATCAAAGCCGAATTTTAAATGAACCGCCTGTTTAACACAAGTGTTGGA TTGCCTAACTGTCGCGTTATTCAACACTGCTTGCATGGGCGTAGTGAAGT TTCTGATTCGGGGGACTTCGAATTTAAGATTATGAATCACTTTGTTCTTG TATCGCAAAAATTCATTTGCTTAGAGTTTTTCTGCATTTTTTTTTGGGAT TAAAATAATAATCCCCCCTTAAATGTGTTTGCTTACGCCCATGACTATGC AAACAGATGTTCAGTGAAGTTGAATTGGATTGAATTGAATCGGCCATGCT GTGTAATATATTTAAACGCTCGCTTCAAGCGAATATAAGGAATGTGAATA ACTTAAATGTGCTGCGGTTGAGCAGTTCCAGTGGTCCCCGAGGAGAGATC CAGGACGCACTGGACATAGAGGCCAATCTATTCGGGAATTCAGATTTAAG GCATGAGCCGATGAACACGAGGGAAGCTTTACGCAAGAATCGATTTGCCG GTAGAAAACCAAAGGTGCCATTTGCCTCAGTTGCATCTCGCAACCTCTCA GCTCCATCTAATCCTGCACCACGAGTGGCTCCAACTCCCGCTCCAGTAAT TAAGGACAATGAGCTGAATCTGGAGTTTGTGCGTCTCACTCTGCAGGATC CACTTACCAGCACCCTACTAACCACAGTGCGCTCCCGCAAGCGCCGTGAT AAGAACCGGCAGATCATCGTCGAAGGCCGTCGTCTCATCCAGGAAGCCCT GCAATGTGGTCTCAAAATGGAAGTACTCCTCTTCTCCCAGAAAGATCAGT TGGCTCTGGTCAAGGAGGAAGTAGGCGTGGCACAGGTGGAGACGGGTACC AAGATTTACAAAGTGCCGCAGCACGACCTAAAGACGTGGTCATCGCTGGT AACTCCTCCCGGTCTGATGGCTATCTTCGACAGGCCGTCGGACAAAGGCT TGGAGAAAAACCTGGCGGAGCAACAGCGTCTGGGCTCTCAGCCCTTTCCC ATTACAGTTGTGTGCGACAACATCAGGGAGCCCAACAATCTGGGCAGCAT TATAAGGACCTGCGCCGCGCTGCCCTGCAGTCAGGTGGTGGTCACCCACG GCTGCTGTGATCCCTGGGAATCGAAGGCCCTGAGAGGAGGCTGTGGCGGT CAGTTTAGAGTTCCAATTCGGGATGATGTAACTTGGGATGAGCTCGCGCT AACCATTCCGCCAGAGGCGGCCGACGACTGTCATGTTTTCATTGCCGAGA CCAACCAAAGGAAGCGGGAGAACAACCAGACCATTGACTATGCAGATATC AAGGGTCTTGGAGCCCATAACTTGCTCATTATTGGCGGAGAGAGTCACGG AGTCAGTGAGGAAGCTTACCGGTAAGGGGGGAAACGAATAAGTTATAAAA TGGAATGCTAATTATGTTTTTATATTGTCAGTTTCTTAAACTTGGTTGGA GGTAAGGGAAAGTGCATCTACATCCCGCTGGCAGCTGGCATCGATAGCTT GAATGTGGCATCTGCTCTGACGCTGTTGCTTTTTGAACTGCGCCGAAAAC TCATTCATCAGGCATCAGAAAAAGAATAAGTTTGGAATAGCAACCGATAT AATTAAATGTATTTTCTTTAATTGTTAATTTCTATGACAAAGTGTATAAA TCGCAGTTAAATCCCATCAATAAACTTGAGTATATTTGTTATGATCCTTT CGAAAATACAATTTTCATCTTGTGTCAGGCATAATATAAATTTATTGCTA GGCTGTTTCACAAATATAGTAATTAATAATTACATTTAATTCAACTATTA