##gff-version 3 ##date Tue Nov 28 12:11:11 CET 2023 ## exported from the transgeneomics system molecule_59058875 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59058875 mpicbg region 9631 21225 . + . Name=dmel-5.43-3L;type=genome;start=3806402;end=3817996;strand=+ molecule_59058875 mpicbg region 21226 22180 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2436;strand=+ molecule_59058875 mpicbg region 22181 22287 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3813;end=3919;strand=+ molecule_59058875 mpicbg region 22288 44153 . + . Name=dmel-5.43-3L;type=genome;start=3817997;end=3839862;strand=+ molecule_59058875 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59058875 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59058875 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59058875 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59058875 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59058875 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59058875 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59058875 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59058875 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59058875 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59058875 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59058875 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59058875 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59058875 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59058875 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59058875 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59058875 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59058875 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59058875 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59058875 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59058875 coding_transcript gene 9943 12319 . + . alias=Int10;Name=IntS10;identifier=FBgn0035462;alias=CG1120;alias=Integrator 10;id=50406262;ensembl=FBgn0035462 molecule_59058875 coding_transcript gene 12375 13410 . - . ensembl=FBgn0052262;id=50878657;alias=CG10854;identifier=FBgn0052262;Name=CG32262 molecule_59058875 coding_transcript gene 13541 14343 . - . alias=CG10854;id=50878639;Name=CG32263;ensembl=FBgn0052263;identifier=FBgn0052263 molecule_59058875 coding_transcript gene 14498 17187 . + . id=50406526;identifier=FBgn0035464;Name=CG12006;ensembl=FBgn0035464 molecule_59058875 coding_transcript gene 17419 22674 . + . alias=Succinyl coenzyme A synthetase alpha subunit;id=50696360;alias=scsalpha;Name=Scsalpha;alias=succinyl-CoA synthetase alpha-subunit;alias=Succinyl coenzyme A synthatase;alias=Scsalpha;identifier=FBgn0004888;alias= alpha subunit;ensembl=FBgn0004888;alias=Succinyl coenzyme A synthetase alpha subunit;alias=CG1065 molecule_59058875 coding_transcript mrna 17419 22674 . + . id=50696373;parent=50696360;Name=FBtr0073151 molecule_59058875 coding_transcript mrna 17419 22445 . + . parent=50696360;Name=FBtr0303096;id=50696403 molecule_59058875 coding_transcript exon 17419 17584 . + . parent=50696373 molecule_59058875 coding_transcript exon 17419 17584 . + . parent=50696403 molecule_59058875 coding_transcript five_prime_utr 17419 17547 . + . parent=50696373 molecule_59058875 coding_transcript five_prime_utr 17419 17547 . + . parent=50696403 molecule_59058875 coding_transcript cds 17548 17584 . + . parent=50696373 molecule_59058875 coding_transcript cds 17548 17584 . + . parent=50696403 molecule_59058875 coding_transcript intron 17585 19860 . + . parent=50696373 molecule_59058875 coding_transcript intron 17585 19860 . + . parent=50696403 molecule_59058875 coding_transcript gene 19152 19583 . - . alias=Acp63;alias=Accessory gland protein 63F;alias=CG10852;Name=Acp63F;alias=Acp63F/64A;ensembl=FBgn0015585;id=51153693;alias=acp63F;alias=Acp63f;alias=Accessory gland peptide 63F;alias=CG10852;identifier=FBgn0015585 molecule_59058875 coding_transcript mrna 19152 19583 . - . Name=FBtr0073182;parent=51153693;id=51153706 molecule_59058875 coding_transcript exon 19152 19275 . - . parent=51153706 molecule_59058875 coding_transcript three_prime_utr 19152 19213 . - . parent=51153706 molecule_59058875 coding_transcript cds 19214 19275 . - . parent=51153706 molecule_59058875 coding_transcript intron 19276 19329 . - . parent=51153706 molecule_59058875 coding_transcript exon 19330 19485 . - . parent=51153706 molecule_59058875 coding_transcript cds 19330 19485 . - . parent=51153706 molecule_59058875 coding_transcript intron 19486 19546 . - . parent=51153706 molecule_59058875 coding_transcript exon 19547 19583 . - . parent=51153706 molecule_59058875 coding_transcript cds 19547 19574 . - . parent=51153706 molecule_59058875 coding_transcript five_prime_utr 19575 19583 . - . parent=51153706 molecule_59058875 coding_transcript exon 19861 20309 . + . parent=50696373 molecule_59058875 coding_transcript cds 19861 20309 . + . parent=50696373 molecule_59058875 coding_transcript exon 19861 20309 . + . parent=50696403 molecule_59058875 coding_transcript cds 19861 20309 . + . parent=50696403 molecule_59058875 coding_transcript intron 20310 20665 . + . parent=50696373 molecule_59058875 coding_transcript intron 20310 20665 . + . parent=50696403 molecule_59058875 