##gff-version 3 ##date Tue Nov 28 12:13:54 CET 2023 ## exported from the transgeneomics system molecule_59059059 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59059059 mpicbg region 9631 22178 . + . Name=dmel-5.43-2L;type=genome;start=396843;end=409390;strand=+ molecule_59059059 mpicbg region 22179 22251 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59059059 mpicbg region 22252 23240 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59059059 mpicbg region 23241 47754 . + . Name=dmel-5.43-2L;type=genome;start=409391;end=433904;strand=+ molecule_59059059 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59059059 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59059059 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59059059 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59059059 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59059059 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59059059 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59059059 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59059059 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59059059 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59059059 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59059059 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59059059 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59059059 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59059059 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59059059 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59059059 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59059059 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59059059 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59059059 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59059059 coding_transcript gene 17093 20757 . + . alias=l(2)k16513;alias=CG4033;identifier=FBgn0003278;alias=RpIII135;alias=DmRP135;alias=RNA polymerase I;Name=RpI135;alias=RP135;id=51280884;ensembl=FBgn0003278;alias=RNA polymerase I 135kD subunit molecule_59059059 coding_transcript gene 20818 28625 . - . Name=alpha-Adaptin;alias=alpha-Adaptin;alias=dAP-2a;alias=alpha-adaptin;alias=cg4260;alias=D-Ada;alias=MENE(2L)-A;alias=alpha-Ada;alias=alpha-adaptin;alias=D-alphaAda;alias=CG31654;alias=AP-2alpha;identifier=FBgn0263350;alias=AP2;alias=MENE (2L)-A;alias=l(2)06694;alias=alpha;alias=Alpha-adaptin;ensembl=FBgn0263350;alias=alpha adaptin;id=51447764;alias=alpha-Adaptin;alias=Alpha-Adaptin;alias=ada;alias=CG4260;alias=alphaAdaptin;alias=alpha-ada;alias=AP-2 molecule_59059059 coding_transcript mrna 20818 28625 . - . Name=FBtr0089488;id=51447793;parent=51447764 molecule_59059059 coding_transcript exon 20818 23315 . - . parent=51447793 molecule_59059059 coding_transcript three_prime_utr 20818 22175 . - . parent=51447793 molecule_59059059 coding_transcript mrna 21664 26735 . - . id=51447853;parent=51447764;Name=FBtr0089489 molecule_59059059 coding_transcript exon 21664 23315 . - . parent=51447853 molecule_59059059 coding_transcript three_prime_utr 21664 22175 . - . parent=51447853 molecule_59059059 coding_transcript cds 22176 23315 . - . parent=51447793 molecule_59059059 coding_transcript cds 22176 23315 . - . parent=51447853 molecule_59059059 CLC misc_recomb 22252 22285 . - . Name=FRT molecule_59059059 CLC cds 22293 22364 . - . Name=BLRP molecule_59059059 CLC cds 22365 22385 . - . Name=TEV molecule_59059059 CLC cds 22386 22409 . - . Name=Precision cut site molecule_59059059 CLC cds 22410 22451 . - . Name=V5 molecule_59059059 CLC cds 22458 23174 . - . Name=SGFP molecule_59059059 CLC cds 23181 23240 . - . Name=2xTY1 molecule_59059059 coding_transcript intron 23316 23381 . - . parent=51447793 molecule_59059059 coding_transcript intron 23316 23381 . - . parent=51447853 molecule_59059059 coding_transcript exon 23382 23586 . - . parent=51447793 molecule_59059059 coding_transcript cds 23382 23586 . - . parent=51447793 molecule_59059059 coding_transcript exon 23382 23586 . - . parent=51447853 molecule_59059059 coding_transcript cds 23382 23586 . - . parent=51447853 molecule_59059059 coding_transcript intron 23587 23639 . - . parent=51447793 molecule_59059059 coding_transcript intron 23587 23639 . - . parent=51447853 molecule_59059059 coding_transcript exon 23640 23923 . - . parent=51447793 molecule_59059059 coding_transcript cds 23640 23923 . - . parent=51447793 molecule_59059059 coding_transcript exon 23640 23923 . - . parent=51447853 molecule_59059059 coding_transcript cds 23640 23923 . - . parent=51447853 molecule_59059059 coding_transcript intron 23924 23976 . - . parent=51447793 molecule_59059059 coding_transcript intron 23924 23976 . - . parent=51447853 molecule_59059059 coding_transcript exon 23977 24910 . - . parent=51447793 molecule_59059059 coding_transcript cds 23977 24910 . - . parent=51447793 molecule_59059059 coding_transcript exon 23977 24910 . - . parent=51447853 molecule_59059059 coding_transcript cds 23977 24910 . - . parent=51447853 molecule_59059059 coding_transcript intron 24911 24978 . - . parent=51447793 molecule_59059059 coding_transcript intron 24911 24978 . - . parent=51447853 molecule_59059059 coding_transcript exon 24979 25568 . - . parent=51447793 molecule_59059059 coding_transcript cds 24979 25568 . - . parent=51447793 molecule_59059059 coding_transcript exon 24979 25568 . - . parent=51447853 molecule_59059059 coding_transcript cds 24979 25568 . - . parent=51447853 molecule_59059059 coding_transcript intron 25569 25631 . - . parent=51447793 molecule_59059059 coding_transcript intron 25569 25631 . - . parent=51447853 molecule_59059059 coding_transcript exon 25632 26087 . - . parent=51447793 molecule_59059059 coding_transcript cds 25632 26087 . - . parent=51447793 molecule_59059059 coding_transcript exon 25632 26087 . - . parent=51447853 molecule_59059059 coding_transcript cds 25632 26087 . - . parent=51447853 molecule_59059059 coding_transcript