GCTTCGATTTCCTTGTAAACCTCGCGCTTATACTCGTCCAGACCACCTTC GATCGCTCTGACTGTGCGATTGCCACACACCCAGAGTTCCTTGCAGACGA CCTTAATGAGGCGTTCGTCGTGGGAAACCAGGATTACGCCGCCCTAAGAA AGACAGTACACATGTATTTCATGGTGTAAATTTCCACTAAAGTCCACTTT ACCTTAAAGGCATTTATGGCTCGGCCCAAAGCATCAATGGTTTCAATGTC CAAGTGATTAGTCGGCTCATCGAGCACCAGGAAATTTGGCTCCGCTATAA AATAAATATATTATGTTGATGTTAATGTTATTGAAAGAAGATGGATAGTC ACTATCTTACCCATGCACATCTTTGCTAAGGCCACTCGTGATTTTTGTCC TCCAGATAAACTGGCAATGCTCTGCAGTGCCAGTGGTCCGGATATGCCGA AGCTGCCCAACTGCCGGCGATACTCTTCGTCCGGGCGACCAGGAAACAGT TCTGCCAAAACTCCCACACACGTTACATTCATATTCAGATGGTCCACATG GTGCTGCGCAAAATATCCAATTCGAAGACCGCGATGCAGGACAATGTTTC CGTGAATAGTGCTCAGTTGACCGACAATAATCTTCAGCAGCGTCGACTTT CCCGCTCCGTTTTCTCCGACAATGCAAATTCGAGAGTCCGATGTGGCTGA GAGATTGACGCCCTTGAAGATGGGCAGTGGATCTTCTGGATTGTAACGGA AAGTAACCTCCGAAATGGCCAGCACGGGAGGATTAAGGGGTTCCACTTCG GGGAATTTGAGCGTGACCACAGTCTCCTTTTCCACTGGCTTTAGTTCCGG CCTGCAAAGCGAACGTAGATGTTTTAAATTTCTTCCAGTCATTATTTTAA TTTATATTTTTGTACTTACAGCTTTTCGAGCATTTTAATTTTGGATTGCA CAGACGAGGCACGGTTTGCGTTGTATCGGAAGCGATCGATGAAGTCCTGG ACATGAGCTCTGTGAGCCATTTGGGCCTCGTATTCACGTCTTTGGGACTT CAGCTTCTCCGTCTTGGTCTTCTCGAACTGTTCATAGTTTCCCCTGGGGA AAAAACAATTTATATTTAAATTAGGCTACATTTTGTAATTTGTAATAGTT ACTTGTATGCCTCCAGTTCCTGGGAATGTAGGTGAATAATGTCTGTCGGC ACCGTGTCCAGGAAGTTGCGATCGTGAGAAACTACCAGAATGGTGGTGGC CCATGTCTGCAGATAGTTTTCCAGCCAAATAATGGCTTTGATGTCTAACA TGTTCGTCGGCTCATCGAGCAGTAACAGATCGGGTTTTGAGAACAGTGCC CTGGCCAAAGCAAGACGCATGCGCCAGCCGCCTGAGAAGGATTTAGTTGG ACGCAGCTGCATATCTGCATCGAATCCCAAGCCCTTAAGTATCACAGATG CGCGGGCCACAGCCTTGTCCGCCTCGATGTTCTGCAGAGAGGCGTAGGTC TCGCTCAGCTCATTGGACAGCGTCGCATCCTGAACTCCATTGTTAAGGGC AGCCAGAATCTCCTTCTCGCGGGTCAGAAGTCTCGTTCGCTCAGTATCAC ATTCCAGCACACTCTCCACTGCTGGTGTGTCATCGCCAACCACCTCCTGC TCCACGTGCAGCACCGATATGTGCGAAGGGATCTGTAGCTGTCGCTCGGC AATCATGCGGAGCAGTGTAGTCTTGCCCAGGCCATTGCGTCCCACCAGAC CATAGCGGCGTCCGTAAGACAGCAGCAGATTCGCATTCTGCAGAAGAACT