coding_transcript exon 20666 20950 . + . parent=50696373 molecule_59058875 coding_transcript cds 20666 20950 . + . parent=50696373 molecule_59058875 coding_transcript exon 20666 20950 . + . parent=50696403 molecule_59058875 coding_transcript cds 20666 20950 . + . parent=50696403 molecule_59058875 coding_transcript intron 20951 21012 . + . parent=50696373 molecule_59058875 coding_transcript intron 20951 21012 . + . parent=50696403 molecule_59058875 coding_transcript exon 21013 22674 . + . parent=50696373 molecule_59058875 coding_transcript exon 21013 22445 . + . parent=50696403 molecule_59058875 coding_transcript cds 21013 22290 . + . parent=50696373 molecule_59058875 coding_transcript cds 21013 22290 . + . parent=50696403 molecule_59058875 CLC cds 21226 21285 . + . Name=2xTY1 molecule_59058875 CLC cds 21292 22008 . + . Name=SGFP molecule_59058875 CLC cds 22015 22056 . + . Name=V5 molecule_59058875 CLC cds 22057 22080 . + . Name=Precision cut site molecule_59058875 CLC cds 22081 22101 . + . Name=TEV molecule_59058875 CLC cds 22102 22173 . + . Name=BLRP molecule_59058875 CLC misc_recomb 22181 22214 . + . Name=FRT molecule_59058875 coding_transcript three_prime_utr 22291 22674 . + . parent=50696373 molecule_59058875 coding_transcript three_prime_utr 22291 22445 . + . parent=50696403 molecule_59058875 coding_transcript gene 29740 32816 . + . identifier=FBgn0064227;ensembl=FBgn0064227;Name=Rdh;alias=Rdh;alias=Red-herring;id=51142805;alias=CG14975 ##FASTA >molecule_59058875 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACCAATTGGTTATTTAGCGAAT AATCAGCTGGCTGGCAGCTACTATGCAACACTACTGCCGCTGCTGTTATC GATTGCAGATGAGGAGAGAGTCGCTTGTTAAGCTAGCTATATTCAAGCTG AAAATTAAATATCTTCGAATTCACCGAACATATATTGATATAAAAAGCGT TTTAGGTTGAAATGACTCAATAACGCCAGCCCTAATGTAACTAAAACAAG CGCACTATGCTAAACAAGCGTTTTGAAAATAATTGAAATCTCTAGCTAGT TTCTAGATCCAATAGTTCCCATCCCTAATAGAAAAATATGGCCAGTGCTA GTAAATAAATTCCTAATAGCCGGCTAAATGGTTTGTTTTTGTTGAAACTA GGAGAAAATTAATAAAAACAAAAGATATACCCGAAGAAACATGCCGAGCC AAGAGGAAAATGAGTTGTACATGGTCAAGGAGGCGCAAAGACTCCGGAAA AGCGATCCTTGCGCGGCCATGGCCTGGATTATCACAGCTAAAACTTTATA TCCCAATGCATTCAACCTGCAATACGAGGCTTATCTACTGGAACGCGATG CTCAGAATTATGAGGAGGCAGCAAAGTGTTTCAGTGCTATGTGAGTATAC AATAGCACATCTATTCCAGTTACTTTATCTTTTACTGTTCCAGAGCCACC AATTTCCAGAATCAACATACGGAGCTGTGGCAGGAGATCAACTCCCTAAC AAATGCCCTCAGAAATGAGAATGAAACTACGCCGGAACACGAGTTCTATG TAAAAATGTACAAGCACCTAACTCCGGAAGTACAGCACAACATATTCATG CACACCATCAACCACAGTGCCGATAATCTGGAGCGCATCTATATCTACAT ACTGATGTTCAACAAGTTTCCCAAATCAGCCATAACTCAGGCTCCCAGGC TACTGGAAATGCTGGCGGAGGGCATGAAAACCGAACCGGATCTCTATCAG CGGATTCTGGTGGAGGAGGTATTGCCCATGATCCAGAATAAGCCCCCGGA ACTTTCGCCAAATCTGGCCTGCAGACTTTATACCAGTTCCTTGGAGTTTT ATTTGCGGCAAATAATGGATGAATCGGATACAGCAGATGCCTGGAAGAAC ATCTTTAAAGTGCTGATGATCTGCGGTCAGATGATGGGCTGGGAGCCCTT CCTGCCCTTCAGCAAGCATGTCAACCAGAACGTCTACTGGGAAAAGCTGG TGGACATACTTTCCGGCAGTCCTGCGGGCAGCTCCCAGGTTTTGTTCTAC GCCACCACCTTGTTCATTTACTCCCTTCATGGTTATATACGAAATTGTAA GCTGAGGATCGAGGATGCCGATGTAACTCATGTTTTGGTAGAAGGATTCA TGGAATGGTCGCCGGAAGGTGATGGCTCCGAAGTGCCCAGCATGGAGCCA CCGAAATTCTCCCTGACCACGGCCATAAGTCCAGAGTTATCCAAGGCCTT CCTACACGCCGCCCAGTGCTGGCAGCTGCTCAATACGGATCAGTTCCAAA GGGATTTCAGTCAACTTATGCTGGCTCTTCCCTTGGCGCCTTGGATCTCA AGATTCCTCTTCGACTTGGCCATATATTTCGGACACCGGGATGAGGCCAA CAAGCTTATGGCGGACATGACCACCCAGAGCAGTCTGGTGCAAAGCCTGC AGATCTTGAGCCTTAATCTAATGCAAGGCAGCATGACGGTAAGTAGAGAG CCAGTTTTTTCACATGGGTAAACCTTAATGAATTTCTCACACAGCTCCAG GGCTTCCAGTGCATTTTAAAGATCCTGTCAGAACTCCCCACCACCCAGGG TCAACTTTTGGAGAATATGTCGCTGAAGGGCCACAGGCACATGGTTTTTC TGCCCCTCACTCGATCAGCGTTGGTTCAGTACTGCGTGGGAGCCATCATC AGCAGACTGAGTCGCAAGGTCTTCGAACCGAACGTTCCAGATCGATTGCT AGGGGATATCCTAGTGCTGCAGCAACTTAATCTACTCAACGATGTTCTGC TCACTCAACAGATATTTAACCTGATCAAGCAACGGAAATCGTTCAATCTG CGCACCCTATCCACCTACATTATTAATATCGATTTGCTCGAGGAACTCTC GCACATTTGGAACTCCCAGCAGGAGGATAACTTTGAGTTGACCAGCTCGC CAAATTCGAGTGGCACACCTACTGCGACCACTGTAGCTGGTGGTTCCCAA AGCCGAAGAATTGGCACCCGTGGAGCGGACAAAGGAGCCCGAGATGAATT CAGGGCGATAACACGCCAGCAGATTGCCCGCTGCAATGAGAACGTGATCA CTTTGCTTGCGAATTTCATTAACCAAGAACACTTGATGCTGGCGCAGCAC ATCTTTGGAATCAGTCAGCCCGTGGAGACGATTGTGATTAAGTGAAATAA CTAGGAGGTAACATTTATAAAATATCTATTTTCCAGCTATCTTACACATT GTGTGTTTGGTTAATACATACGACTATTATATTTAAGTTCACCAGTCTAG ACTGGTGTATTTCGCTTATCGAATAAACAAATATTTATTTTATCAGCTGA TAACATAGTTAGAGGTTGCATTTGATATGTTTCGATTTAGTCATACGCAT AATTTAAAACTTCATGTAGTTTTAATTTAATTTGGGTATAATAAATATAA TTGATCGACTAACAATAACTTAAAATGATTCATCTTATTTCTTGGTTAAG CATTTATGTTAAAGGACCAGTTGTGTACTAAACATGCATATTTATTGGTA TTAAGAGCCTCTTATTTACATAATAACCCTCGTGTTCACAATAACTAAAT AATTTGGTTTCTTGTCGATATCACACCTATTCCGCGATTCCTATTCGTTC TGTCTTAAACGGCTTTTTGGGCATCGGGACTCGTCGTTGAACTCTGAGGC AATAGGTTCTGCTCGGAGGACGCAACTAACTTCTCCTCCAGTGGGAGGTG AACGCCGAAATCGTGCTTCATGTAGGACATGAGCACATTGTAAACAGCCG TGCACACATTGACGAACGTCACCCGGTATTTGGTGTCTAAATAGCGAAAG TTCAGGTACTGCGCCGCCGGCCAGGTCATCCAATCCAGCATGTAAACATA CGGGAACTTGGAGATCAGCTCCTGATTGGTGGCGTCCAGGGTCTGGCGCT CCAGATAGCAAAGCGAATAGAAGAATATGACGATGCAGGCGGGCGACATG ACCAGCTGGTCAATCAGGATCTTCTTGAAGATGTTCTTTAGCGTACGAGC CGGCATTACCCTGTCCATCCAGTTGTACACGTAGTGGTGAAGAGGTCCCT GCAGCGCGCCAGCCACAAACATCCGGTACATGCGATCCGTATCGAAGCGG TCCTGGTGCCGCAATCCACGCCTGTACTCGTACTCCTGGGCTATCACATC GCCCACGACCATCAGCAGTCCGGAGCCCACCACGTTCGTAACGAGCAGAT ACTTGCCGAACATGTTGCTCCACGCGATCTTAGTCCATCGCAGCAGTATG AAACTAAGCGCTCCACCCTCCGTTTCCCCCTTGCCATGGGTAAAACGAAG TCCGTACTTTTGGTATCCCACACCATGGCTTCTCATCCGGCACAGAGCCG