intron 26088 26296 . - . parent=51447793 molecule_59059059 coding_transcript intron 26088 26296 . - . parent=51447853 molecule_59059059 coding_transcript exon 26297 26508 . - . parent=51447793 molecule_59059059 coding_transcript cds 26297 26508 . - . parent=51447793 molecule_59059059 coding_transcript exon 26297 26508 . - . parent=51447853 molecule_59059059 coding_transcript cds 26297 26508 . - . parent=51447853 molecule_59059059 coding_transcript intron 26509 27245 . - . parent=51447793 molecule_59059059 coding_transcript intron 26509 26574 . - . parent=51447853 molecule_59059059 coding_transcript exon 26575 26735 . - . parent=51447853 molecule_59059059 coding_transcript cds 26575 26674 . - . parent=51447853 molecule_59059059 coding_transcript five_prime_utr 26675 26735 . - . parent=51447853 molecule_59059059 coding_transcript exon 27246 27504 . - . parent=51447793 molecule_59059059 coding_transcript cds 27246 27309 . - . parent=51447793 molecule_59059059 coding_transcript five_prime_utr 27310 27504 . - . parent=51447793 molecule_59059059 coding_transcript intron 27505 28292 . - . parent=51447793 molecule_59059059 coding_transcript exon 28293 28625 . - . parent=51447793 molecule_59059059 coding_transcript five_prime_utr 28293 28625 . - . parent=51447793 molecule_59059059 coding_transcript gene 28919 32386 . + . alias=Tb11;alias=ebi;alias=E-2f;ensembl=FBgn0263933;alias=Ebi;alias=Ebi;alias=beta transducin-like 1 protein;alias=CG4063;alias=E-2g;alias=Enhancer on chromosome 2-complementation group 2g;identifier=FBgn0263933;alias=Tbl1;Name=ebi;id=51273858;alias=l(2)k16213 molecule_59059059 coding_transcript gene 32284 33492 . - . ensembl=FBgn0031252;id=50788158;identifier=FBgn0031252;Name=CG13690 molecule_59059059 coding_transcript gene 33781 34556 . + . alias=Rplp1;Name=RpLP1;alias=RpA2;alias=RpP2;alias=LP1;alias=rpA2;alias=rp21C;alias=M(2)21C1-2;alias=RLA1_DROME;alias=Ribosomal protein P2;id=50992936;alias=CG4087;ensembl=FBgn0002593;alias=Ribosomal-protein-A2;alias=ACIDIC RIBOSOMAL PROTEIN LP1;alias=rpP2;alias=M(2)21C;identifier=FBgn0002593;alias=Ribosomal protein LP1;alias=Ribosomal protein A2;alias=rpa2;alias=Minute(2)21C molecule_59059059 coding_transcript gene 34737 35257 . - . ensembl=FBgn0031253;identifier=FBgn0031253;alias=BcDNA:AT13539;id=50511571;Name=CG11885 molecule_59059059 coding_transcript gene 35650 36285 . + . Name=CG13692;ensembl=FBgn0031254;identifier=FBgn0031254;id=50788404 molecule_59059059 coding_transcript gene 37302 39141 . + . alias=CG13691;alias=BBS2;id=50788370;ensembl=FBgn0031255;identifier=FBgn0031255;alias=BBS8;Name=BBS8 ##FASTA >molecule_59059059 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACTCTTCTAGGTCCAATATATC TTCCTGATTTGTGTATTCCGTAAAGGAATATGTATTCTGATTAGAAGTTT CTGTTTCAGACTGCTCTGACTCATTTTCTTGAGTTTTTTCTGGAAACGGC AGTGCCCTAAGTCTCTGCACCATGTCCTCAAGGGTTTCGGGGGCTTCCTT CTGAATAGCTTCCCTTCCAGAAGATCGCTTCTTGGCCGCATCATCCTGTC GAGTGGCAGCACACAACTTGGTTTGTGGCATGACATGCCTCGTCGTAGTC TTGGGGATGGCTCCCGTGGATTGTAGTTTTAGTGCTACCTGACTAGCAGT GGTGGTCACCGTCACAAAACAATCTGCTCCCTCGGCTTCCTCCTCGGGAT GACGGACAATCCTAGTGCTGGCTTCGGAGCTGGTGGCTTCTTCGGACGAA ACAGTTTGTTCCACCAGTTCTGCTTCCTGACGCCGAGTAGCTTCTCTTTC CGCAATCCTGTTGATCATGGCTGTGCCCCTTTCAGATGTGGAGCTCAAAC GGGCAATCAGTTCGTTTCCTTGAAGCTCCAGAATACGAAGACGTTCGGCT CTAGTAGCCGATACCCTTTCAATGTCCTCCAATCGTTGCTCTAAAGTCTG CGACATGCTAGTGGAGCTTCGATCCTGATCCAGCTGAGGATTTGGGCCGT ACTGTTCATGTAGGGTATCCAATTTGGTAGCAAAGTTTTCACCGCGCTCA GAATTTCTTGTGAGCTGCGATATTAACTGTCGACTTTCACGCTCCATACG CTGAATCCTCGCTGCCCTTCTGGATGTATATTCCTCTTCCTCAGCGGTGA GAGGAGATGTAGCTGGACAGGATTCACTTTTCGATGCCGGGATTGCTTCC TCCTCTGTGTTACTTTCGAAGCTCGCCTCTCTGCTTGGTGCTCTTCTAAT CCTGTCCAAAGATTTTTTAAGGTAGTGACCTCGATCGGCAGTGCGCCTAA TCCTTGACATCAGTTGGCGCGACTCCTCTTCTAGGCGACCCAACCGCTCC GATCGTTTCCTTGTGTACTCTTCCTCTCGCGGTGTAAGGCTTCCGGTGGC TGGTGCTGAACTGGCCCTGGTCATTCGCTCCATGCGCTTCCTGTTTATGA ATTCCTCCAAGGGCACAGCATGTTGCGCGGGAGCGATGTCATCCTGAAAC TGGCACAACTGAATCTCAAGGCGCTCCCGATTTCCAGAGGTTTCTAAGAC TTGCTGAATAAGATTTTTACACTGCTCCTCAAGCTTCTGGATGCGACTGG CTGTTCCTGCTGTTTCACTTGACCCTTCCACACTTCTTTGTCTGCTTCTG GAGCTGTGTAGCGACTTAGGCAGAAGACCATGGGCTCCTTCCTCTTCTAG CTCGTCAACATCTTCTCCTTCTTCAGCTTCTTCCCTCCAGCCGCAAGTAG GTGGAGCACTGTTCCAGCGAAGAACGATATTATCAGCCTCAGCTTCCTCG CCTTCGAATCCCTGACGCCCAGGGGAAGTGCTTTGCATTCGCTTAATTTT GCGCGTATGCTCGAATTGATCCCTAAGAAGCTTTCGGCGACAAGTGCTCG ATGAAGTGGGGGCTTCTACAGGATCCACTGTACCCAGATCTCGCTCCTCA TCCGATTGGGGACCCGAATCGCTGTAACCACTCTCAGCCGAGTGATTTGC ATCCTCTAATTTTCTCCTGGCGAATTCCCTGCGCCACTCGTCACACTGCT CCTGGCTCTCGTCGTTCTTAGCCCTGGCCAATGCCCATTTCCTGCGGCAG TACTCCAGCTCATCCTTAAGTTCGCTCAAGAGACGTCGCTTCTGCTGCAA CTGATAGCGAAGGATCTGCTCCTGTGTGTGCAGTTGGCGATGCTGGCGCT GCATCTTGCCCACTAGGTGCCAGGTTTTGGTTAGCTCCAAGCTCACACCG CTCAACCGCTTCTCCTGTTGGTTGAGGCGGTAATCCAGATGGCTGTTAAG GGTTTTTAGTCGGGTTGTCTCCTTCACCAGCGACTTCTTCTCCAGAATAA GGTCCTGAAATAAAGAAAGGCATTGGTTTTTTGACGGTACTTAGCAAGGC CTTGGCCAGCCTGAAGTGAAAACTTCTAAAGTGCTCTATCGCGAGTTTAT CAAACTTTTCAACCAATTAGAGTTCAAGCCAAAATAACAATGGTAGCAAG AAATTAAACAATAATGATAGATACCCTTCTATTTTTGAAGTTCATTAGCT TAAGTTCTAAAAAGATTGTTTCCCATACGCTTTAATACTTTATTTTCCCT GTGGATTATCACAGATTAATGTGAATAAATGTCTAACGCTTTCGTAAGCA CTTTAAGTACGAAGACCAAATATTTTCCTGAATTATTCCTGACATTAAAA AAATACCTGACCAGAACCAAAACAAAGTAGAAATAGCCGCTATTCAAGGG TAGCTAAGTGCAACATGTTCGGTACCAACGGCAACTGACCGATAAATTCA ATTATGTGCACGACAACGGACTCGACTGATACGGCCTTGGCCCCATAGAC CCACCCACTTTGCTCGATGCTCCTCCACTTCCTTTCTACATCGACGCTCG GCAGGATGTCAGCAATAATGAAGCTGCTCGTGCTCGGCCGCTCGCTCGGC AGTAGACTAAAGAAAACGCTTAAGTGAATAATGCAAAACTTTGCAACAGC CACAGACAGAACTCCATGACAGGGGAGTCTCGGAGGCGGATGGGTGCGAT TCTGGCGGGCTGCACTTCATCAGCAAACCGGATACGACAACTAACAAGCC TGATTGTCCGCAGCACTTGAAAGAGGGAAGGGACCGTTGAAGGATCTGCG ACTTAACTGACAAAAATTCTTTCCTTTTCTCTACTTAAATACATAATACA TGTTTTCTATTATTACTTCTGCAAGTTTGTTCGAAAATGAAAATAAATGC AAAAATAACCTCATATGGTAGTAAATACCGATTTTGGTTTAGTTTTTTGC AGTGCAGTAACTGAAACTTGGCAGCTTGGGCTCACCTTTAGTTTGATGTA GGTTTTGCTGACGCTAAGCTCCGGTGGCTTGCGGTGGGACTCTCCCTCGT CCTTGCCAGAAGCGTTGGATGCGGATGAGGAAGGAAACGCCGCACTAGAG GATGGCAGCTCCTCCAACTGCACGCGCTCGATTTTGTGGTGGCTCAAGAG CTCCATCAACACTTTCCAAACTTTTGGCAAGTTGCCAATAATTTCTTGGG