CTAAATGGAATTAACAATAATTTTCGGTTGCTCAATTTCGACAGTTAGGT TGCCTCACTTTTCGCCAAAAGCCAGGTCAAAGTTTTCGATCTTGATGTCC ATGGATCGGTTAAGACCTTTCTGATCCAGCTTGGTGTTCTTCTTGTTGGT CACCTGTGAGGCTGTGGCCGTTTGTAGCTTCACCGCAACAGGAATCATAC CATGTTTGTTCACCTCCTGCCGTTTCTCCTGCTTCTGCTGCAGCTTGGCC TCCGCCTTTCCTAGTTTCTTGGAGTCCACTTTCTGTTAAAATAAGAATAG TTTAGTTGTTATTTAATGAAAGTCGTATTGATGGCGCCGTTCATTCAGTT TATTGGAGTGGTTCGTCAAGGGGAACACTTACATTGGCGCCATCTTTGTT GGCCACCCAGATGCTTTGCATATCCTTGTCCAGCCGCTCCATGTTCTTGG CCATCTCCTCGATGTTGACCGGCGCGTTGAGAACCTTTCGCTCCACGTTG ACCTCGTTGTTCTTCATGATGTTGAGGAACTGCTCGCAAAGCGTACGTAC ACTCTCCTCCGACCTATCACAGTCGACGCTCTGCAGGATGTCGCCCACCG CTTCGAAGATGTCATCGCCGCTTTCGAAGTCCTCCTCGCCTGGCAATTGG AATTTGTGTGCGGGGTAAAGAATAAAAGATCACAGGCTAGTGCAAGGCAC TTACTTCCGGTGAGCACGCCAACGACATAGGTGAGCAGCTCGTGGTCGAT TTTGGGAAACTCGCGCTGCAGAATGCTTGTGTACTCGCTCATCTTGACCT TGATCGCAAATTCGCTTTCTGGACGTGTGGCAGTCGGCTTTTAATTGACT TTTCCGACTTTTATTCCACCGCAAACGAAAACTAAAGGGGATAGCAGAGT GACCGTTGCTGGGTCGACTAAGCATATTTCAGAGATGGTCACACTGCTTT ACTTCTAATATTTTTCCCTACTATATATTTTTAAATATCAGATTTATTTT TTCCAGCAGTTTTAGCACCATCAAAATTTCACCTGATTAACAAAGAATTT CCAGTTTAGTTTAGTTTGTTGTTCATTTTTTCAATCACTTCATTGTACAG TGTGAACGTCTCTCAGGGTGACCAAAGAAATCCCAGCTGTTTTCACAGTT ATCGACCGTGTGACAGCTCTGTTATGTTAGCAACCACTGTTAATCGAATT GCATAAAATTCCAATTCTCTTTTGCAAGATTACTTGTGAAACGATTAAAA AAGGCAATATGCTAAGCAAAACGGGGTTAATTGGCGCCTTGGTGCGTAGA TCCTTCGGCACCAGTCAGATGTTGCGAGAGACGATCAAGAACCACGAGCC AAACAATCTGGAGCGCCGTATGTTGGTTTGGACCGGCAAATACAAGTCGC AGTCCGAGATTCCCAATTTCGTTAGGTAAGTGCCGATTCTTAGAGAGCAA ATGCAACAGGTGTCTAAGTTTTGGTGTCAAAACTTGCAGTCAGGATGTCA TGGAGCGCTGCCGCAACAAAATGCGCATCCGCCTGGCCAACATAATGATC GCACTCACCGCCGTGGGATGCGCCATTATGGTGTACAGTGGCAAGCAGGC CGCCAAGAAAGGAGAATCCGTCACAAAGATGAATCTCGAGTGGCACAAAC AGTTTAATGACTCTCAGCAGAGCGAAGGATCTGCTCCGGCCGCCAAATAG AAAATCACTCCGAAATCCCTCACTCGCCTAGTAATATTAGAACTGGCCAG GCTTCCATTTTCACTTCCAAAGAAGATTGGCTAAAACTGGCCTTAAAAGA