CAAAATCTCTGCGGGAATTGTGGGAGCCATGGATTCGGAGACTGTAGCAC TGGCGCAGGCAACGAGTGCCAAACATCGTTCGCAGCCACTGCAATTTGCG ACTACTGTAGTCCCGTGTGTTTTTGATTTACGTTACGAAAGACCCGATTG TTTTGACGTTAAACAAGCAGCTGATTGGGGATGGCATTTTTTCGACTGAC CACCACCACTTACTGTACCAGCGAGCTTCTAATCGATAGCTTTCTTATCG CTTTTAAAATTTATCCATGAGTTGTTGGAACGCCATTCTTGTATTTTGCT TATTAAGTTTAATTGCCATTAAATATAACTAGGGATCGTGGTTGGAAACC CCGTACTTTATATGAGAAAGCAGAACGACGTACACGCAATTGGCTACATT GACGAACACCACGCGATAGAGGGAATTGAGGAAGCGGAAGTTAAGATATT GCAGACCCGGCCAAAAGCAGCAGTCCAACATCCATGTGTAGAGGAACTTC TCGGACAGCTCGCTATTGCACTCCACGAAACTCTTTCCGCCCAGCAAGCT GCTGACGTAAAAAAACAGGAATATATAGATGGGTGACATGATTAACTGAT CCACGAGTATCTTATGCAGCACACCCCATCCACTAGTGCCCGGTAGAACC CCATCCAACAGCAGATAGAAGCCGTGCTGAATCGGACCAATCACCGAGCC CGTAATCATCATGCATCCTGAGCGAGAGTAGTCAAAGGCTTTCTTTTCAC CAAACCTCTCGTACTGCTGAGCAATTGCATCGCCGATGGCGAGGAGCAGT CCCGATCCGATGGTATTCGTCAGCAACAGGTACTTTCCGAACAGCTTCGT CCAGAATTTTGCATTCGGAGGGGGGGCTGTCGAGAAATGCGTTACTAACT GGCAGCTCATCTTTAGCGGATTGGCCAGTCGAGTCCAGCTAAACATCATA ATTCCATCTGATCCTATTTTGTTGTCTTGTAGGTGTGCGATTTGATTCAA AAACATTAATTTTCTATCGATCTGACATTGCAGGAACTGGTTTGTGGATC AGTTTTGTGATTTATTGATGGCAACAATAGGTTTATATTGAATAAACCAT GTATCAAAGGAATTTAATTGAAAAACATAAAACTTGACATAAAAGCTAAA AGTTCTACGCTGCATATCCTAACACCTTACAACACTGACCGATATATGTA AGCCGATAACTTTAGCTATTTTCCAAAGGGACTCCCTCTGGTCACACTGC CCTGTTCGGTTTTGCTTTGCACTGCTTTCGCGTTATTTTTAGCCGCTTTT TTTGCCGAAACGATTTTTTTGGTGGCTAAAAGCCATCGCAATTTCCACCA AATCTGACCGGTTGGTAAACCACCAACGCACGCAACTATTTAAGGTTAGG ACCGACCTGAAGAAACGCCTGAAATCGTGTATTAAGCGCATTTTATTTCC AGGTGACTCAAAACCATCCGGTTTTCCGGGTGGCGACAATTTTGCGTTTT TGGACCAACGCGGCGTTATTATAATGAAGCTGATCTACGTGTTTCTCCTA ATCTTGGCCGTGCGCTTGGCCTCTGTTTTCGTGGTCCAAACATATTACGT TCCGGATGAATACTGGCAGAGTTTAGAAGTGGCCCACAAACTGACCTTTG GGTAGGTTCAATTTCACGGATTTCGGTTCGATTCCTAGACATTATCTACA TAAAACTATGCTCATTTTGATTAAAAACTCAAAGTACATAGTTCGCACAC TCAATTTTATTATGTAGTATAGTCTACGTGAAAATTTTCACTGATAAATG GCCTTTAGTATCAATATATGCAGCAACTTTTTCATATAATTTAATGAAAA TCCTACTGAATCCTTAAACAAAATCCTTATCTATATGTTTCTTTGTACCT AACTCACGTTTTCTGTATTTTTAGCTATGGCTACCTGACTTGGGAATGGG TTCAGGGCATTCGCAGCTATGTGTACCCCCTGCTGATCGCCGGACTCTAT AAAATCCTGGCCCTCCTGCAATTGGATAGTGCCCACCTTCTGGTTGTGCT GCCAAGGATTGTACAGGCTCTGCTTTCGGCCTACTCCGACTATCGCTTCT TTGTGTGGACGGGCAAGCGAAAGTGGGCGCTGTTTCTGATCCTGGTCCCG TGGTTCTGGTTCTACACGGGCTCGCGCACTCTGGCCAACACATTGGAAGC CTCCCTGACAACGATTGCGTTGAGCTACTTCCCCTGGTATGGCGAATCCA CTGCTTACCTGTGGCCAGCTGCCATCTGCTGCTTCCTGAGACCTACGGCT GCTGTTATTTGGCTCCCATTATCCTTGTATCATCTGCGCAGAAGTCGCCA GAACGTGCTGGAGCTGATCCTGAAGCGATTTGTGCTCATTGGGTAAGATA AGAAATCTAAAACATTGACAGTTTTATAATAATCCAACTTTAACTTGTAG TTTACTCGTTGCTGGTCTGGGAATAGCCATCGATACCTATTGGCATGGCC AGTTGATAGTGACTCCGTACGAGTTCCTCAAGTACAACATATTTAACAAC ATCGGCAGCTTCTATGGCTCACACCCTTGGCACTGGTACTTCAGCGTGGG CTTGCCCACAGTCCTGGGCATCAACACCTTGCCCTTCATCTTTGGCGTGA TGGAAACTGTGAAGAAGTCGGAGAAGTACCCTGTTAGCAAGCAGCTTCTG ATCACCATCTTCCTGACTCTGGTTGTTCTGAGTGCTGTGGAGCACAAGGA GTTTCGATTTGTTTCCCCGCTCCTGCCGCTCTGCTTGTACGTTATCACAG ATGCCCTATCGCGTTGGAGCATCAGAGCCTCGAGCACAATGTTGTGGACC ACCGCTTTGGTCATTCTCGTGGGCAATGTTATGCCCGCCTGGTATCTGAG CACAGTGCATCAGAAGGGACCCATTGAACTGATGCCCAAGTTGAGAGAAA TAGCTCGGGAATACAGAGATGAACGCGAACACCAGGCGAATATTCTCTTC CTAATGCCTTGCCACTCCACACCATACTATAGGTAAGAAGTTTTGGACTT CACTATTCTTCAATGTTTTAATTTTGCTTTTTGCTTTCTTGTTAGTCACA TTCACCAGAATGTCACCATGAGGTTTTTGACTTGCGAACCGAACCTGGAA AAGAAGGAGCAGTATAAGGACGAGGCCGATCGCTTCTTTGAGGATCCCGT GCACTGGATTAACTCGCACATTCCTATGCATCCGCTCACCGCTTTGCCCA CACATGTGGTTCTGTTCGATCCGCTGGCCGAGAACATAAGCGTGTTCCTC CGTAACTACCGGCTGCTCCATCGCATCGAGCACGCAGAGGTAACACGGCT GGAGGGCTCGCAGGCTCTGGTGGACCAGTGGTCGGAGGCACTGGGTGCCC AGTCACCTAATCTTGCTTCTCTCTTGCAGAATCGCCAATCGCGCACAGGT CGTTCCATTTTGGTCTACCAGCGCTTGAAGAAGGGCGAGGAGAATGCATT TAATCGCGGGCCGGATTCAGGACAGCACGAGCCGGATGTCCACGATCATC CGCCGCTGGAGGATCTCGTCCTGGCCAACGAGAACGAGAATCTGTTCAAT TAGATAATAGAGAAAATAAGAGAACCCACCACCGACGCCCTCCGTTCAAA AGCAAGAAGCAATGACACATTTGAGATTAACTAATAGATACAAACCTATA TTTTGTATCCATTTTTGGCCTTAGCAAAAGTTTTTAAAACGTTGTCGCCC GAAGAGAACAGAAAACAGAAACGTAGTTGATATTCGTAGGCGCATGTTGT GTACTCTGTGCTAGTTGCTAATGTGTAAGCCATCTGAGTATTTAGACGCT AGAGGCAATGTATTTTACGTAGTCGATACAACACACTTGATCTGTCCTTT CTTTAAGATCTCGAAATAAAGGTTCAGTGGAGTAGATAAAGATTTATTTG AGATTTACATATTTTGTATATCTTATTGGTGGTTTAAACATTAATTTTCG ACGTTTCTTATTTTTTTTTTTTTAATTATCTTTTTAAAATATTTAGCTAA TTACATTTTCATAGAACAGCTGTTTGAAATGTAACTGTTCAACTTTCTAA TCGATTTGTGGAATACCCCGATTGTAACTTATCGCAGCTAAAATATCGAT GGTGTGTCGTAAGCCTTTGCAGTCGCTCTATCGATACTATCGCAGTGGTT AACTCAGCACTATTCGGCCGATTTCGCACTGCATTAATTAAACGCGTTTT AATTGAGTAAAGCTGTTTTTATCGCACAACCACCACACACAGATAATATG GCTGCTTCAATGAGGGCGCTGCTGAAAGTGCGAGGTGCGTATTCTCCACA TCGGTTGCCTAACACGCCCGATAGCCTAACAGCATAATAAATTATATAAC TTCAATGGATTTACGGCACCAAAAGAACAAATATCCAAGCAATTAGGGAG CACCTGTCGTTCCGACGCATCTGCTGATTAGTCGGCCTCCATTCGGATTA ATAAGCGGCTCAATTTGCGAATCCGCAGATACGTGGCTTTGAAATGATTA AAGAGGGGGAGTGCGGGGGTTGTGTTCAAGGTTCGCTTGCATGTGACCCA GCGTACAAACAACCGTTTTTTTTCGGCAACAAGTACAGTGGAACACCGCT TTGGTGACCATCACTTTTTAACTTTTCTCGTAGTGGATATACGTGTATAC TTTTAATTTAATAGTTCAAACAAATAATTGCTGCAAGCATTTGCCTTCGT CAAAAAGTTATTTAATTCTAATTTAGTTTGGGATATTTTTTCCAAGCTCC GATCTATATTTATGAATATTTGCCCTTAGGGCATTTGGCATGAATTACTT TTTTGAGTTCTGAAAGCATGGATAAACTTAGTATCGTTCTAAAAGTCAAA CTGGTCAGACCTACCTGGCAAACCATTTACTTTACGAAAGCAGACTTCGG TCTTCAGGAAGCTGGCAGTAAGGAAGGTATAGTGGCAATCCGCTGTTATT CCGCACCATGGATCTGCTTTCACCGTAGCTGAATTGGGGGGTTCAAGAAC TTTTGGCATTCTTCAACAGTTAGGACACCATTGACTTCTATCATTGTTAC AACTGTCACAGGGATGAAACCATACCATGTTTATAGGTATATTCCCATTA AATCTTAGGTAACTCACTGAGTATAAGGATATATCCGAAAATCTTCATGG