CCGAGGCAACTTTTCCCATAATTTCGGGCTCATGGCTTTTTAACGAAGCC GCAGTGGCATCCACACCCGAGCCCGAGCGCGAGCTCCCCTTCCGGCATTT TTCGACTTCTCCACCCGGTTGACAACCGTCCGTTGTGTCCTCCTTTGTGG GAGTGGCTTTGGGTGTGGGTGTGGCGCTGCGACTTTTATCTGATTCCTCG GCGGAATCTCCATGACCAGTAGCTTGCTCCACAAGGTCGAAGAGCAACTT GGGCAGAGTGGCACCGTCGCTGCAGTTTCCCTCCGCTTGGGTCATTTGAT TGAGGAGGTGGCGGTTCTCCTCCAGCATTCGATTGACGCGATCGATGTTC ATGCTGCTCTTGCCATTGAACCCCATGATTAGCTGGCTGAAGAGCTGGGA AAGGATATGAAAGGATGTTACACGAAAATGGCTATATAAGTCTATATAAG TTGCACTCACCATGTTAACTGCACCCACTTGCTCACTAAGCAGACGCTTC TCAAACTTGTGCTCGCCGCACTCCTCCCGGAGCTTCGCCAGCTCCTCATT GGCCATCTCCACCTCTTTGAGAAGGCTGTGATTGCGGTCCTCCAAGCTTT TATTTCTAGTACAGGAAGAAAGATCAGTAAAGTTTGGTTCAATGGATAGA AAATTCGCTTACTTATCCTGCTCGGCCGTAAGTTCGTCTCTCTTGATCGA GATTAGGCGCTGGAGATTCTCGTACTCCGCAGCAGCCACTCTCTGTCGCT CTTCATAAAGTTGCCTTAACTGGCGGATATTCACCAGTTGGCGCTCGTAT TCCTGGCGAAGATTGTTCGACATAATCTTCATTTCGCGCTCACTAAAAGA GTTTTCGATTTCCGTCAGCTTCATCTTGAGCTAGTAGTAAACCATTTATT TAATATGGATCTTGATTTCTATACGACCTGCATTACTAGCTCACCTGAGC ACACTGTTCCTCCTTCACGCTCAGCATCTGCTTGCAGCAGGAGATGACCT CCTTCAGGGTTCCTACCTGGCGTTGAACCACTTCCACTTCTCCACGCAAT GACAAATTCTCGGCCTGTGCCTGCTGCAAAGCCAACTGAGCATTGGCCAG TTCGATATTGGCATGGCGGCTCCTGGAACTGGGATTCTCATCATCTGGAT CTGCATCAGGCTTACTGGGACTATTCGAATGGTCGTGCTGATTATCGGCT TGACCGTCTGTAGCCGTAACTTTTCTAAGACGTTGATTCTCAGATTTTTC TATGGCCAATTGTTCTTTAAGACTAGCAATTTCATCCCTCAGGCCCTGCA CAGCATTTTGGCGAACCTCTTTTTTCTGACGAAGCTCTTCTCTGAACTCT TCGAGGGTCTGTTCTCGTTGATGGGTCTCATTTCCTTTGTCCTCCATTTC AATTGCAACTTTATTCTCACGATATTTCACTCTATTTTCGGGAAGTACCT CCTCAGCTTCTTTTTGGGTTGTGGCTCGGGGGGCCTGTTCCAGAATGAGA TCCTCGTGCTCGATGTTGTTCCACCAGGGCTCGTCATCAGTGGACTGCTG CATCTGCATTTGCGTATCATCCGCAGACTGTGTGGACTCGGCATTTCCCA TCTTTACCAACAGAACAAAGACGAACGAGCTGTGGTATGCGGTTGTGATG ATCTGTTTACCAATGCAGATTCGCCTGGCGAGCGTTAAATTTACGATTCG CTTTAATGCGACTTTTCTTCTAGAGAAGAACTCTTTGTCGGCACAAAGAA AGCCCAAGATCCACCGATCTACAGATCGCCACCAATTGATATGGCACCAA TACCAGCAGGGGAAAATACCAACAAAAATCGGTGTCTATATTTGTGTGCG ACGATCACACACGAGTTTGCAGATTTCGCAATTATCTATTGACTTTCACT TTTCAACCAAGGATGTTCGAGAAAAAATAATGTCCCGATTTCCATTAAAT ATTCTTCACTTGCACATTGAACTTCGAAAGATACGGAAAAGGAGAAACGT AACTAAACTAAATATCTAGTATACATATGATAAACTTCTATATGTATACG TGACGTTGGAAAATTTTCGGGTTCTAATTTCTATCCGTTCGACGGTCGAA CGCAACTTTTCGGTTAGCCAGCTCGGGAAAAACTGAGAAAACATTGAATA GATTCTGCTATTTTTAACCCACTACGATCTCTCCTGCTTTCAAACGAATT TGGCTTCTCTCGGCGGCACTCCCAACATAAAATGCTTTGTTTTCGAGCAT TAGAGATTCTTGTTATGTTGAGGGTTTGGCAAGATGTCTGAGAGTCTTCT TAGGACTCTTCCCTTCACATTCTTAATTGTTCTTTTTAGTTTTATGCACA TTTTAATTAGAAGAACGTGTCAGATGAATCCGTCTAAAATTATACACAAG CGTCATTTTAATTATGAGTAAGGGGTAAAACAAAACAAAACTCTTGCCAC ATCGCCTGTCAAGAAATGAAGATCAAGACCAGTTGTCAAGAGCTGAAAGA GAAAGATCCGCAACACTTACTAGGTGAATGATCTGCACTGTTTTGAAGAC GATGTTTCCTAACATCAGGAACTTTAATTACATATAAAAAGCATACAAAA GAATTAGCATTACTCTCAGTTTTGGTATTAGGTAAAAACTCTGGGTGAGT ATGAACACATGTTCAAGGTTAAATACAGCACAATCCTATTCATTTTTCAA TTCATACACGATCACAAACTTTTCTTAGCGCACCCCTGTCTGACCCACAT TCGTTGACCATTATCACTTCGTTAAAGAGAATAAATCTCTGGACCTTTAT TAACCAATTTGTGATAGTGGCATAGGGTATCCCGCGCACCCCCGAACTCA ATGAAAATCTTTCGCGCGAAAGTTTCAAATGAAAATCCATTTGCTAGCTG ATTTTTGCACTGGCCACGCCAACTTCCTGTTTTTTTCCCCCAGTGCGCGC ATTTGAAAAGTGGGAAACACGCAGCAACGATTCCAAACCAAGGACGGTGA AGGGTTTTCCGGGGTAGGAAGGAAGGATGGCGCACACATTTGGCAAAGTG TCGCCAGGCTTGAAAATGAAAATCAACAATGCAATTTGCCATGGCGCCTC GCTCTGCCCCTTAGTTCTAGGTTTCTCTGTTGTTTGTAGCGACTCAAAAG GGAAAAAATTCTGCTAAAAACTTGAAGCGCCAGGCAAAAGTTGGGCCCCA GGAACGCCCTCAGCTTTTGCAGAGATTGCACACAGGCAAATGTGCAGCGA AAGTTGAAAGTAGCAAGGATACAAGAACCAGGCATCAAGGACGCTCTGCC CAAAATAAGTTGCAAGAAATCCATTGTGTTCATTATAATGGAATAATAAA CCGGAGTGACTGCGTTCAGATTGGGGTTCTTTCCTTTTCCATTAGCCCCT GAACCATCTCAAATTGATGATATTTTCTTGATGTTCCCACAACCACTTCA TGTTTTCACGTTAAAACCCAACAAAGTAATTTGGCAATTCCAATACAAGA AAAATTAAGAAATCTGGCATCAGCCTTGATTAACACCTATCTTAAGACGA AATATAATGTTAGTAAAATTTTCATATTCTCGCAGTCATTAGACATTAAT GTGCCAGTCAGTGGGGTTTAAGCCCAAGTATTCGACAAAACTGCTTCTTA GAAGCTTTAGATGGCGTATTTTGGGGAGGGTGCTTCAGATTAATATGCAC ATACATACATATGTGCATACATACGCCACCTATGTGGCTCACAACAATGC AACAACTTCATTGCCAGAGCAACACGTTGGCACATCCTGTTGCAAAGTCT CATTTCCGCAGGAGTTGTGTTCTACATACCGGATGCCTTTGCAAATGCTA AATGGTTATTGCCGTATGTGCACAATATGTCAGACGTTGCAAATAAATTA TATTTGCTTTTATACAACTTGGATACAATTCAAAATTGGGTTATCAGGCT TATCAAGCGCGCACATATCAGCTGTTCCTTGCATTCGGTTGGCAGCCCAG TTATTTAAAGATGAGCTGAACACGAATCGGAACCATACGACAATTCACCG AACTTTAAGGTTATTTTAGTGTGTTCTATTAATCTGAATACAAATTTTTA GTGATGGTTCTTTATTTACCGAAAATTTTTATCCCAATCATCTATATTCT TATTTCATTCAGTTATATGAACAATATAATATATGAACTAGTTCTTTGCG ACTGCCTCACCACTGACTGGTTCGCATTCAAAACGGTTCGATTCCAAACA ACACGTGCGAAGGAAGGCAATAGGTTTCTTAATATTTTTGGTCGGCATTC TGAAAGAATAATACTTACAACATGCTGGAGGAGATGCAACAAATGAAGAC CATTCCAGTGCTGACCAATTCCCGCCCGGAGTTTAAGCAGATACCTAAAA AACTCAGCAGGGTAAATATCAATCTTGTACCTATAGCAAGGTTTCGTGCT AATAGATTTACTTCTATGGCTAGCATTTGGCCAATTTGGGAGGTCCACAT GTGGATTCCTTCGACGAGATGCTGACCGTGGGACTGGATAACTCGGCCAA ACACATGATCCCGAACCACTGGCTGAGTCCTGCCGGCGAAAAGATTTCAA TGAAAGTAGAATCAATATGGATAGCGAAGCCAAAGGTGCCGCAAGATGTG ATTGATGTGCGCACCCGAGAGATTTACCCCACGGACTCCAGGCAGCTCCA TGTCTCCTACTCGGGAATGTGCTCGGTCCGATTGGGGTGGAGTGTCAATG GAGTGCAAAAGACTCCCATAAACATGGACCTAGGAGAAGTGCCCATCATG TTGCGCTCCAAAGCCTGCAATCTGGGACAGGCTACTCCGGAAGAAATGGT AAAACATGGAGAGCACGACAGCGAGTGGGGGGGCATTTTTGTGATCCGAG GAAATGAGAAGATTGTACGTATGTTGATCATGACCCGGAGGAACCATCCC ATATGTGTAAAACGTTCATCCTGGAAGGATCGTGGACAGAATTTTAGCGA TTTGGGTATGTTAGTGCAAACGGTCCGTGAGGACGAATCATCCCTGAGCA ATGTAGTACATTATTTAAACAATGGAACTGCAAAGTTTATGTTTTCTCAC GTCAAGAGACTATCATACGTACCAGTTTGCCTGATCCTCAAGTGCCTAAT GGATTATACAGATGAGGAAATATACAACAGATTGGTGCAAGGCTACGAGT CCGACCAGTACTATGTGTCCTGCGTGCAAGCCATGTTGAGGGAAGTTCAA AATGAAAACGTCTATACGCACGCCCAGTGCAAGAGCTTCATTGGCAATCT GTTCCGTGCCCGCTTCCCAGAAGTTCCGGAATGGCAACCGGATGATGATG TCACAGACTTTATTCTTAGGGAGCGAGTAATGATTCACCTGGATACCTAT GAGGATAAGTTCCAGTTGATTGTGTTTATGATTCAGAAGCTTTTCCAATG CGCACAGGGCAAGTACAAAGTGGAGAACGTCGACTCAGCTATGATGCAGG AAGTGCTTCTGCCAGGCCATCTCTATCAGAAATACCTAAGTGAGCGAGTC GAATCCTGGGTCTCGCAAGTCCGACGTTGCCTTCAAAAAAAACTGACTTC ACCTGATGCCCTAGTTACCAGTGCTGTGATGACGCAGTGCATGCGACAAG CAGGAGGAGTTGGCCGGGCCATAGAGTCGTTTTTAGCAACTGGAAATATT GCGAGTCGCACTGGCCTGGGATTAATGCAAAATAGCGGATTAGTCATTAT GGCGGAGAACATTAACAGGATGCGTTACATGTCCCACTTTCGCGCCATCC