TTTTGCTAATAATCAGTTGGTCTGAAGATTGTTGAAAATTTTTCTTTTTA AATTTAGATTTTTATTTTTGATTTGAATGTGTGCGTTCAACTAAAAAAAT TCATAATTATCCCAATTGGCCCATAAACTATGGAATGGAAAATGTTTGCA GGGCCAAATCTTTAGTGAATTTTTTGGCTTGGAAAGCACTTTGCCATAAG CATGTGTACAAGCCGTGTCCTTGATAGATATTCAGTGATATTTGTAATGT TGTATTATCAAAAATAAAACATATTTATTGCAAATCATGTTTGGGTGCGC TGGGTGAACCAAATTAATATTAAGATTTGGTCATGTTTTTATAAATAAAT TATAAATTAACTATAATTAATTAAACTATACATTTTGGAGATACAATTCG GTTTCAAGTAACTTTCTTTTTCGATTATATTCGATTCAAAACAGTATAAA GGTTTGCTAAGTGTGGGTAACAGGTAAGGGGCTAATAAACTATAGATCCT GTGAAAAATGCATGGCTATCGACTGCGACTGAATTGTGATATCCTTGATA TGAATCCATTGATATGTGGTATTAGCCATAAATATTTGATCATAGTTCAT TCGGAAGGCAACATGAACATCTGTTTCGATTCTGCATCGTCTTCAGAGGC CAGTGGCCACCACTTGCTCGTCGAAGTGCGCCGACGCCGTGAGCATCTCG CTGCTGTCCCGGATTCTGGTTCGGATTTGGGTTCGGACTCGCATGCTCCG AGTGAAACTACCGACTGTCGGAGGCGCTGGCGCTTTTGCATTTACTTTTC ACTTTCAGTTTGTCGAAAACTGTTTGTCTGAACGCCCCCAAGAAAACGCC GAGCGGAGCAAAAAGCGGGACGCAGTTTGGGCCAAGTTTTTTGTGGCCCC CGTGCGTGCAGAAAAGGCTGAAAAAGTGTCAGAAAAATTGTTTTTCCAAA AACAGACAGGGGCCAGCATCGAATTTCCCGGATCGAAAGCGTGGAAAATG TACACGCAGTAGTGCGGAAAATGTGCGGCTAACGAAAGGAGGAACGGATG AGGTGGGAAAAGTGTAAGAGGCGAGAAGTGTAAAATGCAATAAAACGAAA GGCGTGCGTATGTATGTGTAAACAGTTTTCCCCAATTTCCCAGCGAAATG CGGGCAGATGATGGACGATAGTCAACAGGAGTATAAAAAGCAATTGTTTA ATCAAACATCAGCGAAAGCAGATTGCCTTCCCAGAAAATCCATAAAAAAT GAGAGATTTTCCCTGTCTGTCTCTCTTGTTCATTTGTGTGTATGTGTGTG TGTGGGAGTGTGTTTCTCTGTGTACGGGTTTGTGTGGCAATATTCGTTTG CTTTTTTGATTTGTGAAAATGTGTGTATCCGCGAATGTTGCTGTTGTTGT TGTTGTTGTTTTTGTTGTTGCTGTAGCGCTCGTTCTCTCAGCAACAACAA CAGCCGTAAAAAATAACAGAAAACCAGAGGGAAAATAAGTGTGGAAAATT CACATCTAGTTCAAACCGCCCATATCCTTGCCATGCGGTTAGCTCATTTT AAAACACGCTTTTTAAGTGCACCTTATGGCGTGCCTGCAGCCCAACAACA AGTTGTTTTTTCTGCATAGTTGGCCTATTTAAATCGACAATCGCCTCAGC CCCCCTCTCCACACACGCACCACCCACTCAGGGTATTAATTTGACCAGCG GGCCAGCGAAAATAGAGAAACAACATAACACGTTAAAAAAGCGTTAGGCA CACAAAATATATAACGGTCGGTCCCACGAAAGTGAAGGTCGTCTGTAGGA