##gff-version 3 ##date Wed Jul 24 04:20:23 CEST 2024 ## exported from the transgeneomics system molecule_59058811 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59058811 mpicbg region 9631 28553 . + . Name=dmel-5.43-X;type=genome;start=1968827;end=1987749;strand=- molecule_59058811 mpicbg region 28554 28626 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59058811 mpicbg region 28627 29615 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59058811 mpicbg region 29616 51850 . + . Name=dmel-5.43-X;type=genome;start=1946592;end=1968826;strand=- molecule_59058811 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59058811 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59058811 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59058811 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59058811 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59058811 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59058811 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59058811 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59058811 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59058811 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59058811 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59058811 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59058811 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59058811 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59058811 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59058811 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59058811 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59058811 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59058811 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59058811 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59058811 coding_transcript gene 10251 22735 . - . alias=l(1)G0310;alias=unc-76;alias=UNC-76;identifier=FBgn0040395;alias=BcDNA:GH10260;Name=Unc-76;alias=l(1)G0158;alias=CG18851;alias=EG:67A9.1;alias=CG3981;alias=Dunc-76;alias=l(1)G0333;alias=Unc-76;ensembl=FBgn0040395;alias=l(1)G0066;id=51024886;alias=l(1)G0360 molecule_59058811 coding_transcript gene 22964 25009 . + . identifier=FBgn0040394;alias=EG:67A9.2;id=51024855;alias=anon-WO03040301.211;Name=CG16903;ensembl=FBgn0040394 molecule_59058811 coding_transcript gene 24892 26365 . - . alias=anon-WO0140519.169;alias=EG:22E5.9;id=50524302;ensembl=FBgn0025624;identifier=FBgn0025624;Name=CG4025 molecule_59058811 coding_transcript gene 27447 28552 . + . id=51260626;ensembl=FBgn0025629;identifier=FBgn0025629;alias=EG:22E5.4;Name=CG4045 molecule_59058811 coding_transcript gene 28457 31996 . - . alias=RTC1_DROME;identifier=FBgn0025630;id=51104300;Name=CG4061;alias=EG:22E5.3;ensembl=FBgn0025630 molecule_59058811 coding_transcript mrna 28457 31996 . - . parent=51104300;Name=FBtr0070330;id=51104307 molecule_59058811 coding_transcript exon 28457 31275 . - . parent=51104307 molecule_59058811 coding_transcript three_prime_utr 28457 28550 . - . parent=51104307 molecule_59058811 coding_transcript three_prime_utr 28481 28552 . + . parent=51260632 molecule_59058811 coding_transcript cds 28551 30698 . - . parent=51104307 molecule_59058811 CLC misc_recomb 28627 28660 . - . Name=FRT molecule_59058811 CLC cds 28668 28739 . - . Name=BLRP molecule_59058811 CLC cds 28740 28760 . - . Name=TEV molecule_59058811 CLC cds 28761 28784 . - . Name=Precision cut site molecule_59058811 CLC cds 28785 28826 . - . Name=V5 molecule_59058811 CLC cds 28833 29549 . - . Name=SGFP molecule_59058811 CLC cds 29556 29615 . - . Name=2xTY1 molecule_59058811 coding_transcript five_prime_utr 30699 31275 . - . parent=51104307 molecule_59058811 coding_transcript gene 30931 37974 . + . Name=CG4199;ensembl=FBgn0025628;identifier=FBgn0025628;alias=143005_at;alias=EG:22E5.5;id=51260662 molecule_59058811 coding_transcript exon 30931 31032 . + . parent=51260669 