ACCGTGGTTCCTATTTTACAACGATGAGAACCACTGAGGCGCGGCAGCTG CTCCCGGATGCCTGGGGTTTTATTTGTCCAGTGCACACTCCTGATGGCAC ACCGTGCGGACTGTTAAATCATTTGACTCTAACTTGCGAGATTTCGATGC GTCCCGATCCCAAGTTGGTGAAGGTGGGTACAGCTAATGGTAGACTTTAT TAGAAATTTTAACCGATTACTTTTTTTTTCAGGCCATTCCCAAGCATCTT ATAGATATGGGCATGATGCCCTTGTCAAACCGAAGATATTTGGGCGAAAA ACTTTACGTCGTCTTCCTAGATGGCAAACACTTGGGTCACATTCATCAAT CAGAAGCCGAAAAAATAGTTGACGAATTGCGCTACGGGAAGATATTCGGC ACCCTTCCCCAGATGATGGAAATCGGCTTTATACCCTTCAAGAAGAACGG TCAGTTTCCAGGGCTTTACATTGCAACGGGTCCTGCCAGGATGATGAGGC CCGTTTGGAACCTAAAGTGGAAAAGGGTGGAGTACATCGGAACACTGGAA CAGCTTTATATGGAGATCGCCATCGATGCAAAGGAAATGTATCCTGACTT CACCACTCATTTGGAGTTGGCTAAGACCCACTTCATGAGCAACTTGGCCA ACTTGATACCCATGCCGGACTACAATCAATCGCCACGTAACATGTACCAG TGTCAGATGGGAAAACAGACGATGGGAACGCCATGCTTGAATTGGCCTAA GCAAGCGGCCAACAAGTTATACCGCCTTCAGACGCCAGGGACTCCTCTCT TCCGACCAGTACACTACGACAACATCCAGCTGGATGACTTTGCAATGGGC ACAAATGCTATTGTAGCTGTCATTTCCTACACGGGCTACGACATGGAAGA TGCTATGATCATCAACAAGGCTGCTTATGAACGAGGATTCGCCTATGGAA GTATCTACAAAACAAAGTTTTTGACGTTGGACAAGAAGAGCAGTTACTTC GCAAGGCATCCACACATGCCGGAGTTAATAAAGCATCTTGACACGGATGG TCTTCCACATCCGGGCTCCAAATTGAGCTATGGTTCGCCCCTGTACTGTT ACTTTGACGGAGAGGTCGCCACTTATAAAGTTGTGAAAATGGATGAAAAG GAGGATTGCATAGTAGAGAGCATCCGACAGTTGGGAAGCTTCGATTTGTC GCCAAAAAAAATGGTGGCCATCACACTGAGGGTTCCACGACCTGCCACTA TTGGAGACAAGTTTGCATCAAGAGCTGGTCAGAAAGGAATTTGCTCACAA AAATATCCTGCAGAGGACTTGCCATTTACGGAATCTGGTTTGATTCCAGA CATTGTGTTCAATCCCCACGGCTTCCCCTCCCGAATGACAATCGCCATGA TGATAGAAACGATGGCGGGAAAGGGGGCTGCAATCCACGGAAATGTTTAC GATGCCACGCCTTTTCGCTTCTCCGAAGAGAATACTGCTATTGACTATTT TGGCAAAATGTTAGAGGCTGGGGGTTACAATTACTACGGAACGGAGAGGC TGTATTCCGGCGTAGATGGCCGCGAGATGACTGCTGACATATTTTTTGGA GTGGTGCATTACCAGCGTCTTCGGCACATGGTGTTTGACAAGTGGCAAGT AAGATCTACGGGAGCGGTGGAAGCTCGGACCCATCAGCCAATTAAGGGCA GAAAACGCGGTGGAGGCGTCAGATTCGGTGAGATGGAACGGGATGCTTTG ATCTCTCACGGTGCTGCTTTCCTGCTGCAGGATCGCTTGTTCCACAACTC CGATAAGACGCACACCCTGGTGTGCCACAAGTGCGGCTCCATTCTGGCGC CTCTGCAACGCATTGTTAAGCGAAATGAGACGGGAGGACTCTCTTCTCAG CCAGATACGTGTCGCTTGTGCGGGGATAACAGTTCTGTATCGATGATCGA GATACCATTCTCTTTTAAGTATCTGGTTACCGAATTGAGTTCGGTCAACA TTAATGCGAGATTTAAGTTAAATGAAATTTGATTTAAATCTAAAATTATT GTTAGGTCCTATGTTAACCCGTGCGCTAATCGTAATAAAGATAAATACGT AAAATACAACTGTGCTTGCCAAGTGTTTATATCCAGATCGTGGAAACGTT TTAAACACCTTTCAAATGGTTTCAATTTATATTTATTTAAATACATATTG GTTTACGTTTACAGTTAAATTCCTGCACTTGCTATATGTAGTTGTGGCTT GGTTTTCTTGCTCTTGCAGTTGCTTTTGTTTTGTCTGTGAGTGTTAAATG GAATTTGTGTGGAATTTTGTAACATTTAACTATTGCACTTTGGAAATGCC TAAATTTCCAGCTGTCATGCACATTGGTTTTTACGAAAGGATCGAGAGTT TAATGGTAATAAGTATTTGATGTCAGTTTCCATTATCGGTTTTCAGTATC AGTATCTATATAGTGTATATTTTAGTTTACAATTCTTTGTTCTTTATCGG CAGCCGTCTCGCATTTGAAGAGAGTCATTAGCAGATTTATGGCTGGCGGC TACTGCTGCTGCTGCTTCAGATTAGTTAATACTTGGTGCTACAAAGATCG CTTTCTCTTCAGGAAGCGGCACAACATGAAGTAGCCCCTCTCAGTTTATC TATGGTACACAAACGAAACGTAATATTACCCAGAATCATTCAAAAAATTC TGCTATAAGTATAATAATATTCTGAAATTTTTGCTTCGTTTTCTTCAATA GGGAAATTTTTCCTATCGTTAATAAATTTTAAGTTGCTCAACAGTGATTA ATCAAGGAGATTTTGTGGATCTGTCTAATTATTTGTCTATTATTTAATGA GATTTCTGCTCTTGCGGTCCTCCATTGGATTTTACAATCAAAAACATTAA ACATGAATTTCGTTTAGATGCAATTGCAATAATCAATATATGTATAAATA TTTAGATAACGATTTGCATACTTGTCATTTGCAGGCATCTTAATAATTCC CTTGCAAGCTTTTCTCTTTTGTTTTATATTGATTTCTGTTTTTATTACAA CGACGTATATACTAGGTATATGTATGTGGTTTGTATGAATGTATGTAGAT CTGTATATAGGTATATAATATCCAATTGCTACTGCCTCGAAATGATGCAA CAATATATAATTTGTCATACATATAAACATAATCTAATTATGTTCTCTCG TTTCTCTACTATGAACTTTTTGAGCTTAACATTTACAAAAAAGTTTGGGA ACATGAAATTGAAAATGGTTAAAGTAAGAGTAGGTTTACAAACATAATAT TCAAATAAACAGGACAGTGGGTAAATCAACTCGCTGTTGGAGAAGATGAA AGGTACTTAAGAAGAGTGTAGGAGTGTGCCTGGCATAACTAAACGCGTAC AGTTCTAGGGCCTTGTATGCTTTGATATTTCTCTAGGTAATTGGGATTGT GCATTGTAAAGTGGTTGCCGTTGCTCCATGGCTTCGCAGCTCCGTCTCCA TCACCCCGTCCATGATTGTTGTGGCTTACTTGTCGTCGTCATCCTTGTAG TCAATGTCATGATCTTTATAGTCTCCATCGTGGTCTTTATAATCTGTCGA CGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCCGAGGATCCGCTGC CGCCGGCGTTGCTGCGCCACTCCATCTTCTGGCTATCCAGGATCTGGCGC AGGCTGCTGGCCATGCCCTGGAAGTACAGGTTCTCGGGGCCCTGGAACAG CACCTCCAGGGTGCTATCCAGGCCCAGCAGGGGGTTGGGGATGGGCTTGC CCTCGAGCTTGTACAGCTCATCCATGCCCAGGGTGATGCCGGCGGCGGTC ACGAACTCCAGCAGCACCATGTGATCGCGCTTCTCGTTGGGGTCCTTGGA CAGCACGCTCTGGGTGCTCAGGTAGTGGTTATCGGGCAGCAGCACTGGGC CGTCGCCGATGGGGGTGTTCTGCTGGTAGTGATCGGCCAGCTGCACGGAG CCATCCTCCACATTGTGGCGGATCTTGAAGTTGGCCTTGATGCCGTTCTT CTGCTTATCGGCGGTGATGTACACGTTGTGGCTGTTGAAGTTGTACTCCA GCTTGTGGCCCAGGATGTTGCCATCCTCCTTGAAATCGATGCCCTTCAGC TCGATGCGGTTCACCAGGGTATCGCCCTCGAACTTCACCTCGGCGCGGGT CTTGTAGGTGCCGTCATCCTTGAAGCTGATGGTGCGCTCCTGCACGTAGC CCTCGGGCATGGCGCTCTTGAAGAAATCGTGCTGCTTCATGTGATCGGGG TAGCGGCTGAAGCACTGCACGCCGTAGGTCAGGGTGGTCACCAGGGTGGG CCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCT TGCCGTTGGTGGCGTCGCCCTCGCCCTCGCCGCGCACGCTGAACTTGTGG CCGTTCACGTCGCCATCCAGCTCCACCAGGATGGGCACCACGCCGGTGAA CAGCTCCTCGCCCTTGGACACCATGAATTCATCAAGTGGATCTTGGTTTG TGTGAACCTCGTCCAGCGGGTCCTGATTGGTATGCACTTCGAATTGATCC GTCAACAGATCGCAGATTTCCCGAGTTACGGTCTCCTTGCTTGCCCGAAC TGTCAGTCGGAACATCTATTGATAATTTGAGAAATAGGCAATAGGCATTA TGTTCCAAGTATCTAACAATAAATTACTCACCTGAGCCTGCTTGTTCGGC TCCAATCGCATAAGGCAGCCCACCTGTTGCGATTGCGTATGAATGATGCC CGCGCAGACCATGTTGTCTGGATTGGGATCCACTTGGTCCAGCAGTTGCA TTCCAAAGCCCATAAGCTTGTTGCGGGCTCCGGGCAAATCCAGTGGCTGT GCAGCCTTGAACACTTTCTGTGACCGTTGTTGTTCACTACAAATGCACAA TTAATATTGAATATTATCAAAAGACACCTTATTAAATACCCGCTAAGGTT CTTCCATCGTGCAAAGAATGATTCCGCATTCATTTCGGTAGGCTCAAAGA ATTTGTTAACGCTCAATGGCAGTTTAATGCTGAACTTCTGCTGGGTGCCG TTGTAGCGGAAACTGATCTCGATTGTTGGCGCATCGGCGTAGTCCTCGAT GCATTCCGCGGTTAACAGTTGTTGGATCTGGGCGCCGGCCTCCAGGGTTG GCTCCACCACCTTCATCTGCACGTTCAGCTTAAGCGCATCCTCGGCAGAC CATTGCAGCACAGGATTGAAGTTCTGAAAAGAGAGCAATGTAATGCCTGG AATGTTTCAGAAACTAATTTACTTACTGTCAGGGGAACCTGTGTCTTGTT GCCGTAGAAAAGGCCTAATCGTCCTAAATTCTGGCGAAACTCGCTCTTCA CACCGATCTGCAGCATTTCGTTCTCAAACAAAACACCATTGTTCTTGAAC AAAAACTTCTTCGTGTTGTACACGGCACTTGAGTTGTTGTTACTATTGCT GCCGTACATGTCGCCCAAAACATCAATGAGCGTACTGTTGCTATTGCTAC CACTGCCAATATTATTTGATGGCGGAGTGCTTAATCCAAGCAGATCCGTA TTTGCGTTGCTGTTATTCAGCTTGCTATGTGAATTGTTCACAAGGGCGTT GTTCTGCGCTGCAGAAGTCAGGGGTGCCGGGCTCTTCGACTCGCGAATTT CGTTCTCCGGCACCCTGCCGGGCTTCTTCTTCTTTAGCACTGCTAAAATT GAGCTCTCGCGTTCCGGGAACGATGGCATCTCCTCCAGGACGGTGGCCAA