TGAGATTGAGATTGAATGTTTCGCAAGTGTTGCAGGGTTTTACAAAGATT AGCTGCTAATTACCGAAACATGTCGTATTTAAGGCGATTAAAGCAACAGG TGTGGAATTTCTTAACAAATGTCAAGGCCACAAAAGGCGGTGTTTCTAAA CTTTAGATTACATAGATTTTTAAAATGGTAAAAATGAAGAGTTAAATCTT TATTGAAAGTGATCAAGGATATAAAATGCCTTATAATATAAAAAAGTTAT TTTCCTTATCTAGTTTTCCTGCATCTGGGTTTACCCCGGGGACACCTTCC GGCCTTGATTTTCAGAAATACTGGACATGTAAATAAGGTTAGGCGAACTG AATACGATAATTGAATTGAACCTACGAGGCTTTCCCAGTTCAGTCAGTTT GCACTGCTCTTGTCCAACGTGCAAAAGACTCAAGCCTTGGAAGTTACAGG TAGCGGCAAACGCGCAGAATGGACTTCCAGCTTTTATAAATCCTTCACAG ACACTCTTTCCATTCGCAGTCTCGAATATATTCATAACTGCAGTGGTTGA ATAGTTCAGAACGTATGTATTTACTCGCAGTTTCTTGCGTAGAAACTCAC TCAGAAATAATAAGAAGCTCAAAGCTTTCATAATCGCACGCAGATTGAGT AGTTTACATATAATTTAATGCTTTAAAATGCTTCTCAGAAGAATTATAGA ATATAGGTATTTATAATGCCTTTAATTGAAACATATATGCATGGAAATAT TGGAACAATATTACTATTTTAACGAGCAACGCGGTTTACCATGGAGACAT TTTCCGGGAATTAGTTCGATGAATCCTAAACGAATCGATTAAGTTTTCTG AAACACAAAAGGTGTCAACAATTACCCACCTGGTTTTCCGTTTTCTTTGC GTTCACACGACACCCTTTTGAGGTAACTTGGATTTGGACCATCTAAGTTA CAATCGGGAAGTATTCCGCAGTGAGGATCAAGATTTAGATAAATTGCTTG GTTGCATTTGCTCATAGCATGCACACTTGAAATGACTAAAGGGGATGTAA AAGTAAAACAATTTCGGTTAGCAACATAAGCTCCAAAAAAACTCACACAG AATAAAAACGATGATAGCTTTCATCTTGCAAAGCGACTGATATTCTTAAA GAAAATACTCAACTTAAATAGATCTATATATGGCATGAGTTCTGGAACAT ATTCCATTCGATCTAGAAAATCAATTATGTGTACTTGGAAAATGGGCAAG AAATATAGGAATTTAATAAATAATAAACCTTTCTCGAACGTTACGCAAAT GAAATTATCATGTAACTATGTAAGTTTACACTTGCAGGCTGGTTTATTAA TATCCAAAATACTAAATTTCCAACTTTAGTCCTAAAATGATTCATTCTTA CATTTTTCAGATGGCTTCGTGGCCGGAGTGCGCTGCAATTCGCAGTACAA CAAGACGCGCGGCAACTTGAAGCTGAACGGCGATTCGCGGGTGATCTGCC AGGGATTCACCGGCAAACAGGGCACGTTCCACAGCCAACAGGCTCTGGAG TACGGCACCAAGTTGGTCGGCGGCATTTCCCCCAAGAAGGGAGGCACCCA GCATCTGGGACTGCCCGTCTTCGCTTCGGTGGCGGAGGCCAAGAAGGCCA CCGATCCACATGCCACCGTCATCTATGTGCCACCACCGGGCGCTGCGGCC GCCATCATCGAGGCTCTGGAAGCGGAGATCCCCCTGATCGTTTGCATTAC GGAGGGTGTGCCGCAGCACGACATGGTGAAGGTGAAGCACGCCCTCATCA GCCAGAGCAAGTCGCGATTGGTGGGTCCCAACTGCCCGGGAATCATCGCC CCCGAACAGGTTCGTACATCTCCAGCGCTTGAGAGATAAGCTTGGCCAGA GGGCAAAGTCCACGTTCATCTGGTGGTTTTCTTATCTCTTGGTATGACGC TCGCTTTGAACTACATATATCTGTTTACTATTCCGTTTTCAATTTGCTTA TTGTTAATGTATAAACAGGCCTCCATTGACACACCCTTAAATTTGGGCAT TGAACTTTGCACCTGAAGTTGGTGGAATTTGCGGACGATACGTTTTTTAT TACCATTTATAACGCTTATCTTTCTATGCGTCACAAAACTTAGTGATTAC CCACTTCACTCCACTTTCAGTTAAGTCAATTGTATAATCTTAAACTATGT TTTTTCTGATTGCAGTGCAAGATCGGCATCATGCCGGGTCACATTCACAA GCGCGGCAAGATCGGCGTGGTCTCGCGCTCGGGAACCTTGACCTACGAGG CCGTGCACCAGACCACGGAGGTGGGTCTGGGCCAGACCCTGTGCGTGGGC ATTGGAGGCGATCCGTTCAACGGAACCGACTTCATCGACTGCCTGGAGGT CTTCCTCAAGGATCCCGAGACCAAGGGCATCATCCTGATCGGCGAGATCG GAGGCGTTGCCGAGGAGAAGGCTGCCGACTACCTGACCGAGTACAATTCG GTATGAGAAGCCATCACGGATCAATGTATTTCATTGCTAAATGTTTTTGT ATCCTATTGCAGGGCATCAAGGCCAAGCCTGTCGTCTCGTTCATTGCCGG AGTGTCGGCGCCACCCGGCCGTCGCATGGGTCACGCTGGAGCCATCATTT CCGGAGGAAAGGGAGGTGCCAACGACAAGATCGCCGCCCTGGAGAAGGCC GGCGTCATTGTGACCAGGAGTCCTGCCAAAATGGGCCACGAGCTCTTCAA GGAGATGAAGCGTCTGGAGTTAGTGGAAGTGCATACCAATCAGGACCCGC TGGACGAGGTTCACACAAACCAAGATCCACTTGATGAATTCATGGTGTCC AAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGTGGAGCTGGA TGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGGGCGAGGGCG ACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAG CTGCCCGTGCCCTGGCCCACCCTGGTGACCACCCTGACCTACGGCGTGCA GTGCTTCAGCCGCTACCCCGATCACATGAAGCAGCACGATTTCTTCAAGA GCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGCTTCAAGGAT GACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGATACCCT GGTGAACCGCATCGAGCTGAAGGGCATCGATTTCAAGGAGGATGGCAACA TCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAACGTGTACATC ACCGCCGATAAGCAGAAGAACGGCATCAAGGCCAACTTCAAGATCCGCCA CAATGTGGAGGATGGCTCCGTGCAGCTGGCCGATCACTACCAGCAGAACA CCCCCATCGGCGACGGCCCAGTGCTGCTGCCCGATAACCACTACCTGAGC ACCCAGAGCGTGCTGTCCAAGGACCCCAACGAGAAGCGCGATCACATGGT GCTGCTGGAGTTCGTGACCGCCGCCGGCATCACCCTGGGCATGGATGAGC TGTACAAGCTCGAGGGCAAGCCCATCCCCAACCCCCTGCTGGGCCTGGAT AGCACCCTGGAGGTGCTGTTCCAGGGCCCCGAGAACCTGTACTTCCAGGG CATGGCCAGCAGCCTGCGCCAGATCCTGGATAGCCAGAAGATGGAGTGGC GCAGCAACGCCGGCGGCAGCGGATCCTCGGGAAGTTCCTATTCTCTAGAA AGTATAGGAACTTCGTCGACAGATTATAAAGACCACGATGGAGACTATAA AGATCATGACATTGACTACAAGGATGACGACGACAAGTAAATAATTAAAG GCCATAACCAAACCGGAATCCGTACGCCGATCAAAGCGTATACGCAAACT CATGATGATGAACCTAACGTTAAGCTAAAAGTGTCGAAAATCGAAATTGC ATTCGAGCGAACCCAAATAAATTATTGTGAAAAATTACTAGAGAGAAACG AGAGGCGTTGAATTGTGACATGTATTCCAAGAATTAAGTTAACTACTGCC GTACCACCAAGTTGAACTAAAATAACTCGCACCAAAACCAAGATTTCTAA TTGTTATTGCACTCGGCTCATTGTTTGTGTTGCGAACAGATTTTTGCCTT AATTTTAAATGCCTGCTCGAATTATCAATGCGAATTGTATCTGAATGTGT AATAAATATGCATAAAAACAGGATAGATGTGGTGAATTTTCGTGGTTTTA GCTATACAAGCCATATCCTTTGAAAATATGAATTTTCAGGTCAATTTATT TAATCTAAACTAAAATTCTTTGGAGAAGAATTAACAAAACAATAATTTAT GAAAAGCAATGCTTACCATATTAAAAAAAGATTTAAGGAAATTTAAAAAA ATGTAGTTTTCTACTTTCGATATTTAATGGGATCGACTTGCAAACATCAA GAGCACACATCGATAGAGCGGAAGTTTCGATTAACTCGTGAAATATCTGG CAACATTAATATCGAACTGCCATCGCTTTTTGTGCCAGCTCTAATAAACA TATATATGTTTTAGGGCCGCGATTGAAAATGCGTGCCACAAAGGCCTAAA CAAACTTGGAAAACACCGCGAAAAACGTCAGAAGCTATAGTGCCGATTCG CATATTGTTCGCCACCCCGGAAAAGTGTGAAAATCGCAGATAATCAAAAG GGAGAGCAACCAAAGGAAAAGCAACAACAACGACTCGCCATGGGCAGCAG AACTGAAAATGGTGAGTTTCTAAGAAAATGTCCCTAAATTTCGTTAGCAC TGTCCCTTTTCTCGCAAAGCGTGTTGGAAATGATGTGAACATAATAATAT TAGTGCGCTTATTATTACTATTGCAACATTTTCGGTTTTTGCAGCCGCCG GTTGCGGTTGCATTTTAAAGTGCACTACATACGCACACACACACATGTGC ACATACAAATTTATCACCTCGCATGTATGTATGTATGTGACGGAGTAGTG CATGCCTTTTAGTAGGGCTGCCGGGAAGGCCCCGTTATCTGATTCCGGGT