GAGAAAGAGAGAGCGAGGCAGCCAGGAGCAAACAGGACACTGGGAAAAAT CGTTGCTTTCCGATATTTCTTTAAAAATTCCTTCAAAGCATAACAATAAT TCCTTTAAAATTTATTTTTACTGTTAGCCAGATTGTAGTGCTCCCATTTA CATTTTACTTACATATGAACATAGTTTTTTTGTAGTATTTCTCTCATTCA AATATAATCATATAACTTATAGGGATTTTGATGTGTTTCTTAACAATAAA TTTCTTATCTTATAAATAAACCCAACATTTGAAAATGTTGAAGTAGAATC CCGGAATTGGATTGCAACCTAACATTTATTTTCCCGATATTAATGAGTAT AATAATGCAGATATCAAATTTATGTACTATCCTTTTGCCCAGTGCAGCTG CAGTCCATTTGTTGGCGTAAATGTGTGAAAAATCCTTGGCTTGGTTTTTG GCGCAATAACAAAGCTGCACTAATACCAGCATCACCGATGCAAGCGCACA CACACACAAAGGCTTTATCTCTCTTCTATGTGTGTGTGTGTCTCTTTGAT GACGCGCTTAAAGCAGCAGAGGCAGCGCAGTTGCAGCGCAGTTGCAGAGC AGCTGCCGCACATCCAGTAGTTGTTGTTTTGTTATCATTGGTTTAAAATT ACACTTTTATTGCAGCTTAATGCACATGGACACCGTAATGCGGTTCTTTT ATTACCTCACCTCAAATCGATGGGGTTGATCTTAATAGAAATAAGTGCTT TTACTCTTGAAGATCTTAGTAATAATTATCACGAATATCCTGTAGTATTG AAGATTTTTTGTTTCGACCGCAAATTATTTTGCTACCCCTGGTTGTATCT CTATACATATATCTCTTACACCCCAATAAGCACATATAGTACACAATCCC GTACGTGGTCACAGTTGTACGCGTATTTATACGCAGATATAAACACATTT TACGCATGAAAAGGCTTAGCGGGCCTACATAAATTACGCCATTGGCCACA TCCAACCAAGCAACCACCACCCCATCGCTGTTAGCCGCACCATCCACCCA GTGCGACCCAGGATTTGGCTCTTTGGGCCACTTGCACGTCCACTGGACGC CCCGCATCATCACATCCCTTTGAACCGCTCTTGGTGTCCTGCTTGCCATG GCCATCAGGACGAAAGTTTTTCGGTGCTAGTGGTGGTGGATTCGCTACAT TGCAGCTCTTCCAGCTGACGATGTTGGCCAACTGATAAGCACGACTCTAT AAAGTTTTAATGTCTTTTGCAATTAATGCGAACAACGGCGGAAACTCCAA AGTTTCATCCTTGAACATCCCGAATCCCAACATTTTCTTATATTGTGTAA GCTATGAATTTGAGAAAAACTTTAACGGTTGAGAAGTATACGTATTGTAT AATGATTACATAGATATCACACAAATGATGTGGGTATAATAATAAAAGGT AATAGCCAAAATAACAAGTGTAAGGATCAAATAGTTGAATATGGAATACA TGTTATTTTGATTCAGTTTTTCCAAGTGCACGTGCCATTGAGTTTACCAG TTTCCAGCAACCCTTGCTTCTTCTTGTTGCTGCCCAGACTTGTTTCGGAA CATGAAATTTAAATAATAAATCACCTTGAAATCGAATTGCTGTCGACGCA TTCGGCCTTTTCTTGTATTGTCCTCTGGCACAACATGACGTATGGGCAAT GCTTGAATTAATAATAAGCATACGCAGTGTGTTGCGGCTACATAAAAATT AATATGCGAAGGATGCTGAAAGCTGGTCAATATTTTTCTTGCCAATGCAA