AACGTCTGTCGATGCCACTATGCTAAGCTGGAGATATTCGCTAGCTCGCT GCTGCAGTTCCGCATCTGCGGATCGAAGATTGCTGTGCTGGCGGAACACA TCCTGGATATTGGTACGAATTTCCGGAAAGAGGTTGATAAATTTAATGTA CGTGGACAGAAGAAGGGCCCGGGTCATCGGCGAGCACAAGTGGTACTTGG AGTGCAGTAGCTTGAATTGTACCAGTGGTGCTGAGCGGGAATCTCCGGCG ATTAAGTTGCCAAACTCGCCCAAGATGTAGCCGCCCACTTTAACCATGTT TTCGTGGCAGGCAGGGGCCTGTAGCGCCTCAAAAACAGTCTTTGCGGCAT AGCCTTGAACCTCCTCGCGATTGATCACGATCTGAATGACGCGGTACCAT ACTTCCTCAGACACGTAGTCGCCAGCAATGCGAATTAGATTGAGGATAAC GTCCACATACCTGGTAATATAGCGGTTGTCATAAAGCACATAGACTTTTA AGCACAAGCTAAAAAAGAGAACACCTACCAGGTATAATCCGTGGCGTACT TCTCGGCAAGAATGGCCACCTTGAGCACCATTTCCTCACGAATAGAGTAG TCGGCCGTCTCCAGATAGTTGAGCATCTCCTGAACAATTTCCTCGGCATT ACCACGATCACACATGGCATACAAAAGATCCACCGCCATTTGGCGCACGG ACACGTCCTTCTCCATTTTCATTGACAAAATGACCACCTCCTGGTGCTTC TTCACCTCCTCGTGCGAGAACTCCGATGTGGCCAGGTGGCACATGGACTC CAGAGCCAGATAGCGCAAGTTGGTCTCCCGATTGCTAAGGAACTGTCCCA ACTGGTTGCAAGCGCGGACAAGAAGGTTCGGCTCGCTGTCGCTGTGAATG ATCAGGTTGATGGCCTCGAAGAGCACGGCGTTCTTTGCGTTAGAGTGCTG CACCTTCTTACTCTTTGGCGGCTCTTGCGCCTTGTTCAAAATCGTCTCCA AAGTTTCATTCAAGCGGGCCCGCACACCGGCCTCTTCGGTCACTGGATTG TAGTTTTGCAGCAATCGCAGAAGTTTCACCGATAGCCATGGAGCCGGCAC AAAGTAATATGTGTAATCCTGCAATGCGAATTTAGTTAGTAATTAGAAGT TTCTTACCTTAAAAAATGCATTAAATCGTACCTGAAGATCCGTGTAGCTG GCTGTTACGATCCGGGATAAGCGTGAAACAGCCAAATTAACACAACCCTT GTACTCGTCCGGATTGCGCTTCACCAAGGCGTCGATCAGCGAGGTGGCCG CTGTGACCACTCCCATGTGCTGATCATTGAGCAAATGGATAATGCGCGAA GTCCACTCACCACCGGGAATGATGTCCGGCGAGGAGCGGAACAGGCGGAG CAGGCATAGCGCCGCCGACTGCTTCACCACGTCCATGGTGTCGCCCGAGA CGAGTAGCTTGGGTATTTCGTTGGAAAAGGACTCGGCCATATCCCGACTT CCAATGTTGGCAATGCATTGTAGTGCCAGATTAACGTGCACAGGATTACG CGACTGCAAATCATTCTTTATAGATTGGATGATCAGCCGAATAAGGTCGC TGTTGGTGTTCACCAACACTGAGATGAAAAGGTAACCCTAAAGTTCAAAA AACAGATTTTATCAGTAACATTAAATTTAAAAAACCAATTTTTTAATTAT TTTTATCAAACTTCAAACAACGACAAGTTAAATTTAATTGAATGAAATTC CCTTTTCCCACAAGCAGAGTCGTCTGCTTTCAGTTCAATTATTTCGACTC GCTAAATAAACAAATGATTATTGAAGCAATTTTTTGGGGTACTCACAATC TGCTTTTCTGAGTATTTGTTGGAGGACAGCAAATTGACCGCCTCCATGTG CCCGAAGTCGATGTCATGGCCGAGGAGAAATATGAATAACAGCTTACAGA CATATTTCTTTTTCTGATAGCCGTCGAGGGTTTTGTCTCCTTTAAATTTG CTTCGTATATTGGCCAACTCCTTGTTTATGCGTTTGACTTCGGCCTCTTT GCTTTTGCCTGTGGGCAAATGGGTGAATATTAGTATAGAAATTTGTGTCT TATGCGGGTATAAGGGAGATTCACAGTAAAACAACAGTGATTCGTCTGCG GAAGCTTCGCTTTCCTTTCCACCCCGCGATTGATCGATCGGAGAGACGAC TTCACACCCTTCAGCTCTCTCCATGTCGCGGATTTTCTCCGATTCACATA GGCGTCAATTAGTACCAGTCACCGATCCGCAGCGGAACCTCTGCTCTCCT ATATGTTGTCCACAAACCAGAAACTAGTAACCGAGCATACAGCAAACAAC GAGCTGTGATAATAATACCATACAGTGAAGCGTCGGACTCTTGCGCACAC ACATATGCACGCTTCGAAGTACTACAGTAAGTCATCAAACTATCAAAATT GTAAGTATTTATTAATACTGAGAGGCAACCGATTCACATTGATATAACTA TTTGCTGTGTTGTACCCATATATATAACTATATATATAACTTTCTCATAT CTTTCTAATGTAACGACTACGAAAACATTTACATAGGAATGGAGAAGAAA AGTAGCCAATATTTTGTAATTCATCTGGCAGAGAGCTTACTGTTCCTGCG TTTTTGTACCGCCCCACGTTTTTGTCAGTGCGCTGCTCCTGGTAATTGAT CAAGTAATGGCGCTGATTCCGCCCCTATGGAAAATCTCTTGTTGCGACCC GCTCAATTGGATTTAATGCTGGTTACCCAAGAGATCTGCACTTACAGTTC CTTATATCCGATATAAAGACGGCCAGGCCTCTCATGCCATCCCCCCGCAC CGGCGCCATGGTAGTTAGCTTGTTAATTTTCGCTGGTTTTATGCAAACTG GGGGCGCAAGAAAATCGTCAATGGATGGCGGCCGAGTCTCGAGGCGTTCT TATCGCTCGAACTCGACGTCGGACCCTAAGATATATAGTTGCTCTCCGCT CTGGTTCTGCAAAGCTCTTTTTACTTCGATTGGATCTCGGCCGTTCCTTG GGACCTGAAAGGGGAAACGATACTCTATTTATTGTGGGTTGTGGGAATGG GAAAACTTAGTATTATGATTACGTTTTAGTATTTGTGTTAACAAACGTAT ATTATTCAAACAAAAGGTATTTTGGATAACAATTTGTATTTAGCCAGGGA GTAGCTTATTGTGCATGCCAACACATTGATACAGCTTCTATTTTGAAAGT CCGTATTGCAGTTTTACTTTTGATAACGAAAACGCCACAAAATATGTATG CACCACACATTTCACTGAGCATCAAGCGCTGATAACGATTTATATGTATA AAAAATCCAATGTTTAATAAACTCAGAACTTTTAAACGGTAAATAGTGGA CTACGTGATTGATTTTCCGGCCAGTGCACCCAATGGCTGGCGAACTTTGA CATTTTCTGGTGGAAGTAGAGTGTACCCCCGCATTTTTGGCAACCGATTT ATTTTCAACTTGGCAGCGTTTTGCCCGTTGATAAAGATTCTGTGACCTCG CTCGCCCACTTTTTATCGCCTGGCGAAGTCGATGTGCACTTGGGCATTAT TATTTGGATTTGCGCGACCACCGGCTTTTGTTTCTGTAGTATACTTTTTA CTTTGCTTTCCGTTTCGTTTTATTTTCTGTTTTTCACTGCGCTCTTCGGT TCTCTTCTTTCTTTGCTTTCATGTCACGTCACTTTTTTCACCGCTGGATG ACGAGGGCGTTTTGCCCAAAAAAAAAAGCACCGAAGAAGCCTCCAAAAAC ATTAATGGGCGTATGTTAGCTGTTCTTTTTTTTTGAGCTTACTTTTCCGA TTTTTTTTACTCGCCAGCGGACAAAATCGGTTAGCGTTGCGGAATTTCTG TGGCGGAGCAGAGAGAGTAATCTCTGACTTCTGAAGTTGGCTTCGCTTGG AATCGGAATCCGGGGTGTTGGCTGCGGAATGTTTGACCCTGCGTGTTGCA CTTTATGGAACTCCAACTCGCTGGAGCTTCGCCTCGCTGATTTGCCGCTA ATTTGTTTGTTAACTATTACCAAGTGCAGGGCAATTCACTAAAATGAAAA TTTCTATTGATTTTTCTTCGCTCTCGCTGCCTAAGAGTGGAGCCATCTAG CGGGCGCGGGTGGAACGATTGGTGTGACCAGTAGAGCGTTGGGTTGAAAT ACAATGATTACTTCGAGGGATGGGTACACAGGGATGGACGAAGAGAGACG ACAATTCGCTTTAAGAATTTTTTACCTTTTGCTCCAAGCAGAAATCCAAA AATATCTTCTTAATTGTTTTTATGGCTAATAAATTTCCGTTCTATCCTTT AAGGTAACGCTTGGTGCAATACAAAAATATGACTCAAATTTGATTAAGTT GTTGTCAAAACTTGTGACGTCACAAAACACAAGGCTGCGCAACCTCTCGC AGCGCACACCTTGAGATTACTCCGCCATTTTTTTGCGCGTTTCAGAAACG CGTTTTCGATCCCTCGGTTTTATTTGTGGAAAAAATATGTGAAGTGCTCT TGCGGCAAGCAGCAAACTGGCAGAATTGAAAACACAGGACCGACCAGATC GATCCAAGTACCAGGAGTAGCACCGGATACCGTGGCTTGCGCCGAAGTGA TAAGCGTGCCGAATGCAGACGCATGTGTTACGCAGCACAGTTCCGATTTT CGCACCGTAAAAACATAATTGGCATTGGAGATAGGAGTGGATTTTGGAGT GCGCTAGTAGTAGGAGAAGGAGCCAACCGCGTTCCGTCATGAGTTTTTCC AGCGACGAGGTGAACTTTCTGGTTTACCGATACCTGCAGGAGTCGGGTGA GTAAAACCCTCCAATCGCAAGATAACAGCCCGCCCTAATCTCATGCAATC CCGTTTTCTAGGCTTTCTGCACTCGGCCTACGTGTTTGGCATTGAGTCAC ACATCTCGCAAAGTAATATCAATGGCGCATTGGTTCCACCTGCCGCTTTG CTCACCATCCTGCAGAAGGGTCTTCTGTACACTGAAGTGGAGTGGAGCGT AGGCGAAGACGGCGAGGTGGCGCGACCCATTGAAGGACTCTCTCTAATAG ACGCTGTCATGCCGGAGGTGAAGCCACTCAAGCCCATTGTGAAAACAGAG CCGGGAAAACCCGGGGCAGTCGACTCTTCTGCCCCTGCCGGTGGCAACCA GAACAACAATGCCAAGCCTGAGATAAAAATAGAACCGGGTACCGGAGTGG CGGGCTCAGCAGGTGGAAACAAAATTGCTGGCAGCACCACGGGCACAAGC ACACCAACCGATCAGTCGGCAAGCGAGGTAGACTCCAGTGGAAATGCGGC AAATAATGCTGGCGGCACATACGCCGGAAACAATGGAGCTGGAGGGAACC AGGCCAGTACTGGAGGATCTAATAGCACAAGCACACCAGCTGGTGGAGAT TTGGCAGCACCTGGGGCAAGTCAAAAGAAATCCCAGAACTCGAATGAAGC GGGAAGCTCATCTAGTGGCAATGCAGGCAATGCAAATGCTACCAGTACCG ATGATGCAGCCTCCTCAACATCCACAAATGGCAATAGCAGCACTTCCAGC AGCGTAGAACAACCTACAAGCGGGCTGACGCCCGCTGGTGGAACTGTATC AACCTCCAATCCGGACGCAGCAGCATCGGGCGGAGCTTCGACTGCAACAG GATCAAAGGCGCCAAGTGGAGCGGTTACGATTCGCGTAGGAGCCCAAGGA AACAACGTGCAGTCTGGTTCGTCCAATGCTCAAAGCTCTGCTCCCAGTGG AACCATCTCCTCGTCTACCAGCGGAGGTGCTGGGACTCCCGCAGCTCTTG