ATGTCTAATTGGAGTTGTTAGTTGGAATTTTCGTTCGCCGAGGAACTTTA TTGAAAAAAAGTTGTAGCATGGCTAATACCAGGAGTTCATGGCCTTGACG CTCGCAATACATAGTGCTGCATTGAAAATAATAAATTATGGGATTGTTGG TAGCAGATTGGTAGCTTAATTGCTCACATAATTCTTCGATTTAATATTAT GCCAATGCTTCCGTACTTTTAATATAATATATATTCAATATCCTACTTTA AAAAAATATTATTATGAAACGAGAAATATAGCTAGAAGTATTATTCTTTA TTATTCTTTAGTTTTAAGTTTTTAAAATGTTGATCCGAAATATCAGGTTG AGTTAAAAGTAATGTAAATGTAAAATATATTTTACAAACAGCACGTCATT ATTACTTCGGATATGAAAAACCACTTAAGGATGCGTCCTATCTATATATT ATGTAGATTTTTGTGTATAAGCTTTAGGATAAATAGTTTTGAAAACTGTT GCTGCTGCTGCAGATCGATTACAAAACGCCGAAAAATGTGCGTTCCAGTT CGCTAGGAACCCTCAACTTCTGGTGACATATCGCATTCTTGCAAACATTT TTGTAAGTTTTCTTCCTCTTCGCGTTTGCTCGATTTATAGAGAATGCTTT TGTTTGTGTTTAAAATAGATTCGAAATGGCTCTTTGGCCTGCGTCCGCCA TTGTCGGCGTTTTCGAGTGGGTTTTATTGAAAATCTATTTTGCGAATTAT CCGACCAGCCCGGCTATATCCCCCCTCCCTCCACTTCCCTGGGCCTTTCT CACATTTGTCTCCAATTCTCTTACATCGCTGGCGTCGCAATAATGTCGTC AGTTTTTTGTTTATTCGCTCTCCCAAACACCGAAACACGCAAAAAATAGT TCTTATTTTTGTTAAATCCACACAAATTTTCTTGAGTGAAAGTGAAGATT TTATCTTATTAGTGATTGTAGCTTCTATCAAAAAGTGTGAGTTTAGGAAA GTTTGGGTTTTGAATATCTGGACTCATTGGTCTTTCAATGCAAGTGTCCA CTGTACTTTATAATACAATTTATACTAAAAACGTCGCTGTTTTGTTTTCG TCTGTTTATTGTTTTATTTGGATACTCGCATCTAATGATTCCACCGATGA TGACCGATTTTCGGTCGATGATGCCGTGATGAGGATGATGTATCTTTGCT GATGCTCTAAACGAAATGTCGTCGTTGTCACACAATGTTGTAGTTGTTTC CTTAGTGGCTGCTGCTACTTAGTTAGTCGATTGTGATGCGCTCGGATTCG CTTCGGCCTTCCGTTTCGCACTCATTACACAAACAAAAAAAGATTGAACA CAAGTCTTACTGCAAAAACTCGCGAAACCGAAGCATTTTTCATGCGAGAA TGTCGAGAATTTGTGTAAATTAATTTATTGCCTTCGCTCATGCCACTTTC TATATCGGATGGCATTTTATTTGCATTTTTTGAAACACATTCTGGCAGGC GTACATCTTTTGATTTCGCATTTCGATATTTCAGCAGGCAAACTCCTGTT AGTAGAATTTTTATTGAGTTAAAAAAAATGTAACTTGTAATTTAAAGCAA AATTTTTATAGTCCACATAATTGAATATTGAAAAACATTGGTTGTTTTCT ACCTTTCCAAAGAGCTCATCTGATGCCTTGAATAAATCAGGAAAAATAAA TATACTCGTGCCCACAAGCGTTTTATGTTTTGAAGGTAAAATTAAAAAAA TTATTTTTTTTATATATATACACTGGGAATAATTAATATTTGGCTGATTA CTTGTCAACGAAGATGCGCTGTACTTTATTTAGTCTGCTGCTTATGAATA ATCGCCTGTGATAAGAGCAGACACATCACATCGGTTACGCCAGTTTTGTT TTTGATTTTGATTTGGCTCAAAGAGCCCCATCAGTTCCACACACCTGCCC CACCGCTGTCCTCTGTAGATTCCGCAGACAAAGTTGCGATGCCAAGCAAA TTCTATTCCCGTAGAAGCGAAGGAGGTGACTGGGTGGTGGCTTTAGGTCC GTGCAGATGCTTTTTGCATATTTCATAATTCCCGCAGATGGCCTGAGCGC GGGGAAAGCCGAAGACAACAATCAAATGGCCCCAAATGTCGGCTCCCAGG TGCCCCTTTTCGTATGCAACGGGCATGTCTCATATGCCAAATGAATGAAT GATTGAGGAGACTGAAAGTCTAGCTCTCTTCTCCTACTCCTATTAATATT TTCCCTTAAGCTATGAGCACCATTTAGCCGTTTACAGGACATCTGCTAGT CAGGATTCTCTGTTCGCCAGCTGTGCTTAGCTCGGCTTTTTCTGCGCTCT GCCGCAGAACTCAATGGCTGCTTAACGTGGCCTTAAAAGTTTTGGCCGTC TGTCACGAAAAAACCAAAGCAGAAACGATAGCTGACAAAAGTTTAAAGAT TTTAAGATATTTAGCTGCTTGATAGTAGACATTTAGATGTGTAAAATTGT TTACGTTACCAGTATAATTACTATTGGAACTAAATGGAAATGTTAGTCGT CATATCGCCGAATAAAATCTGTCATAATCAGGGTTTTAGCAAGAGCCTTT TTGGTTGGGGGCGCGCTTGAATGAAGACTTCTTTGGCTGGCCTCTTCCAT CTGTCTGTCTGGGTCAAGTGAGTGGAGGCGATGGTAGCCTTGCCCGCCTT CCACCAGCTTTCTTGGCCAGGCGTTTGTTGTTAACACCTTTCATGGCCGT CAGGACACGAGACATGGCATGGCCCAGTCATTGTCACAGGCAAATTAATT AAAGGACCCCCTCTGGGCGATGTCGTAAAGCATTTAGCATTTTAATTGCG CCGTAAAACGAGGCGGGGGACGTCGTACAGCCGTCGAGGTGTTAAGCAGG TGACAGGGGGTCACCGGTGGGTTAAGGGGGTCCAAAGTGGATGGATTCAC CAGGGCAAGAGTTGACTTTGCTTTGGCATTTGCCGGCTAATTAGATTAGA TTTGCTTGCTTAATATTTCCCAGAAGGATCGTAAGAAAAGGCCATAATGG CCACCTCTCTGCTCAACCTTCATTTTGTGTAGTGCGATAAACATCTGACT AACTTAAGAAATAAGACTAAGGATTATGGAAACATCTCTTGGTTGATTTT GAAACTATTAAATGGGGTTTACTTTAAGCTGTTAGCTAAATACTCAGAAG TGAAGTTTAATTGTAAATCAAGTATATCATTTATATCGCGACCGCTTTTA TTCAATTAAATATACTTTCAATGTTCCTGTTGCAAGCACTGCCCTTTCAT TTCACTACCAATGCCTTAATTTCCTGTTACTAACTGTGATAATTCTGGTA ACCTTTAGTCACCGGGGGGAATGCAGGTATTATAGAATTTAAATTGAATT TCCAGCAGGAAATCAGTGCAGTTGCATCTGCATATCTCTGCCCTGTGGGC CAACTAAACTGGGCCAACGCAGGCCACACCCACTGGACACCCCCACGCCG AGCTCCTACCCGCCTAACCCCCCTTTTGGATACTGCAGTTGCCTGCGGAA GTGACAGACGGATGCTGGTAGTATCCTCGAGTCCTCGCATCCTCGTACTC GGCACTTGGCCTCGAAATGCGATGCGCTTTTAAGCTCACACGTGCGATGG AGCTTAAGCTCGGCCGGCCCCTCTCTTTCTGCGGGGTATGAACCTCTCTT TTTCTATTCGCATATAGCCCACTCTTTCGCTCCGGCTAGCCCCCTCTCTT TCGCTGGAGAGCAATCTCTCCGTGTTGACCCAAATAAGATGTCGTAATTG CAGGCGAAAGGCGCGACATTCACGAATATGCAATTACATTAACCGAAGGG AGGAGAGAGACAAGGAAGCAACAGTCTCGTCCTTTTTCTCCCTCTCTTTC TATTTCTGTTTCATTGCCATCGCTTCCCGTTCCATTCCTCGTATTCCCAG AATTTTACATAAATTATTTATTACGACGCATTCGGGGAAACGCATTTTGC ACAGAAGGCGACAAAAAGTCCTTTCAAGAAAAAAAATCAGCGTTAAGGGG GGAGCGAGGGATGAAGAAACTCATTTGGCTAATCGATGCAAATTATTTTG CAATTTGCCAGAGCGAGATGGTAGTTATGGGAGATGGGAAGTGATAAGCA GCATAAAAGAGATAGATTGCTGGCGCAATTTTGATTAAATTCAAGGTCCC GCAGGGCAAAAAGTCGAACTTATTGCGTTGCTTGCACTAAAATTATGTTG CATACTTCGGGGTGGAATTTCTATGTGCTTGTATGGGTTGTGTGTGTTTG TAGTGGAATCTAGGACACGCTTCACCTGATTTTCAACTCAAAATTGCGGG ATGCAGGCCAGAATGCACATGAAAGGCTTTTAATAAACTGGAAAATAATA CAAAACTAAGTAGGGCGCCATATACAAAGCTATTAAAAAAGGTTTATCCA TTTGAATATTTAGATTAGAATTTTTGGATCGTTTTATTTACTTTACTTAC TTAGTTGTACATTTTCATCGTTAGTTATTTGATAAATATTTTAAAATTTC AAAACGTATGATAAATATATTAATAGTTCATGCGTTTATCCCTGCTGCAC CACTGTAAGTAAAACTTGGTTGGGAGACCAAAAATGAAGATTATTCCTGG CTTAACATTATTGGCAGCGACAATGAAAAAAAAATGTCCTTTCGTCTGCT TATCGCTCCTATTTACCCCCATGTTTTTGCTCCTCTAAGGAACGAGGTTC TAAAAGCTTTTTTATTGCCCACTCAAACGATGAATGCATTCATCATGAGG AAAGGGAGGAGACTCAGAGGCAAATAAAATAACTGGCATATCCCGTCAGG AATCAAATGCAATTTCAGGCTATAAATTGACAGATATGCAAGCGGAAAAG AGATGGGAAAAGGGCAGTAGAAAGAGACGGAAGAGCTTCAATTGATGGAC ACTTTTTTGGTCAATTTGCCAGTGATTTGCGAGGGTAATTGAATTGGAAA AAGTTTTTTTGTGGGATATAGAGTATATGATGATTTATGGGATAAGTTTT AAGTGGTTTAAAAGTGGTTTACTTTGCTGGAAATGTTCCAGAAAATTAAG CTAGAAAACTATATTTAACGAAAATAGACAATGTATTTCGGTTTGTTCTT