ACAAATATTGTTGAAATTATTTTACTCCGTTTCCAAATTGAGATGATTTT AATTGTCCATGCATCAGTTGGCGAATAATTAAATGCATTTAATGCATGCC TTTGTTTGAATTTATAGCCAACATCGCGATGTTTATGATTCAATTACAAA TTTATGTTTTTTAAATAATTATTGCAATCGGCTATTAAGATATGTGAAAG ATTTTCTGTCCATGTGCAAATTTAATCCGAATAATTGTTTTCAAAAGCAA CAAATTTGATTATGATTCGATGTTTTAATATTATTATAATAATAACATAA GCATAATTAGCTTACCCGTTGGCAATGATAAATCTGCTGACCCAAAATGC AGTGCACTGGGTGTGGGATCAATATTGCAGCAGAGATATTTATAGAGCTC TGACGATTGAAAATAAATCGTGTATAAAACCGATTTAATTTTCATGGGGG GAAAAGGTGCCACTAATGCGAATTAGTTTCTTTGAAATGCTTGCCAAATA GACACCTTACTCGAGGAGACACCTTCAATTTTGTTCCTAGTGGGAGGATA CATAAAACCCTACTTAAGCGCGGCGACACACTCACGGGCAAAAGTGAAAA GTACAAGGAAAATTAGAAAATCTTTACAGGTCCCAGAGACAAATGGCGAA ATGTTTTTTGATGTTGGGCCGACGGCGAGGGCAAAGGCCCTCCTCATCCC CAAATCCAAACACCAACCCAAACCCGAATCCGAACCAATCCCAGTCCGGA TCCCACAGCCTAAGCCGAACGCTAGCCCGAAACCGAAACCGAGACCCACA TCCTTAGCCCGTATCCAAAGCCCAAGGGTCCTATGAGCAGGCGCAGAGAA AATGAGACTCTCACCCACTCTCCCTTTCTCACATTCTCCCATTCTCTCGT TCTCTCGCGCTTCTCTGCTCAGTAGTACATATTTCTCATTTTTCATTAAG CCGATGGAACAAATTTAAAAAGAACGAAAAAACTAATTGTAAACAAAAGA AAATCATCGCGGGGAAATGTGGGAAATTCGAAGCAGTTGGGAAAACACCG AGTATTTTTGGTCCGGTCAGGAGGTTGTTGTGATGCCTCAAAAATAGTCC AAACAACAACAACAACCAACTAAACACGTAAACATTGTTAACTTATTGTC AATAAAAATACAAAACTGAAATGCCCACCAGGCTATAAAATTGCCTTTAT GATCTGGAAACGCGTCCATTTCTTTTTGATTCGCATTTTGCCTCAAAGTT GCAGTTGTGTTCAACCTGCCCGCCGTTTCCACCCCCCGCCCCCCTCGATT TTCGCGAAAATGACTTCCGCTTCGAGAGGGCTAAAAAGAGAAAGTCAAAG TCGAGCCGCCATAATAAGGCGGGCCCACGCAATGGCTGCGATGGAAAATT CACAGGATTTCCGTAGATTTCTCGTGTGCTCCGCACATTAATGCCTAACT AGCATTTGGGTCCCGCAAATTGAATGGAACGGTCTCGAGGGCCGAGTGGG TGGTCCCGGTCCGCCTGCCTGTTTGTACTTTATAATAAACAAAAAACAAA TAATAAACATTAAAAAAACGGGCAGTCAGGAAACACAAACAGGGGTGGAA AAAAAAGGAATGCGATGCTGATATGCCCTGAAAGCAACATTAATAGATAA TAATTGCGGAGGCTCCGAGGTGTAAATTGATATGGCTATTCCCATGCTGA AGGTCAGAAAAGTATGCTATATTTATGCTGAGCACTGTGCCATGATGGTG GTACCTTTGTATATAGAAGAAATCTTAAATTATTATTATTTGCTAAAACA