TTCCCATGGACATTGACGAGAACATCGAAATACCCGAATCCAAGGCTCGT GTATTACGCGGCCACGAAAGCGAGGTGTTTATCTGCGCATGGAATCCTAG CCGGGATTTACTGGCAAGCGGTTCGGGAGACAGCACTGCTAGGATATGGG ACATGTCCGATGCAAACACTAACTCCAACCAGTTGGTGCTGCGCCACTGC ATCCAGAAAGGCGGCGCTGAGGTGCCTAGCAACAAGGACGTCACCTCTCT GGACTGGAATGTAAGTCGAAGATCTTGGCACTTAAGCCTTGCAAAGTTTG ATTTCTGATCCTTACTTAATCTATTCTCGTTTTTGCAGTGCGATGGTTCC TTGCTCGCCACCGGCAGCTACGATGGTTACGCCCGAATTTGGAAAACCGA CGGTCGACTTGCTTCTACTTTGGGACAACACAAGGGTCCGATCTTTGCTC TGAAGTGGAACAAGTGCGGCAACTACATCCTCTCGGCTGGCGTGGACAAG ACGACGATCATCTGGGACGCATCCACGGGCCAATGCACCCAGCAATTTGC CTTTCACAGTGCTCCAGCCTTGGATGTGGACTGGCAGACAAACCAGGCCT TTGCCTCTTGCAGTACGGATCAGCGGATACATGTGTGCCGGTTGGGTGTA AATGAACCCATCAAGACCTTTAAAGGACACACAAACGAGGTGAATGCAAT CAAGTGGTGTCCGCAGGGCCAACTGCTGGCGTCCTGCTCTGATGACATGA CCCTCAAGATCTGGAGCATGAACCGAGATCGTTGCTGCCACGATCTGCAG GCTCACTCAAAGGAGATCTATACGATAAAATGGTCGCCCACGGGGCCGGG AACCAATAATCCAAACACAAACCTGATCCTCGCATCCGCTTCGTTCGATT CCACGGTAAGACTGTGGGACGTGGAGAGGGGCAGCTGTATCCACACGCTC ACCAAGCACACAGAGCCAGTCTATTCGGTGGCCTTCAGTCCGGATGGAAA GCATTTGGCCTCCGGCAGCTTCGACAAGTGCGTACACATTTGGAGCACGC AAACGGGACAGCTAGTGCACAGTTACAAGGGCACGGGCGGAATCTTTGAG GTGTGCTGGAACTCCAAGGGCACTAAGGTGGGTGCCAGTGCCTCCGACGG TAGCGTTTTCGTGTTGGACCTGCGAAAGTTCTGATTGCCGGAGCAGCCAC AACTGGATTTCGTGTATTGAGCCAACGCTTAAAATAGTCAAGATTCCTTT TCCAGCTCATTATTTGGTAAAAATGAAATCGGTAGTTTTTCACTTTCTTA CGGAACGAGAAGTTTTTACTTTTGATTCAAAAATTGCATTTAACTATATT TTTTAAAGAAGTGAAATATGATCAGTTACAATTCTACCAACATAAGTCGA TTTGGATCTGGAGTCCGGACCTTAGGTAACTCCTTTCTTAGCTATCCCGC CCTGCAATCGTATTTGTAATTGCTTTAAATTCTAATTAGTTCTTTAAGGT ATACCTCTTGAGATGAGATCCTCCCGCTTTTGTCCACGTCTATTTCGTAC GCTTAGTTTCGAGTCACAAAATATCGATATGCACCTGGGATTTTTGGGGG CTTCAACATGGTTGTTGTTCTCTTCAGATCAGCGGGATGCGACTCGCCTC ATTTTAATCTTAATCATAAGCTCCATGTTTCTAAGGTCGTCCCTTTTTAT ACGAAAATCGTTTAGTATAACTTTGCATTTTGTTATTGTATCGATCAAAG ATGCCAGCCAACTCCCCGCCCTCCCCACCAAAAGTCCTTTACCCAATTCC ACAGTTGTCCTCCAAAAAAGGGATGCCAAGAGATCAGATCAGACCGATTC ACGCATACATTCAGAACAGTGTAACTGCAGTCCCACGTAGTCAGTAATCG AACGTAATTATTAAGAACACGAGATTGGCGGAAACACAAGAACATCAGCA AAAATACATTAAAGATAAAAATTAATCTGTTTTCGTTTTGGGCCTGGGTG TTTTTTGTATTTTAGCATTTTAAAATTTAATACTAAAGTACTTAAATTAA ACTTTATTCTTTGTAAATATAGATACTCCTGAACTTAATTTTATTTTCAT TTGTTGCTAAAACTCCATGACACTTTCCAGATGGCGTTGCTTAAAGAAGC GGCACTCCTCGCGAATTATTTCGCCGGATTTTGTTGTGCCCTTAAAGAAC TTTGTGAGCTTGGTGCCGGCGTACTTGGGCTTCTCGGAATCCGGCTCGTC GAACTCCATGTCATAGGCCTTGTCCGCCAGTGCGTTTTCCGCGGTGGACC AACTGAAGCGCACAAGTCGTGGAAATCCAAACACTAGATCGATGTACTCG GTCAGAAATCTTCTTGTGACCGGATCTCCCGGATATCCACTGCCGAACTC GTTGTCCTTAATGACCAAGCCCTCGGGGAAGCTCCACACCTTGAGGGCAT GATCACGGGTAACTTTGGCGCATATACTAGCAGCAGAGACTATTGGATAG GTGGAGTCAGCTTTTTTCGCCACGGTGATTTTAAAGCTGGGGAAACGTTT GAGCAACTTCTCCTGGTACTTCTCCGGCGGACCCACCGTATCCACATAAA CCTCGGCTATATTGACGCCCGCATCGATCGCCTGTTGGATAAGGCCCATG GCCGAGTCCATGGAAACTTCGTTCAGGGAGCACTTCGACCGCCGGTACAT GCTGGTGCTGATCGTGTTCGGCGATATGATCTCCACGGCCCAGCCAACGC AACTGGTCGCATATTCCTTGGTGTTGATATCGTTAAATATGATATCACGT TTCCCCTCGGTTAGTTGTTTGGAATCGGCGCATCCCAGGTCCTCTAAAGC CTTGTTACTTTCCAGTGGACAGTAGGAGATCCCATATACCATAGGTCCCA GGACGGGACCACGCCCTGCTTCGTCCACGCCCAGCATGCACGGCTTATCC TTGCAAATATCCGGAACATCGCTGAGGTAAACCGTGTTGCGGCTATTCTC CTTGCCGGCTATAAATGGACCCAGGGCCTTCAAGGAGCTTATTTTTCCGC TGTCCTTAAAATCTACATCATCGGGCTCTTCGTCGTTCTCATCAATATTT TCTATACATTTTTTTTCTTTTTTTACAACTACGTCTTCTTGGTCCGACAT TTTCGCGCGCTTTTTTTTTGTTTACGTTTAAACGACGCTATGGGCACACT AATTGTATACATAAAGTTGCAGTGTGACTCATTCGTCATTATACCAAAAT ATCTTTTTTTTAATATTCTCAATAACCGTACGGAAAGGTCTTTTATTAAA ATAGAGAGATAAACATATAACCAGAGAATTATGCTAAGGCTTCTGTCCAA GATGCTTAAAAATAAACTAGTTTAAATAAGAGATAATCTCGGCAGTTTGA ACGAGTTTTCCTCTACCTAGTATTTCCTGACAATAATATGCAAATTTTCA TAGACGGTTGGTATTTTTCTTCGTCATCGGCGCGGTCACACTGCATATCA ACTGCTCTTTCCGGTTTAGGATTTTGACCAGCGTGCTTGTTCTCGTCCCG AGCTAAGGCCATTTGTTATAAACAATTAATTTTTGGCAACTTGCACAATC AGTGATTAGCCACAGCACTTCGACATGTCCACCAAAGCCGAGCTCGCCTG CGTCTACGCCTCCCTCATCCTCGTCGATGACGATGTCGCCGTCACCGTAA GTTTTTCGATATTGCAATCGGGGACGAAGCAAATCCTCCAAAGCCGCGGC CATCGGCCGGAAGTATTGGACAATTTGCGGGTCCTATGGTTTCTTTCGCA CTGCTGCAACTTGTGCTGATCTTATTTTTTGGATTCACCAGGGTGAGAAG ATCAACACCATCCTGAAGGCCGCCAACGTCGAGGTGGAGCCCTACTGGCC CGGTCTCTTCGCCAAGGCCCTGGAGGGCATCAACGTCAAGGACCTGATCA CCAACATCGGATCCGGAGTTGGTGCCGCTCCCGCCGGTGGTGCTGCCCCT GCTGCCGCCGCCGCTGCTCCAGCCGCCGAGTCCAAGAAGGAGGAGAAGAA GAAGGAGGAGGAGTCCGACCAGTCTGACGACGACATGGGCTTCGGTCTGT TCGACTAAATCCTCTAGAGAACTTCTCGACAACCGGACATCCGTTGTGTT TGTGCTGTAATCCTCGAGAGGTGGACGTGTACCCGTTTCCCGACCTGCGT ACACGTTTTTAATGTACAAATGTGAGGAAATATAGAAGACGTTTGCTAAA AAATTATCGAGACTCATTCCTTTCACAACGGTGCAGAATTATTATGGTTT ACTATGTTATTGGTCATTCCACTGCCTTTTTGTGAGTAGATTCTATTTTG GGTTTTTAAGCACATGAAAGAGGTTGCAGTAGAATGGCCAATAATTTGGT CAGCCGGGTTGAAGGCTACGATTAAAATGTTCAAGGTTTTTTTTACAAAA ACTGTCACAGCTAATATTTATTGGATATAACGAACGCAGACTAGAATAAC GTCTCCTCGAGGACCTTAGCTAGGGCACGAAGATTGGGTCCGTCGATTTT CTTGAGACCCAAGCCCACCACGAACTCCGTCGGGCACTTGTGGAGTCCGG TTCTGTTGACCAGAAACTGTATGGCGCTGCGAGTCTCGTCGGTGTCCAAG CCCAAGCAGCAGTTCATCGTGATTGGCACCGATACGTGGAACTCCGGATT GTCCACGGGTCCGTGCAAATAGGGAACCACTCTTTCGTCCTTTTTGACAT CGAAGTGCACGTTGTAGATGCCGGGAATCTTGCCGAGCTGCGTTATGACT AAGAACCACTTCTTGGCAAAGCAGTGGAACACTATCTCCGTGGGAACGCC GTTCACGTCCGCTGAGAACTGCCTGTCGAATCCGATTTGTCGAGGTTTGT TTGCTGTGTGGTTCATTTTTTGAGAGAATTTAAAAGCGTTTAACAATGTT GATATTGTTTACGATGAGACAGCATGAAAAAACGATGAAAAATACATCGA TGTTTTATCGATAGTCATTATGCATTGATGTGCTAATATGAAGTGTGGCC GAATGGTTCCGAGTTTCGTGACTCCCGAAGCACGCAGTTCAAACGTTTGC ACTGATTTCCTGAGAGCGCCATCATGCAGAAAATAATTGAACTACTGACA CAAGATTTCGATTACGCGATTGATATTAAATGTTCAACCATTTGTAAATA TTTTATATATAAAATAAGCCAGAAATAACAACATGTACGTGCTTACTGAA CTAACTTTTACAATTTTAATTTAATTAATTAATTAATAAACTTTGGTAAC CAAGGCTACCTTTGTTAGATCCATAAATAAAATCCAAGTAAAAGCAAAAA TGTCCACCTGCATTTGCTTGGGCCCCAAAAGAGCGGGCAAAACGCACCTT TTGAAAGCTTTACAGGATCCGGAATCCATCGATGAGACCACGTTTTCCAT GCCCACCATTGGCACTGGGATTTACCGAATCCATTTCCCAACAAAATCGC CAAATGGGGATAAAAATAAGCCTCCTCCCTCAGAAGCTCCAGCTAACATT CCTCATGGCGGTAAAAATCTGCCCAAGTCCATACAGATCCTGGAAATTGG AGGGAGTATGGCCCCCTTGTGGAGGCAGTATTTCGAGGATGTCAAGAAGC TGATCTACGTCGTGGACACCTCTAATCTCTGTCAGATTTCAGCCGCCGGC GTTCTTTTCTATTCAATCCTCACCGAGCCGCGTCTGCAGTAAGTAAGGTG GAAATGAACTGAAAGCTCATGCACTAGTTAAATTCGTCGCAGGCATAATA