ACAGCTTTAAAAGGATATGCAATAGTCGAATATTTTCCCTCTTCATTAAA ACTATTTGCATTCGCTTATCTGCTGGCTTTCACACAGGCAATTTGATTAA AAGTGTTTGAAACCGAGATTTAGATTGCTGTGATGAAAAATCTCTTTTAA TATTTACATTCAATTAAAATTGAATTCGATTTCCAGGTATGGCATGTTTT GTTTTTCATCGACTTTGGTGAAGTTTTTGTTTTACTTTTTTTGCCCCATA ACATTCCTGTTTGGCAGGACTCTCCTTCTGCAGGACTCTCTCCCCTTCCC TCTCACGCACTTATGCTCACATGTCCAAGGTCCTTTTGTGGCCTGCTAGG AAGTGAAGCCACAGAACCAAGCAGGGATATAGGGATATATAGGCAGAAAA CGCAGAAAAACACAAAGGATGAGATGCCCAGTAACCAGAACAACAACTGC ACTCGCTACGCAGCGCACGCACACAAACGCACCACGAAGGACAATAAAAG CAACAACAATAGCCACCAGGAGCAGCAGCAACTAGAAGGAGTAGATGAGA ACACTGACAAAAATAATGCCGCAAACAATATGAAATTATTAAGAGTAATA TATATTGTTTATATTGATTCTTGTTTCCACTCATTAACGGATTAAGCAAT CAAAAAATTATGCGCAAAAGCTTTTAATATATTTAAGAGTTTAAAAATAC TCCCAAATGTAGGCTCTAAAAGTTGGGCGCCAATTATTTAATTTTTTCTT CAAATTAATTGATAATTTCTTCGAGTGAGTGCAGAGTGGAGAGTCTCGAG CAAATGCCACCCCAATAAGCATTTTGCCTCTGGGCCATGGGACATCGGGC GAACTATATGGTAGGGAGGATATCTAGAGAGTGAGAGAGGGGGCTAGGAT GTGGGAAAGGGAGGGGGAGACCCATACGCTTTAACCTGTTTTCCGCGAAG CTTTTACGCACTCGCAGCGCTCTCTTTTTGCGTGACCAAAGCGAGAGCAA AAGAGAGCGAAAGACTCGCTTGATTTTTTTTGCCACCCTTCTGGGGGAAA AGCACAAGCACGAATGAGGAGATTTTCAGCCGAGAGATTCTAGAGAGAAA ACCAGAGGAAAAGAGACCTTCCGCCAGCGAATTGGCCCAGTATCCATTCG GCCGTGTTCCCATAATGTCCGCCAGCGGTCGTCGCTTCTGTCGCAGCCGT TGCCAAAGTTGTCATTGTCATCCGTACCAGCAAACGCAGCAGCAAAAGCA GCAGCAGCAGCAGCAGCAGCAACATCAGGCAGCAGCAGCAGCAGCAACTA GCAACTAGCAGCAGCAACATCTATAGGAGAAGCAGAGCCGCAGCAGCAGC AGCAGCTTAAAAATACATTTTTCACAATGAAGCAAACGGAGGCAAGAAAA AATTAGTGCCCGAGAAAATTAGTTTTTCAAGAAAAAATACAAAAATAACA AAAAGAGCGAGTGAGAGGGGCATAAAAGCCGAGAGAATGAGATGGAGAGA GAACAATGGTCGATGGGGTTTTTGCGGTTGTGGGGCTCTGTTCTTCGGTT TTCGCTTCTCAATACAAGAGTTGCTGGTGGAATATACAAAAAAGAAGGAA AACACAAATGGCACGCGCGTTGAAAAAAATAAAAATATCGGTTTTAGAGT GAAATTGCAGACACCGAGTGGTAAATGGATATGTAAAGCTGAAAAGGAAG CCCCTTTGCCGGGCAGAGTGTTTAAAAATATATAAATAAAATGAAAAGTG CAAAGAAATGTGTGCGAAAACGAGAAAAATGTTTTCGAGTCGCGAGGAAT TTTCATTTGCTTAAAAGACAATTTTTTTCGGTGGCCTTTTTGGTGTATTA TACATACACAGTCGCACACGTTTTTCCCACACACACACACACACTCATAC GAGAGTTCGGGTCTTTTTCTCGGGTTCGTTTTTCATTTCGTATTTTTCTT TAACAGCATTTTAGTTTGTGTATTTTCGACATTCGGTGACGTTTCAACAT ACAAATTAGTAAGAGTTTTCCGCGCGAGAGGTGGAAAACTGCATGCTTGG AACATTTCATCGACTTGTCAACAAATTATAATCGTTATTTGGCTCTTTGG TGGAAATGGACGCCCCATTTAGCCCTCATCTTTTGCTTCTTCCTCCCTCT TTTGGGGTTTTTTTGCTGTTTCATTTTCCATTTCCCTTCCACTGCCTTTG CGAGTGCATTGCAGCCAACTTCCTGCTCGAGCTTCTAAAGTGCAGGCACG CCATGCTCTCTCTGGGTATGCACTCAAAGAAAATTGTGGTTAGAATTTAC TTATAAATTAATTTGAGTAATAATAATAATATAAGAGGTTTTAAATACTT ACAAATGTAGGATACAAAATACTTTAAAATCTTGGTAATAGTTTAATAAC TAAAGCAGTTATATTGGGAACATTTCCTTATATTTTCCTCAGTGTACTAC TTTTAAGGCTCTTCTTCCCTTTTGGGTTCTCCCACGCACGCGCTTTGGAG CTTATTCTCCGAAGACTAGACGACCGCAACACATTTCCTAGTACTCGTCA CTACGGGGAAGCTTTTTGTTTGTCGCTTTGAGCGGCTGGAGGTCCAAAGG ACACACCGATAGGCGAAGAAAGAGAGGGCGTGTGTAGTGAGTGAGTGAGC AGCTGTAAACAGCAAAACAGCAGGAAGGCCAAGTCGTAATACCACGCCAC ATGCAACCCATAATTCCACACCCCCTTCTCCGGATTCTGAATCAGACTCC TCACCCGAATGCAATTTTGCGACTCTTGTCCCAAATTTGGTTGGCGAACT TTGTCGTTGGCTTTGCCTTCGCCTCGTTTCCATCGAAAGCCGTTAGAATT GGCAAGGAAAAGCGGTGGAAAAACGAAGACGAAGACGTCGTCACCTTCGT TTTGGTCGTGTGCCACACGTCGTATGCGTGTTTCTTTTTAAGGCGGCTAC GTCATCTGTCACCTGCCCACTTTTTCGCTTTTCTCTCGTGCGATTCTCCA AATCTCGTTTCTCGCTTCTTGCTTCCACTCGCTTTTCGCATTTTTCGCGG GTATTTCCCAGAATAAAAGATTCACTGCGACTGTCATGGCATTTCGCATT TGGCCAGGTGTTTTTGGCCCAAAACCTTCATTCATCTATTCTATTCTATT CTTTTTGCATTTATATTGCATTTTATATGAGTATTGGTAGAAAACAAACG AAAGGAAAATGATTCTTTGTCATAATTTTTAAAGGCTTAAACGCTTTGGG AAAATCGAAGCAAAGTCTTTTTAAAATTTCATCATACTTATCGTAACTAA TTCATTTTTAAATATTCCTACACAGATTTCTGATTACTTTCTATATTCAA CAGAGAATGCAAAAATCCTTTAGCTATTGTACAACTTTTTGGGAACTTTC CGTTGCCCTTAACTTCACACAGCAATTTTTAATTATATAAACGCAAAGAA TAGTAGCCCCCTTATTCAAGATTTCATTACTTGCCGATGCAAACACCGAC TTGCCTCAGTTATTTATGCAAAGTCCATTCAACTCGGACAGATAAACATC AAAATTTGAAACAATTTTTGGGAGTTCAGCTCAACCCCTCTAGTAGGCAC AAAAAGTGAACGAAATTGGCTACCTACTCCATAAATTGTGACAATCAAAA ACTCAAGATAATTACGTTGAAAGGGAACCAGTCGCTTGTTACGGGTGTGT GTGCGAGTGGTGTCGTCCTTATAAGGATATTCGCCAGGAGCTGAGGTGCC CTGAAGATACAGAGAGCAGGCGAATATCCACCCTTCTAATCGTGCCGAGG GCAATATTCGCATCATGAAATTTTCTCGGCTTTCGGTTCGTGCAGTTTGA ATATCAAAATAAATCGTAAACAAGGTCATATTGTCTACGAGTGTGTGATA CACGGATACACAGTTTTGCCAAAGGGATTCATTCTCTCGGCTTCCGACTC TCTCTCTCTCTCTCTCTCGCGTGCGCGTTTTTCTCTTTTGGGGAAAAGCC TTCGATTAAACTTCCTCCAACTTTGCAGATGGTAAAATGTGTGCCACAGG AAACAACAGGATGTCAGAGAAATCCTCAAAGAATCCAAACTATATAGACA ACCAGATGGAAATATCTCAATAAACATAAACAAACAAAGAAACAAGTAAC AAAACCGAGGAAAAGGAAAAATCAGCGAGAGAAATAATCACAAACAAACC GAAAGAAAGAAAGCTTTAACTAAAATATTTTTAACTATACAATATACATA CATATATAAATTAATTATAGAAATAGCAACCTAAGTGTTTAGTGCGTAAA CGAATTAAATTTTAAACAAAATAATTGGGAAAATCGAGCAAGTGTACAGA CCAAAAAGTGTGGGCAGCTTCTGATTTTCGGTGATATGGTGTAAATGTGA TAAACAACGTTCTAAAGAAAACAACAAACAAACAACCAAATCGTTTTAAA ACTCAATTACCACAATAACAAAACAAAATACCTTAAACTAGTGTTTTATT TTTCCTCCCTTCGCAAAGTTTTTTGCCACGAAAATCCAATACAATAACTA TTTATCTACAAAAAATACTAAGCCTTGCATCTTATAAACAAACTTAACTA ATTGTAAACTATTCTAAGTCGCACAAAACCAATGCAAATCGAGTGAAAAC AACAGCGTCAGAGATTTTTGGTTCAACCTTTTTTATAAAAAAATATTCTC TCAACCGCACTGCCGCAACTTTTCGACAAATATGATTTTTTCCTGAAAGA ATTAAAACCAAAATATTCGTACAAATATAAACTAAAGAAAGAACTAAGCA AAAATTCTTATGAGCCGCAGACAACAAACAAAGAATTAAAAGACAAAACT AACCAATAACGAAAATTTGTTAACAAATTTTTGGAGCTACATAAAACCCT GTAAACAAAATGCAATAGTTTAACTCACATATTGAGGTAATCATGATGGG ATTTCAAAATTTTTAAAAATATTTTCTTTATGTATTAATATTTGTTTCTT TCAAAACCAATAAGTCAATTAATTGTTTATTTATTTTTTGCGCATCTTTT CCGTTTCAGTACACTTGACATAAACTGTGATTATGAGTTCCACAAAATCT CAAGTAGCCCTAGCTACGAATATTCCAACCAATTTATCCTCCGCCGCTTC TGCCTCAACAGCGGCCGCTGCGGCCGCCGTTGTTGTTGTTGCCAGTGCCA