AAACAATTAATTATGTTAAATTGCTTATAAATTGTTTTGGAATAATAAGC TACAATATCCTTTAAAACCAATTTTTAAATCATAATAAAGTCCAACAGAC GGCTTGTTGGTTTATTTTCAATAGAAAATCTGATTCGATATATCTTCGCA TTACTAAACAATATATTTATATCATTAATTATGTAAATTGACCTTTCGGA CAAAGAAGTTCTTAGACCGAAATTGATTGATGGCTGATAATCTACTGGGA GTTCATTTCGCTCACCTTTCAATTCAGTTTAAATTCGAAATTTTCTGATT GAAATGTTTATAATGGCTGTCACAGTTCAAGACCAAGTCCGAATACTCCC ACTCGAATGAAAACTGAAAAAGTCTCACATTGTTGGTTGTAGGGAACAAG GTATGGATGAATGGATGGATAGACAGATGGGTGAATGGATGAATGGATGG ATGGATGGATCCACATCATTATGACGAGAGAGATGCTTTGTTGCCGCATG CTGTTGTTCTGTTTTTGGTCTATTTGCGGCCCCCTCCCTCCCACGGAAAA GTGAAACCTTGAGACGAACTGTAACTAAAAGCAGCCAACTAACTGGCAAA TAATTAGGCAGCCCCGCGCCACGCAAAACTAAAATAAACTATGCAAATAA TTAATGAAAGCACAGGGTGGGACAAATATGTATAATAGGGACATGTGGCG CCTTTGTTTCGCCAGCAGCCGGAAGTCGCATTCAGCAGCCCCGTTTGGCG CCAAGGTGTTTTCCACCGGACAGCCGGACGGGTCACAGCCACCCACCACA CCAGCCCACCGACCTTGCCACCTCGTTTGCTGTTTGACAATTTATTCTGG TAGCACACACCACCCACCGAACAGGCTGATCCTGCCGCTGAATTGCCTGA TGGCGATGTTGAAGCTATCCTTGAATCGCCCAACGACACCCAGACATCAT CATCAGCGTCAGCAGTGAGCGGTGGGTGGTGGGAGGTGTTAGGTGAGCAG GAGAGCAAAGCAAACGGCATTGATTAATTTCCATTTCGCACAATGCGAGC TAGAAAAGCAAGGTCAACGACAAGATATACACTATGAGAAAAGAGGATTT AACATTGTCAAACTCAATCAAAATCAATAATAAATAACAAGCTAACATGC CTATAAAAATAGGTAACGGTTAATGAAAAATATGTTCTAGTCATTTTCTT TTATATTTCGACTCGATTGACTCCTTTCTATGTATAGTTTAAACTCAGAC TTGAGTGGCTTTAATGTGACATAAAAAAGATTATAAACATTGTTGAAGGA CATTTAAATTTAAATACACCTTCCCACAATACGAAATTATTTACCAAAAA CATTTATTCCTATCAAAAAATTTATCTTCAGACAGTGTAATTTTTTCCCG TGTATTTCTTTGAAGAGTAATAACGTCAATATATAGAGGAAATTGTTGAT AGGATAATGCGGCATTAAAACATTAAGGCCTGACACTCAGCTGGGTTTCA AAAAGTGCTGGTGTGTGTGTGGGTGGTAGTGGGTGCTTCTATGGGGTGTG GGTTCTGTGGGAGTGGCAATCAAGGTTGAATCTGTCGGTTTGTTTGACTC TTCTTTTTTCTTTAATGGGCGCAAAATTTGTTTGCGTATTGTGTGATGTG ATGCACTGGGGGAACTGAGCTTACTAGTTTTGTTTTCTACTACTATTCAT TTTGAGCTTCTACTATATAAGAATGTATTAATAACATCTTATATCCTTTT TATACATTACTGTAACAGTTATTCAGCTCAAACAATGAGTCGCTGCCATC