CTAAGATCCTGTTGGTACTGGCCAAAATGGATTACTCCTACCGCCAGATG CGAAACGAGGCTCTGCTCATGCTGCAGATGCAGAAGTTGCAAAAACAGAT CCGCCAGCAGGTGACCATCGTGGAGGCCAGCGCCGTCACCAAAGTGGGCT TAGACCCCATCTACGATTGGCTGCAGAGACCCTAAATAATAAAATATCAT AGAAATTAGTGTGTCACTCACATTAATGATACACCAGTGAAAATATTAAA CTCTATTCCGATGCATTTTTATGTGGCTTTAGTTAATAAAATTAAACGTG AACACTGCCTAATCTATCAGATAGAAGTTAATATCTAGATTAAGACCTAA ACTTCCCAAAAAGCAGAAAGCAGAGGAGATGCAGATGCATCCCGGAAGAC AAACCAAGAAACAAGTTGGTTATATTAAGCTCAAATTAACATTAAAAATT TAGGTAGATTTACAGAGAGGTATAGTCAGGGTGTCCCAACAGGGTGACTC CCCAGGGACCGGAACAGGCGCACTGCAAAGTAATTAATGTTTTGGCCGAC CAGGTATCCATGGTAATCGCCTCGTACCCCGAACCTAACCAATTCAAACT ATACCGGAAGACCCTTTCCATATGGCGAGTATACACCTATACCTGCTAGA GGCCAGTCAGTCGATACCAGCAACCGCAGCAGCGGAGGAATCTACAAATT AGGTCCCGTGCAAAAGAGGTAGGCGGGAAGTACAAATTATGGGCATAGAA AAATTAGATGGCATGGAGACGAGCCAAGAACTAAGACCAGATTCGAACCC AGAGGAGTCCAGAGGAGCGGAGGAGGGAGATGAACCGCAGGAAGCAGCAG CCGCATTCCTGATGCCCCTGGATTTTCGGGCTTGGAGGGGCAGAGGAATG ACACGCATCCGGTTTTAAAATTCCAGTGATCGAAGCGCAGCAGAAGAGCC CGAAAAAAGGAACTCAGCCGAGGAATTCAAACACTTGAATCGGACACAGA TACACAATATACTGAACGAAAAGAAGAAGTTTTTTGAGAATCGAAATATT TATTTATTATATGAATATGAATATGATTTCCAAAATATGATTTCTTTCTG TCCAACCTAATCAAATTTACTCGTTCTATGTGGAATTCTCAACATCTGTG TACAGTTTTTTTTTTTCGAGTGTGACAACTAAAGACGAAGGACGCGAATC GATGGCATCAGCGATGCTGGCGACTCTGGAGCTGGACTACTTCAGGGCGG TGTCCCTCTACCGTCGACGCTCCTACGAGCGGTGTGCGGAGCTGTGCAAC GCACTCCTGCAGGCCGGTCACGATGGCCATGTCCAACTGTTCACCACCAA GGAGGAGGAGGAGGAGGAGCAGCACCAGCAGCAGCAGGCGGAGCACAGCA GATTCGGTAGCAATTTGCAACGCATTGGCCCTAGGCCAAGAGGAGCAGCT GGAGGTGGAGCCGGGGCAGTCGACTCTGGGCCGTCCATCATGATGCCCAC TTGGCTGATGGAGGGCGTGTGGCAATTAAAGATGCGCGCCCTTACGCAGC GCGTGTACGTGGACGACCTGGACGAGGACGATGGAGGGAATGAGGGTAAG CAGGTGACATTTTTTTTGGCGCACAATCACTCATTAATTGTTTAATAATT TGCCATTGCTGGCAGCCACCGAGGAAGTGGAGTTCGAGCGTATAGCCACT GCTGCTCGACCGGGTAGCAGCATAAAGACCGCTTTCCAGCCACGCCCCCT TACCAGTCAGAGGGCGCAGCAAGCGAGGAGCAGGGGTGCCGGAGTGGCCC ACTCCAGCGATGGCCGCTTAAATAGTTCCCGGCCAGGATCGGCAGCAGTG GCTCGACCTGGAACGAGTCTCAGTCGACCGGGATCCTCACTGGGTTCTCG TTGCGGAACCGCCTCCAGGATTCGAGCCACCTCGGCGGCGGCTTTCAATG TAGGTGATGCCACTTCGAAACTGTACCAGGCGTCCCGCCTGAATCCCACC ATATACGCCGAACGGGAAACCCTGGTGAAGGCCTTATTTCAGTTTCTCTA CTACCACGAAGCGGATGTGCAAAAAGCCCACTCCCTTTGTCAAGCGGTTC TGGAAGTTGAGCGCCAGAAGCCCAGTGGGTCCACTGGATGCACCCTGTCC TGGTGGTGGCAACAGCAGATGGGCCGATGTCTTCTTGCCCTGCATTATCC TCGAAGAGCGGAGCCTTTTCTGCAGCAATCCCTGACCAGCTTTCCCCATC CGGACACCTATCTTCTCCTCTCCAGAGTATACCAAAGAATAAAGCAACCC GAGCGAGCTTTGCTCGTGATCGGCGAAGTGGTGGATTCGCGACCCTTTGA CGTCACCTACCGACTGGAGCAGGCGAGAATTCACCAGGCCATGGAACAGC AGGAGGACGCACTGCAGCTTTACAGACTGGCTGCCAAACTGCATCCAATC AATGTGGAATCTTTGGCCAGCATTGCTGTGGGCTACTTTTACGACAACAA TCCGGAAATGGCGGTAATATTATGACCCTAATAATAAGGATATGCACAAA TTGAAAAGACCGCTTTACCTTAGTTGATGTACTACCGGAGGATTTTGTCC TTGGGAGCCCAGTCTCCTGAGCTCTACTGCAATATAGCGCTGTGTTGTCT ATATGGCGGGCAAATCGACTTGGTTCTGCCGTGTTTCCAACGAGCTTTGG CCACGGCTACCCAACCCGGCCAAAAGTCAGACATCTGGTATAATCTCAGT TTTGTGGCGGTGGTAAGGGAGGTTAAAGTACATAAATGTGTATGCATACA TTATTGAAATACTTTTCGACAGACTTCTGGTGACTTCAACCTAGCCAAAA GGTGTCTCCAACTATGCCTCACATCAGATGCCCAGAATGGAGCCGCACTT AATAACTTGGCTGTGTTGGCTGCTCAGTCTGGAGACATTTTGGGGGCCAA GTCCTACCTGAATGCAGCCAAGGATGTGATGCCCGATGCTGCGGAGGTAA CCACCAATCTGCAATTCATGGATGTGCATTACAAGCTATAAGACCAAATG TCACTTATAGCGCTCTAAAATAAAACAATTGTAACCATTCACTTTGTAAT GCTAATTGAATTTAATCGAGTGATTTATTTTTTGAAATACTCTAAAGCGC CCACCTAATATGCTTCCTAAAAAATAACAATTTTAATTTGCGGACTTAGC AGAAAAGCTTCGACAAATGTTGTGCAAAATCCAGAAGCGCCAAATGGAGT TTGTGAAATCATTGTGCCATTTGTCAGGTGTTCGGGTCAGCAAACCTGCT GATGCTGATGCTGGAGCTGAAAAGGTTGCTTCTGGCGGGGAATGGGAATG TTCTTCCACACCACCCAGTCTGCCCCTACTCCCGCCCCCCTTTGTTTGAC TAGAACAAATGATAAGCGCCAAATATTTGTTGATAAATGTTTGAAAATTA ACTAGCAACGAACGACGACGTTGAACTCATCGCGCTGGCATGCAAAAGCC AAATATTTATCAGCCTAGAAGCGGCCGTTCTACTTAGTTGGGGATTACAG ATCCCACGGTTCGGGGACCAAGATGCTAATCGAAATTTGAATAACGCTCT TGAGCTTCCAGTTGTGCCAAAAAAGGTAAACATACGGTTCACACACTCGG AAAAACCATAAATTTCATGAATTATAGATGTGGTTTTGAAAAGAATTCGA CTTCAAAACGGATGCAAAGCTGAAGGTGCAAATCATACTGATAACTGAGG AACTTAAGAACCTTGTTCATTTATAAACATTTTGTTGTTTTATGATTTTG AAATTTTAGTAAAACATTTAATCTCTATAAAGCTATGACTACCCAACCCA GTATGCTACTCGAAAGAGACTATTTAAAAACTGTTCAACGAATGATTTAC AATGCTTTTCGCTTGTTTGTTTTCTAACGTTAAAGTTAAAGAGAGTCCAG CCACATTTTGTTGTCGTGCACATGTCTATCTGATTCTACACATCTATGTG TATCTGTATCTCTATCTGTATCTGTATCTGTATCTTTTATTTGCCCGTTT CCGTTTTCGAGGAGAGTTTCGTTTTCTTTTTGGCATTGAATTCGTATTCG CGTTGACTGGGCTTATCAGCCTTTGGTCGAAATGCGTCAGCGTTTGCGGG CACTTGACGGGCTTTTTACTTTTCATTTTTATCACAGACATGCGAGCGAA TTGCAGCACTGCTCAAAACTCACCTGCCCCTCAGTCGGAGTGACTAGTTA ATCATTGCCGGATTCGCCTCGTCCGGCGGCAGGTGCCTCCAAAGTGTCAA GATGATCTCGTAACGCGACTCTCAATTAGCCGGCCACACCTGACAGCTGC AGATTGAGCTGTGAGTCGGGAACTGAGTCGAGAAAGGTATTTCGCCGGGC TCCACATACTCCATTTCACCCCCTCCCCACTCGGGGATCCCCTTTTCGCG GCTTTTCAAATATTTCTGGCGCACGAGCTGAACGATCTGAGATACGTCAA GTTCTTTTACTTCTTTAGGCTTTGTTCCAGATGCAATGATTTTTCGATCG GTTGACTGACTCAACTCTACATTCATTGCCACAAATATTTCGGACTCAAA ATATATAGAACTATAATTATAATTCTGCTATGCTGCTTTAGTATCTATAG TATAACATGATTTTAAGTAAATTGTTTTGTGTGTCATGTGTGAAATTGTA TATGTGCATACATTCCGCACACTTCACACGCCTCTGTTTGAACAAGTGTT TTTCCTGCGGTTTATTTCTATTTCTGCCTAAAACTGTGTTACCATAATAA TATGGCAACCAGCCCCCCCCCCCCGCTCCTTCTCTTTGCCGAGCCCATGG GAACCAATTGCATTACCGTGAATCCATTGATAGCCGAGAAGTCGATGTCT AGGCTTGTTGTGGGTAGACCGCAAGAGCGAAAAGCACCATCATCTTCTCC GGCTGACATGGAGATGCAGCTTGGCTGCCCCGGGTCATTCCTTTCCCCTT GCCACTGGTTCTTCCGATCCTGCAGCCCATATAAAAGCTCATTAAAAACA TAAAAAAAGAGCAGCCAAGGCAGCAGCTACTGTACGGAGCTTGGATGATT TCGTCGATTTTTAGCGACCATATAACCCCCCGCAAGATTCCCCATGAAAT CTCCTCTAAAGGAAGAAAAGCAAAGGAAAGGCCAAAACAGGTAAGTCAAC AACAGGCAAACAATTTGCACAGCGAGAAAATGATGACGTTTTGTATGTAA AGATTACTAAATGATGATGATTGCCCTGTAGAACGTATACTCGACGAAAC CTCCAAGGGTTGCGTCTTGATTCCACCTTGGTAAATAGTTTTTTTTTTCA CTGTATTCATCTGCTCGCACTACGCACGCGCGATGTCGGCGTCGACGTTC TCTGCTGCGTGGCTGCCTTTATGGTGTGTGTGGTTCGTTTCCTTTTTTTT GGGGCTTTGGGGCCTTGGCAGCCTCGAAACTCGTGCCTCGCGTTGCTCTT CTTCTTGCTGCTAGCCGGTATTTACAGGGTATCCAGGGAGGATTTGTAGT AGGGTATATGTATTGATTAAATTGACTATAATGTGAATAGGGCTCCTTCA ATTTTGAGCGTTAAGTCCCCAAGCGCAGATAGGTCGAGTATATCCCTGTA TGTTGTTGCTGCTGCTGATGATGATGACGATGCTAAAGATTGCAATCACG TTGCGCCCAGCGTACAGAATTTGTATCTTTAAGATACATCTGCGACCCCT CCTCGACTCCCTGCTCACTGAACTTCATTTCTCCGGAATTTATTTAGAAC ACATTGTTGCTGCTCCCGTTGGAGGTTGCTGTAGCTGCTTCTGCCGCGAC