ACGCCGCCGTTGCCTCAAGCGCCAACTCATCGGGAGTGGGTTCAGGATCG GGACCGGGACCGGGATCGGGAGCAGGAGTATCAGGACCAGTAGCCGCAGG CACAGCCACTGCCGTAGCAACAGGATCAACAGTCACAGCAGCAACATCCG TCGCGGCAACAACCTCCACTTCCGTTGCCACAATCTCAACCAGCTGCAGC AGCAGCAGCATCAACAACATCAACAACAACTGCGGCGAGGAGTGCCAGTC GGCGGCCGGATCCTCCAACTTGGGTCGACAGAACAGCTTCGGCAATAGAC GAGTAAGTATTGCCGAAGAAACTCGAGGTTTTGATCTATAGCATCTTAAG GATATATAAAGGGATATAATCTGTATAGATAATAATTAATTTCGAAAAGG ATTCCTTGTGCATTAAAGTTCTTAAGATACATAAACTGTAGCTATCGTAA GCATAACCATTGTTTAAGAATATGCATTACATAGGAAACCATTTAGAATG CCTTATATGCCATGTTAAATAGGTTACTACTATATGGTTCAAAAAGGCGA ATGCAGGGATTATAGAACAGCTCTATATAGGTCAGATCTGGTCAGGTGTC GCGTTGCAGTTGGGTTCTCCTCTTCCCACTCAACATCCTTTCGGCCCTGC TCTCGATTTTCGCAGCTCTCTCTTGCAGTGCCCGTGATATCTCTTCGTGT CTCTCGCAGGATGCACACACATAAGTGCAGCCATGAACTGAACTCTCGAG CTAAGGATACACGCCCAAAAAACGTCTAGTAAACTGGGTCAGGTCAGTGG CTGTCCAAGAGGGGGTGGTGATGGCTTATGACGGGGGCGTGGGGATTATG GTTCTGCGAATAGCATTTGCTGGAAATTCCCCAATCGACCCCGAACGGCT AAAGTGTTGCAATTGGTAATCGTGTTTCTGATTGCTCCTGCAGCAGTTCG TCGCTGGCACACAATCGTAGACATTTCCAAACGCTTTTTGCCAGCAGAGT TCAAGGTTTTTGTGTGAGTTGGTGGGTGGTTGGTCGGTCGCTCGGTCGGT TAGTTGGTTGGTTGGTTTGACGTTCCGTCGGCCGGTTGCCTTGGTTAACT GCTCATGCAGGATTTATCGTCAATCATTGTTTATGTGCTGGGCGATAGAG TGGTTTTCATGGCCCCCCTCATTTCACCCACTCCCCAAATTATGGAGCAC TCACTGGCAAATGCTGCTGCTGCGAGGCTCCAAGGTCGATTTATTGATTT TTCCCACAACGAAAATTAAATGGGTGTACCAGATTCCTGGAAATCGCTTT GAATGCCCGTTTCAAGAACTGGAAAATTAGCTGCGCGCCTGAAGGTTAGG GACCAAAGTTTTTCATTCAAACAATCTGTCAGTTTCCACAAACCTGGCTT GCTTTTAAGTAGTAAGTGTGGAAAAATTGTAAGAAATTTCCGGAACTCTT GTGGTGCGGAAGATGGTTAAAAACCATCTAAGTTAAGGTTAAGTCCCTAG TTCCTTCTTATTGAAACATGAAGTGCTAACATAGCCTGTTGGCCACGTCA AGTGACTTCAACAGCTGATTAATGAGGTCAGTTAGTTTTCGTCCAGCGGA AAATCAATGGGGGAAAACAAATAGCAAGGGAACGTAATTAATGTGCCTGA TGACTAAACTTGAACGATCGGCCGACAGACTGAACGCCTGACTGCGCTTA TGCTTTGGTTTTTATCCTGCCCTTCAACGCGCGAAAAATGTCAAAAGGCA ATCCTGGGCGGACTCCATGAGGTATACATATCGTGTATAATATTAGCCTA GCACGGCAACCAAGCGGAGTATACTTCCCGGTAACCTTTACGGAATTTCC CGTGTGTGGGTCGTTTGTTTTTTTACCTTATGCCTTTTGTAAGTATATTC TAAGTATATTTTATGTACCGTTCAGTACCAAAATGAAGTTAAACGGAATT CAAAACTAGTTTCTGTTTATTCAAAATATTTGACAATCGAAAATCTAAAA ATCAGTTTGGATATTCAACATTTGTTCTCAGAAAATCCAGGGGCATTACA GTTTCCGGGCTTTGAACGTTTGACTGCTTACTCATCTCTGGTCAACTTTG ACATTCGTTCTTTACTAATTCGAAACTAATCACTTCACCTGTCGCCTGCT TTTGCTTTCAGGGCAACATGAAGGGCAAACATCTGACGCGCAGCCATGCC ATGCGTGAGTCCACTTCGCCACCTCGCACGCCAACGCCGCGGGCTGCCTC CGAGCAGCAGCAACAGCAGCTCCAGGGGGAACAACACGAGCATAACAATA ATAACAATATCAACAGCAGCAGCAAAGCACAATCAGCTGGAAGGGGCAAC TCGCCGTTGATGGAGACGCCAGCCGTGATTGTCACTAGTCAGCAACCGCA ACAGCAGCAGCAACAGCAGCAGCAACAGCAGCAGAGTGTGCCACCAAAGC CGCAGCAGAATGTGCCACTCAGCAATGAAGCGGAGTTCCCAAAGCTATCG CCTCCAAAGAAATCCGGCGGTCAGCACAATCGCACCAACAGCAACGGCAG CGGCATGGAGTTTAATAACAATAATAACAGTAGTAACAAGAAATTCGTCG TTGATATGAAGGCCAATGGTTTGGACAACAAGCCACACAACAACTCGTCT ACGGGTGTGATCTTCAACTCCGGGATGAACTACAAGGCGGCGGAGCGGCA TGATCGTCACGAGCGCCACGAGATGTCCAGCCAGAACAGCAATCTGAGCA ACAACCACGACGAGGAGCCGTATCACTATGAGCCCAGAGGTGGAGGAGGC GGCAAGAAGCATCGTGCCAACACCAATGCCAAAGGTAATAAACCACGGTT GAAGAATCTCGGTGGAAGCTCATCTGGCAGCATTGATTTAGGAGGCGGCG GTGGAAACGGAAATTGCAACAACATGTCCAACAATGGCCAATCCAACAAC TCGAGCAACAACACCTCGGGCTTTATATCGCGCGGTAAGTGGCGAATTTT CGTCAATGGCCCATATCCAGGCTCATCACTCACTGATTCTAGTCTTTCAT CAATCAGAGAACTCGAGCGAGCAGTACACGGACTATGGCGGGACCGATCT ACTGGTTTTCTTCCGGGACACCCTCAACAAGAACCCCAAGGATCGCAATA TCCTCTTGAAGATTGAGAAGGACCTAATAGACTTTGTCCAGGAAAATAGG TGAGTCGGTGGAGGATAGGTGATTTAACCTGCTCTAAACGGCAAATAGTA AAATTTAAAAATATCTAATCATTGTTGTCCCTTTTTTCTCTTGCAGTCGT GGCTGTGAGTACCGTTTTCCGCCAGCTTCCTCGTACAATCGTATGCTGAT CCATCGCACTGCCGCATTCTTCGGCATGGAGCACAATGTGGACACGGAGA CGCAGCAGTGTGTGATTGTGGCCGTGGCCAAGAACACTCGCATACCGGAG GTACTTAGTCGCACATGAAGCGCATTCAATATACACTAATTACTTAATCA ATACTTTTTCAGATCCGCTTCCAGTCGCTGGTGCGCGACGATGCACGCAA GTCAATTCTGAAGCGGGACACGCACAGCTTCGATGAGGTGCGTCAGTCAC CGTACTTGTGCCCTCTTTCTCTGGATCGAAAGGCCAAGAGCTTCGAGGAG CGGGAAGAGGACTACGATAGAGCGCGCAGCCGCATCTTCAGTCGAACAGG GGGCAATCATGACGGTTACTCCGGAGGTGGTGGCGACGAGGAATGCTACG GTGGTTGGGAGCAGCAGCAACAACAGCAGAAGCAGTCTCAGCCACCCAGA CCCAAGAGGCCCAATGGAAAGATGTTGCAGATGCAAAATGTATGATTTTC CATAGAGTAGCACAAGACAACAAGTAACTTATATCCTAACTTATAGTCCA CGGAATCTCGCGATGGCATGCGATCCGGTGGAGCCGTGCCCAAGTCGCAC AACTTTGGCAACTACGGAGGTCCGCCCAGCTCAGGAGGTCCTGGCAACAA TTCCTTGCCTCGTGGCGACTCAACAAACTCGATCAAAAGCGGACGCGGCG GCTTCGTCAAGCAGGACTCAACTGGCAGCACTCCATGGCGCCTGTCTCCT TCCAGCAGTGGGTGAGTAGTCCCGAAGTCTGTCTCTTTAAAATCATTAAA AGTTACCGGCTTCACTGAGACAAGAATCAAGCAATTTCTTATTTTGTTTT ACGAGTAGCGAAACTTCTCTTAGTAATTATTACAGTATAATTCGCTTAGC TGCATCGATAGTTAGCTGCATCGGCAAGATATCTGCATTATTTTTCCATT TTTTTGTGTGAATAGAAAATAGAAAATAGAAAAAAAAAAATTAAGTTAGC TGCATTTTTAAGTTACCTGCATCGAGGCATTGTGCAAAGTACTCGAGGCA GCTAAGCGAATTATACTGTATAATAGCTTATTTATGTGTTCCACTTAATT ATTTAAAATTCTCTGAAAATTTCATTTGTAAGCAAAAGAAGTGAAGCCGG TTAGCACAGATACCATGCCCATGTACCCAAACTCAAAGTCGCTCTCGCTC CATTTCTTAAATTATGAATAATTTTAAATTGACAAACTTAAAATACCCAA AAAAAAAAAAAAAACGAAACAAAAATCATTTTTGTATGCAATCCCAACAA CAATAACAACAACAAATGAACCAACCAACATATAAACCAACTCGAACTCC CCACCGTCCAGCTACAAGACGCGCACCCAGTCGGTGCGCTCCGACTCCGT AACTCCATCGCCCACGGGTTACGGCAGCGACAGGCAGACGCCGGAGTTAA ACCATCCATCCATGATGAGCCACAGCCGGGTGGCACCACCCATGTCATCG GGTGGTGGTGGTGTTGTCGGCGGCGGAGGATCAGGAGCAGTCACCGTGTC CTCCGTGGAAATGGGAACAGAAGCCACCGGGGCTGATCCGTCGTCCACTT CCAATTGCTCGTCGGGAACGTCGGGAATTGTCTGGGCCGTTACAGACATT TCGAATGTGCCAATTGGCAGCCTCCTCATTGATCCGCAAACCCTCCAACC AATTGTCAATGCAGACGGGTAATTTACAAAAACTAAACCAAGAAAATTAA ACCACACAAACAACTAAAAAATATAATACAGAAATCGCTGCAAAATTATC