AATCAAAATGAGACCCTAATATCTATTTTGCATGTACTGCATGCAAATAC AAGTTAGTACTTGTGATGTAAGACAAGCCCAGTCAGTCCATCTCAACCCC ATTCTCATCTATCACTTGAGCTAACCTTCTCTAACCTTAGCGTTCAACTA CCGACAACCTTTTTGTGACCGTGTCGTGTCTCACTGGTTTCCATTCAGCA AACTAATAACTCCTAATGGCTATTGTTATGGCAACGCCGAATGACAAACG CCACATCCACTTTAACCCGAAACACCTTCAACTTTTCCTTACTTTCAAGA ATCATTTGGTTACTGCAAGGAAAACTTTGGGAAATCATCTAACTGAGTAT ACACTACAATTTGGAACTACAACACAAGAAATTTCTCTTGTTTAGTATTC AATTAATAAAATAAATTTTGAACTCCTAATTATTTTGGCTGTATTAAAGT ATACTAGGACATGGAAGAAATATCGAACTATTTACAGGTATAATTTTTCG ATACATCCTATATATAATTGGAAAGCGCAGCTAGGAGACATTTGATAGAC ATATATATTTTTAATCAGAACCAAAAGTGGAGTAGATATAGCCACGTCTG CTGGTCCATCCCTTCGTTTTTACTCAAACTGGTCTTTTAGTGGTAAAGCT ATCTGCATAAAACTTATCCAAAAGTCTTTTATCTGATGAAGGTATAATAA AACGAATATTAAACCCTTTGATAATTTTAGGCTTTATTTTGAGCATATAG CTATCATAGAAAACGGACTAATAACAATCGAAAATATTAAAAACGAAATC TAAGTTTCGTTATTTCTGATCACCCAGTGATTCTTACTCGGCATTTAGAG GCTTGCTTAGATATGAAACCACTGCAAGCGTATATAAAATTCAGCGTGAC GACTGTTGTTTTTTAAACCACATTTTCTTTTAAATACTATGTGATGAGCA TTGTTTCACAATTTTTATATTATATCACGCATCTCCTAGTTGACAGGTGC CCTTAAATATACAACCATTTTTAATAAGGGTGCGTTAAACAAATTAAACT GCTTTTTCTGGTAGTGCAATCGATGTGCTCTTGGTTGGAATTATGTAGCA ATGGAGTAACAATCGTGGCAGTGCTAGAGTAAAACAACTAAACACAGAGC CATAAATATTGTATAAATCAAAGAAACACATTATATAGACTTCAAGAGTC ATGCCAAGCCATGACATTTATGGAAACAAATGACTTTGTGTCACAGTTCC CAAGTTGGGCGGTTAGTTGGGTGGGTGCTTTGTCGCCGCGAAGTGGGCGC AAGGCCAAAGGACAGATAAGAAAACTTTTTGCGTTCTAATTGTTGTTGGG AAAATGACTTGTGGCCCAAGGAAGATTTGCAGGGTGTTTACTGTCCATTG AAATGCACATAAATTTGTTGTGCGACTGGCGAAATCGAGCAACAAAGCCA CCCACGCATCCCACCCAATCTTTCGCGTACACTCAAAACGGAATGCAATG GAAAATCCTAAAACAGATTAAAATTTTAGCATGGTATGTAAAAGGCACAC TGAAAACAAATAATACGAAATGAAACGCCATTATATGTCTAGTCTGAATT CATTGACTTATTAAAAGTAATTGATATGTAAATCTTCATTTAAATCTAGT TCTTTCTCTAATTAATTTATTTTTTATGGAATGTCGGTGTATAAAATTAT ACCTATTTTATTTAAAAGTGGAAAGAGTATTTGTCACTATGAATTGCAGT TTACGTAGTGACGAAGCGCACCAGAGAAGTGTGCTTAGATCGCTACGATA CGTACGCAAAAG