GTTGCAGCCGGGGGCTTAGCAGGACCAGCAGCAACACAACACAACAGCTA CAGCAACACAACAGCAACATGCTGCATTCCAAGGCCCAAAAAAGGCAAAT CCCAAGCTGCAGCAGCGGCAAAATCGATTGGCAGCCTGAAATTTCATTGC AGTTTAGTCGGATTGCCGCTCACCAGCTAAAACCGAGAGAAGAGAGAGAA AAGTTCGGTTCGAATAAATTGAATCGAATCGAATGAGATGCCAAAGAGCC GCGATGCGATGCCGACTGGAAATGGAGTGAAAGTAGGGTAGGCAGATTAG ACTCTTCGGATTCGATTTGACTCCGACTTGGCGAGCATCTACACTTGACC AAAAAGTAAGTTATGATTCTGCATAACATTTTAGGTATTTAAGATAATAG CAGGAGTGCAGGCATTTCTCTAAGTATTTCATTCCCAACACTACACACAT TCGGCCATCCAAAGGTCGGAGTTGACACTCTTGCTCTCCCATTCAGGTGA CCCCGCCTTATGTCCCCCCTCCCCTTTTGCAACTCCTCACCCTAAAAACT TATTTAAATTCGTCGATAGAAAAAGAGAGCTACAGCGAAATACCAGCTAT TCGAATAGGAAGTGAGTTAGTGTAACAAATGTAATAAAAATACCTGGGAT ACATTCTTCGATGATGGTCTGAGCACGAAGTGGAGAAAGGGGGGCGGCCC ATTAACATTATCGTGGCCAGCAGAAATATTTGACCATAATAAAAAGAATT GAAAACAAAGCGAATCGAATCGAACAGCGAATCGAAGCGGAAACCTAATC GTCAACTCATCGAAGCTTACGATACTCTCGATCGCGAGTGATAAGGTGTT CAATGTTGGGTGTTGAGTGGGGCTTGCATTCGCTTTAAAAGTGCTTGAAG AGGGTAGAACATTTTCAAGATTGCTCAGTAATTTATAAATTTTTATGGCC AACAAATAAGCCTGGTCCATTGCTATGCCAATAAGATTTTACTCATCCAG ACTATGACAGGGAGAGGGCTTTTAACAGAAGGGATAGGGGTATGCGACAA TCGGCGATATCGACGTTCCATCGCCTGGCAGTGAAGCGTAGCGAAAACAC GCCAGAAACAGCAACACACACCACATCCACATCAGTGGGTTGGTACCCGC GTCATATGCCAACTTATTCAATAAATTCCTGGCCTCCTCGCCATATCATC ATCGCCAGCGACTTTGGCTCTGCCCAAGACCGCAAAGAGCACGAGGAATT TTGAATAGAAAGAGGATCAATGGCAGCTGCTCTTGGCTGAAAGATCACTT TGCCAAAAAAAAAGGCCAGAAATGCGCGCCAATTCCGCAAAAGCGATTCT CTGGACCGGGAGACTGGAGACTGAAATCGACTTCAAGGAATTGCATAAAA CATTTTTGGCCGTTCTTTTTTTATTTTTTCACTCTCCTCGCTCAAAACTT CGGCCTCGACCAGGCTCCAAACCTCGCACACACACAAGCACAGATATAGA ACGTATGTATATCTACACGATATTGACCAAGAACGTAGTTCCCAAAAGGC TGCTTACAGCAACAACAACAACCGGTCTTAGAGAACCAGCGACCAAGCGA TCGACCAAAGACGAAAGAATAACGAACAGCCACAAAACAAAAAAAAAAAA CAAGAATGAAAAGCTTGGGCTTCAAGTCGAAGATGGAAGTACTCTAGATC TCTTGTAGTCAGACTGATCCGGTGGGTAACAAACTACCTTTACTCAAATT CCCTTACACCATAGGCTTGTCAATAGAGAAATTTTCAAAATTTGTCCCAG GAGTGGCATGTACTTTTTTTGAAACCTACAAACCTTTTTTAATTCTTCCC GTTGTATCCCAAACAGGGTATAGCAGACACCACAACGCAAAGTACACTCA AAGAAATCAAAGGCTGTGCGAGTTGTTCCCATCGAAACCCCGCCTCACCG GAATGTCTCGCCCAATTTCTACCCCTGCCCCACCACTTCCCTGACTTCAG TCAACAAGTTATGTCCATGGCAAGACGACCCGACCCCGACCCCTTGACTC TCCAATTCTGAGTCTTCGACTTTTGGCCGGGTCTTCAGGGGCGTAGCGAG GGTTTGGCACCGGGGCACAACTTCGATCATCATTATATAGTCTTTTGGTT GTGTTTAGTTACGATTTTTATATCATTTAGACTTTTTTCCATATAATCTA AATTTTGTTTTCTGTGGATTTTTCTAAGTAGCCCCTTGGACGAACTGGTT AAAACCTTACTTGGCTTACACTGATCCCCGCCCTTTCGTGGGGCGTGTGT ATGCCGCATATTTGAAGCAAATGATGGTTGAAGAGGTGGAGGAGGGGAAA TGAAAAGGAGGAAATCTAAAGAAGAGAAAAAGAGGGAAGAGGGAGCAAAA AGAATCCAGCAAATCAAGCTCACATTATGCTGAGGAATGCGCCCAAGTGA CGATATCGTAGCAGCAGAGGACGCCGATAGAGGCAGAGTCTTCAGACCCT CAAGTTCCGATTCCGATTCTCCCTCGTCCAGTGCATCTGTATCTGGAGTT TTGCCCAGAGAGTTTATTTATAAGATAGTCGCATCGATGGCTAGCGCAGG GATACTGAAAGCTAGATTTGAATCCAATAGGCTTCCGCCATAGTTTGGCA AAAAGTGAATGCCAAAAGATAGAACTCATAATGTAATTGTAATATACAAT GTAAACTACAAGATAGCATGTGATAAAAAGCAGAATTAGAAAGAAAGGTA CCTTTGTTAAAATTCTCATATGCATTTTACTTAAATCTGCTATCCTAACA GGGTATCCTTTAAGCCCTTGAGAATCGGAATCGTCGTCTCGCGAGATAAG CCATTGGAATTCCACTACTCACACGGACGCACACACTATGTAGTTGGCTA CTGGGATTCTCCTTTGAAGTTTGTTTTTCTTTTATTGCTTATTGCTATTT ACATTTTCGTAGCCGTTGTTGTTGTTGCCATCGGGTTTGTGTATCGCTGT GTGCGCTTCTTTCGAATTCGAATTCTCTCTTGGGCTCTCTTTTCGTTAAA CGCGGCTTCGTTAAGTTTTAACGAAATCTCGACTCGATCTTCGTTGTGTT CGGTTTCGCTGAGCAGGGGCAAAATCAGTATATCGCTAAACGTCAACGGT AACCGAACAGATCGTCGGGACAGCAAAGCATGTGCTTTCCACTGGGAAAT ATAAATTCGGTTTAATGAATTTATTCGAGACCTAACATTCGGAAAAGTTG TTCTTCAGATCTTAAATGCACACCGCACGCACACCAGATCGCCCAGACAC ACACAGAGCTACACAGATTCAGTTGCTTAAAGTGAAGTTCGGTTTTCACT GAAACAAAAACAGCGCGCTTCGTTTTCGCACTCGCCTCAATTACAAAAGT GATTTTTGTTGGTGTTGGTGCAACTAGTTCTGATTTTGGGAAAACGCGCC TTAAAACCACGAAAATATCTACGACTAGTAGTGTAAAAAAGCTGAAGTCA ACTCCGAAAAGTTGGTGCTGGTCAAAAAGAAAAAATTCAGCCGCAACAAC AACTGCCCACTGGAAACTACAACTACAACAAATAAAGCAGTCAGCAACAG CAAAAACAACAACCCAGCAAACGGCATTCTTTCGCGCAACAACAACGACT CCACGCACACAGATACTCTCAGTTGCGCTCGCCCGCGTGTGCAATTGTTC TGGTGTTAGTGAGTTTTGATTAAAGTATGTGCGACGCTGGAATGCGACCC GATCGCTGTTGACTGCGCAGTCGCAGCGCGCGTCGTGGAAGTGGAAGAGG TCAGAAAGTAACAACAACGAAACGAAAATTTTACTGTTAGGCACTTATCG ATAGCCAAATCAATAGATCGGTTTTAAGAGTGCACGAAGAGTGAGCTTTA GTTAAACAAAACTACCAAACCAAAATTAAAAAGCCAGTTATTGTGGATTA CGCGAAACCGAAACAGAAGCAGATACAGATACAGCATTAACAATGCCGAC TTCTGCAGCGGCTTAAGGTAAGAAAAGGACAGATACACGTGCAGATATAG AGTGGTGTACCCATATGGGGCCATTTCCCCGGAATTTTAATGACTCCCTG AAAACGGCAAACAAAACAAATGCCAGCAAATTTCTTATCTGTCAACCATA AAATCGCCAACGTCCAACGATTGTTTAACATTTCGTTGTTGTCGCCAGCT TTTTTCTTTAAATTTTTTTTTTTGCGTCCCGCTAAGAGTCAAAAATTCAG CGAATTGTGCAATTAACCCATTTCGGGCCATGGAATATCAAATGTCAGTC AAACTTGACACTCTACGGAGGGTATATTGAAATGGGGAAGCTGTTTAGAG TACTATTGTGTCAAATATATATGTACATTCACATGTGCATACATATGTAG TTATATAGTAGGCCTGACCGACTTTTTAAATACCGGTCACATTTAATTAA TTTTTTTTGACATTTTCTATGCGGCCCTAAAGTATCTTTGCACAGGGTTT CACTTATCTCGGGATCCAATTTCCAAGTGAGCTAGTCAATTTGATAGGTT CTATGGCTAATAGGCGACTTAAACGGTTGTCAGAACGATCGACGGCGATG CAATTAAGTGAAAATGGAAGCTCCACAGAGTTCTATTGTTATTCCCGGGT TTGGAATTTCAACCGTCCATCGGGATCCCTGGAACAATTGCTGAAATCAG AAACCGCTTGGCAATCAGACATCTTGAATGTAAATCAGCGAAAGATAAAC AAACGGGTGAAAACACACGCTTTGGGTATCAGTCGATAAGCTTTAAGCGG TTAAACGCTAATCGTTAAACGATTTTGCCACCAGGCAATCATATACATAT GGGTAACTGTATCTGCGGACAGACGTATCTATATCTCGGCAAGTACACAT GTATTCCCCGGATCGTAGTTTTAGTTCGCTTGTGGTTTTTTCGATTGAGC ACTGACGTCTACATCTCCATCTCCGTGCGTATCTCTTGATCTCCACATCA CACTTGACCTCAGGCAATGGGCTTTTGCATTGAAGCTGACAACAGCAACA GCAATGATCATACAAACTCAAAATATTAATTTCGTAAACTGAAATTCCTG CACGCAGTTGATATGCGTGTGCGAACATTGAAAACTCTGGTTGCTCATTG CCTCGAACAATTCAGGCAATTAAAATGTACAACAAATTAAACAAATTTCG AATGACAATCGGAGTCGAGGCTGGCTCAGAGATATAGAGGATACACTAAT GAACGACCTTCGAGGATTAAAAAAATGTACTTATCTCTATGCTCGTAAAA AAATATTGTTTCAACAACATATTGCCAGATAGGCAAAAACTTAAAAGCCT CTTTACTTAGAATTGGTCAAAGAATTATTCTAGCCATAATCAAAATACCT TAAACTTTAGAATTATTGGTTACTCGTATTATAGCGCATTCATTTAACCC AAGATACCCTGTATGGACTGCTAATTTTTCTACGGTATTATGGCAGCATA GTTTCGCACGCCTCCGATTTGGCATGCGGCACACGTTGCGGCTTCTTTTT TGTTTTTGTATCTTGCTGTTTGCTGCTCTCATTGTGGAGGCCATCGCCTC CGCCACCGTTACCACCTTCGTTCGCCCAGTTGGGCATTTCGCGTCTGCGG GGTGTGGTGCGCAGTGGAGGAGAGTGGTGCGATGTGGTGCGATTTTGTGG TGCCTAGCCAACTGAAGCCGAGCGACGACGTGTGGGCTGCTTTCTTTTGG CCCACTCCGCCCTGGCTGCTCCTCACAGCTATCCAGCCAACCGAGCAAGC GACC