GCATTCGTTTACTGCAATTGCTTTTGGTATAACAGTTTATTTAATTTTTC CTCAATTTACACATATTCTAACTAAACAATTAACAAAGCGACAAGTGCGG CTTTAAGACACAGTTACATAGTATACATATATATACTGTTCTTCAATATT TGAAGAACTTTTTTAAAACGTTTTATCTTTCAATTAAATCTAATTATTGT TAAAGAGCAAAATTTAGTAGTGCCATATTCTATTTGATTTTTTATGCAAA CAATAATAATAACTATTTTGAATACAAAGTATCTTAACGTAACATTTATT AAATATACTTAAAAAAATATTTTAATTTGCCAACTCGCCAGAGTTTTGAT AAATAATATATCCGTGTAGTTTAAACAAATATGTGTTCAATAATCAAAAG TTATTTGCTTGAAGCTCATATTTAAATTATCCTTATATAACTTTAGCCTT GTTACTTAATATTATTTATCATAAATATTAATACGTTATTATATGTGAAA TATGCAATATTCTTAGCTTTTCATTTTTCGTAAGGACGACTTATCGATGT TGTTTTTGTAAATTATCTGCCTAAACTCGAACTAAATTACCCGACACCAC AGCGCAACACCAGCTGCTATCGAATACAATTATTCGCCTCACCTGTCTAT ACATCTCTTGATCTGTGCCTTTTCTACCATGCTCATTGACACCATATTTA CACAAAATCGAGTGTTATTCCACTATATAAGCCAAAGTACTCCACCTTTC ATGCTCTAAAATAAAATCACAAAGCTTGCCTCTTCAGCGTTGATTGAAAG TTTAAGATTTTAAGGTATCGAATGAATGAGTTGAATGTAACCGTGTGTTG TCGTCTATCGTCTGCCAGTGTTGTCGTCATATTCTAAGTGTTTGTTCAAT TTGCATATCGCATTGTATCAATTCAATCAATCGAGCCATTTGTTGTTGTT GTTTTTTCAATTACTCTTATATAATACTCCTTGTCTGTCGCTGCCGTCGC GTCGCTAATACACTGCAAATACAAATATAGAAAAACCACAAAACTGTGGA AACTCTATCCAGCAGCCGCTTGTATCGACTGTACTTTCCTTTTATGTAAC TGCGATTAAAATAGTAGGAGTCTACATTTCATTCCTAATCGTGCTAAATA TTATTTTAATCGCAGTCCTCTACTCTTTATTCTTAAATTTCCTATTCGAA CGTTGCATGTTGCCGAGCGAGAAAAAAATACCCAAATAACACACTCAATC CTATCAGTAAAACTATGTTCAAATATACATAAAAAGCTTATAATTACATT CGATTTTTGCAGTTCCATTTACCACTACGACCCGTCCAACCTGCCGCCCA ACCAGGCGCTCCAGCACTCGGGCAATCAATACCAGTCACAGAACCAGGGC AACTCCTCATCCGGCGGCTATAACAACTATCGCAAGTCGTCGCCACATCA ACAGCAACAGTCGCAGCAGCAGCAACAGTCACAGCAGCATCATCAGCAGC AATTGCAGCAGCCACAGCAGCTGCATCAGCAGTCATCACAGCAATATGCC ACCACTGAGCTGTCCTGCAGCTCCACCGAGAGCTATGCGGAGGAGGAGGC GCAGTCCCCAGGAATGGAGTGTTCTGAGGGATACGAGAGCTACGAGCAGC AGTCGTTGCCTGTTCAGCAGCAGCTTTCCGGCAACGGGGATTCGGCCAGC ACCAAGGGAGATGATTGTGATAGCCTGGCCAGTGCTACCGCCTGCCTCAG CATCACCACCTCCACATCCACAAAGAACTACGACCGCATCGAGGTGCAGA AGTACAAGAACCAGGCCACTAGTCCGAACATACCCGCCTGCTGCGCCGTG GGCGAAAAGCTTGAACTGGAGGCTGGCTTGCCGCAGGAGCAGGAACAGGA ACCTATGGCTGGACCCTCCTCTTCCGGTTCCGCCACCTCCTCGGTGGGCA TTACCGAGCTCCCATCCAGCCAGACACCGCTCCCAATGGTGAATCAGGTG AACTGTGACCTCCAATCGGTCTCGCCCAGCACCACGCCCTACAGCCAGTG CGAGGTGAAAACTCCTAGCCAGAACCATGCACCCAGTGCCGCCGTCGAGG AGCCCAAGACCACCACCTGGACGTACACGCAGAGCTACCAGGCGCCAGAC GGCTCTACCGTCTTTCACACTACCACTACGCCCAATGGGGCTGCGCCCTA CTGCGCCACCACATATCAGCAGGGGGTGAGTCTATCTAGGGATACCATAC CATTATATTCTCAATCTGACGTTTTGATTATCCATTTAGCCCGATGGCAG CATCTATGCGGTTCCGCAGGGCATGGTTTATGCCGCCTACCCGCAACCAG GCGTAGGCACTGCCGGTGGTGCCTCTCAGCCGCTCTTCCAACTTACCACC AGCAGTCACCCGCCCGCTCAGACAATTTTTGCATCCCCGGAGGCAGGCGC AGAGATTCCTGGAGGCACCTACATGATACCTGTCTTTGATCCGGCTCAGC AGCCGCGTGAGGGACTCATCCCGGCGCAGGCCATATACCAGACGGGGCCG GGCGGACCGGGAGCCACCACCGTGATGCCAATGGCGACGGCGGCTGCCTA TCCAACGGCCCAGTTCGCCACAGCGGCTCCAAATGGCGCGCCGATATACC AGGCGCCGCTTATCTACTCCAGTGAACCGGGAGGTGGAGCACAGCTGCAA CAGCTTCCCATGGCACCGTATCCGATTCAATACTCTTACCCGTACTACCA TCCCATCTCGTACTATGTGCCCCAGCAGGCAGTGGCCGCCGCACCGATGG TAGCCTCCCAGCCGCAGGTGGGTCAGGCTCCGATGCAACAGCAGGCGCCG CACACGGGAGCTGGAACAACCACAGGTCCACCAACGGTGGTTTCAGGTAA ATATAATCAATCTCATCATAAATCGTACAATTGATAGAATTTCCCCTTTT AGTTTCAGGCCAACAACACCACCAGCCGCATCAGCAGCACCATCAGCAGC AGCAGCACTCGAGCAATGGATCCGTGGTCACATCCAGTGCCTATGGCACT CGGGTTAAGCGCACACCAGGCGGTGGCTCGATCCACTACAACCCAAGCTA CACACCAAGTTCTGTGGCTCATGCCGGTGGTGCCCATCATCCGTCAGCGG GCTCTGCCCAGATAATCGCTGCGCCTGCGGCCAGCACAACCACATATCAT GCGCTGCCTACGCTGACGCTAGCCCACGGTGGTCCAGCGACTGGCACGGA TCTCAGTGGAGCGGGTGGTGCCCATGTTTATGCTCTCCCCGCCCAACACG CGCTGATCCCAACGAATATCTTCCCTTATGCAGCGGCGGCGGCGGCAGCC GCCGGAGGGCCAGGGGGTCCTCCAACGACTCCCCAGGTGGTGCAGCAGGC ACCACCACCACCGCCACAGAGTGCTCCCCATCATGCTCTTATCACAGCGG CTCCGTTTTATCCTGCAAATGGCGGTAACATGGATCAGGGTGCCTCTCAG TCGGCTCCTAGCACTCCAGCGGCTCCTGGAAGACAAGCGCCGTTGTTCAG CACACCACCGGCACCAAACAATGGAAGCAGTGGCAGCAGCAGTGCGGGAG GCGGTGGAAACAGCGGTGGCTATCACAGCAACAGCTCCACGCCGCACTAC TACCAGGGCCAGAACAGCAACGAGGGTTACACCTCGCCTTATGAGAAGAG AAATCATGGAGGTGGAGCCTCAGGAGCACACTCGGTGGGAGTGCGTAAGC CTTACCACCCAGGTGGCTACAACCCAAGACATTCGGTACCACTAGGGGGC ATCCCCTCTGGAGCAAAGACTCCCTTGCTGAACTCCAACAACGAGCCCAC GCCGCGTGCCTCTCCCAGCAGCGTAAGTCTGGGTGGTGCTTCTTCATCCG GTGGGGCCAATTCCTACCCACATCGTGGGCCACCACCACACACGATGGGT GTGAAACGAGATAACAAGCCCAACCAACTGCCGCTGATCAGTGGACCACC GCCTAGTTATGCAGCTAACTCGAGCCCTGGAGTTTCCAGCTACGAGTCCA AGCCACCGGTGCGCCTAAATGCCGGAGCTGCTAGTTTCCGGAGTCAGAAG TCCATGAACCAGGACTACCGACGCAGTGTCTCCCAACGTAACTCGCCCAG CGCCAATGGAGGTGGAAGTGGCAGCCACGAGAGCAGCAACAACTCGCCCA ACAGTATTGTGGGCAGCCAGAGCAACAGTGCTGCCAACACGCCCAACGCA GCAGCCCCACCACCACCGCAGCCACAGCCTACGCTGGTTAGCCACTCTGG AGGATTTGTGGTGCTGGATCAGACCACCGGAGCCGCCATGAATGCCTCGC CGCCGTCGCTCTATGGTGGCGGTGGAGGTCCAAATGCAGGAATAAGTGGA GGAGCAGGCGCTTCGGGAGCGGCAGGCTCGAATGGTGGCCATCAGCCGGG TGGCGGCGGTGGCGCCCGCTCGCACATTCCCACTGCCCAGCTGCATCACA GTGCCGCCGCTGCCGCCGCCGCAGCTGCTGGCAGCCAACAGGCAACGGCG GCGGTGCTGAGCGGCGTGGCCGCTGCTGCCGCCCTCGGCGGCTACAATCC AAATGGGGCGTCCGGTGTCTACTTCAAGTATGGCCAGACGTACTTTGCCC ATGTGAGTGTTCGCTGAAAAACATAAATGGTCACTTTTACTAATAAAGTT ATATTATATTGTAGCCCTCGGTGGCCTTGCCCAACAGTCGACGATCTCCG TCGAACGATATCCGGCCTCAAATGGCGCAAGTGGCCGGCATGTATCCCAC AATGATGATACAAGGTGAGGACATCTCCTAAGAAAACCCCTCTCTGCTCT TATAATGCCAGAAAATTGATTAATAAATTTTGAAATAAAAACAAAGCTAA CGACTTGCATGCATCACTTCCAGCGCGTCATCCGAGTCGCCATCCGAACC CGAACTACAAAGGTTCGCGTCCGCGGTAAAGCCAGCCGGTAAACCGATAT AGGATACCCAAACAAAGCAAAAACTACATACACATAACGGCATACCTAAG ATAAATATAAATAGCATCCTAATCTAGTGGAACATAACGTAGTTGACAAC ATAAAACCAGAGAAAGTGGACCGGACAAACGGATGGAAATGGAAGAGCAG CGC