molecule_59058811 coding_transcript five_prime_utr 30931 31032 . + . parent=51260669 molecule_59058811 coding_transcript exon 30982 31292 . + . parent=51260693 molecule_59058811 coding_transcript five_prime_utr 30982 31292 . + . parent=51260693 molecule_59058811 coding_transcript intron 31276 31683 . - . parent=51104307 molecule_59058811 coding_transcript exon 31684 31996 . - . parent=51104307 molecule_59058811 coding_transcript five_prime_utr 31684 31996 . - . parent=51104307 molecule_59058811 coding_transcript exon 31714 31859 . + . parent=51260717 molecule_59058811 coding_transcript five_prime_utr 31714 31859 . + . parent=51260717 molecule_59058811 coding_transcript gene 34721 35815 . - . alias=EG:22E5.6;id=50524118;Name=CG4194;identifier=FBgn0025627;ensembl=FBgn0025627 molecule_59058811 coding_transcript gene 38050 39136 . + . identifier=FBgn0029596;alias=BcDNA:AT13882;Name=CG14054;ensembl=FBgn0029596;id=50722894 molecule_59058811 coding_transcript gene 39273 42096 . + . identifier=FBgn0025626;alias=EG:22E5.7;id=51364274;Name=CG4281;ensembl=FBgn0025626 molecule_59058811 coding_transcript gene 42494 49099 . + . ensembl=FBgn0025625;identifier=FBgn0025625;alias=SIK2;Name=SIK2;alias=CG4290;id=50524232;alias=Salt-induced kinase 2;alias=EG:22E5.8;alias=SIK molecule_59058811 coding_transcript gene 48995 51792 . - . ensembl=FBgn0025632;id=51104554;Name=CG4313;alias=EG:22E5.10;identifier=FBgn0025632 ##FASTA >molecule_59058811 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACTTTTAATATTTGTTTTACTC GGCAGAGACCCAAAAAAGTCACATTCCATTGAAAGATTTGCGATTTAGTA ATACATTTTAAATACGTTTGGTTTATAAAGCGCGACCATATTTGATATAC ATTTATATTTGTTGTATATGAAGTCGTAAACATTTATGCGGTTTCGCTTG AGTGTGTATTTTGTCTTTTTTTATAGGTTCTCGATTTTAGGTATATCTTG CATATCGTTTAATAACAAAGGTACCTAAGATTTGCATTAGATGTGATTCA TAGATAGATAGAGGATACTACTCTATCTGAACGATCCATTAACGATGATC AAATGGGCTGGAATCCTTGTTCTTCCCCGTCTAGTTTTGTCGTGTGAGAT GTGAGACATGATATAATGTGGTTCATTTGGACTTGATGCAACTTTATGTG TGTATCTTATACGTGTACTTCCCCCCACTCGTTTATCTTGTTAGTGTGGC TGGTAGCTTAGATGCTAAGGACAAGAATTACGGATCTACTTATGCGCACT GGGTAATCGTATTGAAAAGAAGAGCACTGTGCGCCTGATTGAGTTTTACC TATTATTCGATTTATTTGTAATCATAATAATAATTATCGTTATCATCATC GTTAGCATTATCATTAGCGTTTTATTTATGCTTGTTTGGTAAAAGTAAAT AACACAGCGTTTTCTATGCAAATTAAAATTAAATTTGTGTTTCCTCCATT TACATTAAACAATTGTTTTGAACAAAATAGAACGCGTTTTATGGCCTCGT AAACAATAAAAAAATGAGTAAATTAGGCGTCGTAAACTTAAAGCGATGCG AAAACAATTGCTGCAACTAATTCTGATTTTCCGATTCTGAGTCTGATTCT GATGCCATCTCAAATCATATTTTTGTAAATTGCACTCGGAACACATTTCG AAACGGCGGATTTTCCAGGGACTGCAGGCCACACACCTCTTATAATCAGA TTATATATTACATACAAGATAAGATCCTTATTGTAAAACCTAGTGATTGG CTGTCCGTTCGATCGCAGATAGCTGGGCGAACATAATGCAAGCGTGTATC GATTTAGATCTGCATATTTCACATATAGACGAAAAAATTGAAGCTGCACC GGCAGGCGGACTTGCAACTGGCCCACATGCATTTACCATATATGTATGTA TGTATTTTAAGCTTAGTTGGAGTCGGCTCTTTAACAATACGAATGCTCCT TAAAGAGAAAGAGAGGCGGCGGAGAGAATTGAGTATTATTGCCATGGGAG GACTGGCTGAGTTCGTAGAGCGCGCTCTCGGTAAATTTTTCGGTTTATAT ATATATATATGTGTCTATATATGTATGTGTATTGCATGTATGTTTTGTTG CATATTTTGTTCTGTCGGTCGAATCGGCCGGGAAAAGCACTCCGTTGAGA AGAAGACCCCACTTTGGGTGCCTCATATTCGACAGACGAATCACTAGAGT CCTCTCTTTATGCGGCAAATCTTCTTCTCCGCGGAGAGTACACGGATTGC ATTTAAACAATAATTTAAAGTACGAACTAATCATTAAATTATGTGTGGTG TGTTCGGTGTGTATATGCAAGTTGTATAATTGTATAAACACAGACAGAGA GATGGAGCGACAGCTGGGGTTCCTGCTCCTCGGCGACTACCGCTTGCGGC GCTTATGTAGGGCAGAGCACCTTCAGGATGTAGTCCGTAAGGAGGGCCGG AACCGTCGGGCTGTCCTCGTTGATGGCCTTGAGAACTGCAAGAGATCGGG AGGAGTCGGCATTAGAGTCGGCATCTGGGATGTTTAGCCCGCAATGGGTA CTTACTCTTGATCAGGACCTGCAGAGACTGATTGTTGGGCGTGCCGTTCT CCAGGTGATACGGAATGACTGTGGTCAAGTACTTGGGCTCGGGACCTGCA TGAACAGGGAAAAGCCGTGTTAAGTATAAGCGCGCTGGCTGGATTTTGGT TCGCGAAACTCACCCTGGAACTTGCCGCGCTTCTTCTCCACATGGTACTG CCGCCTTTTGTTCTGAACGGCGAGGAGCAGAGAGATGAACGAGTTCTTCA GCTCCTTCTCGAACTCCAGCTCGTCGCGCAGGGCCAGCTCGTTGATCAAC GTCTCGCTCAGCTCCTGGATCAGCACCTCCATCTCCATGTACAGCTCGTT CAGCTGTGTCGTGGTCAGATATTGCAGTTCTGCAAGAGAATGTGCGGATT ATGTTAATCTGTGTAACTGGCATCCAGGACGTCGTCGCCTGCTTACTTTC CGCATAGAGGGGGGCGCCCAGCACCTCTCGCGCCTTCTCGATCACCTCCG AATCGCAGGTCTCCGGCTCGTCCAGCGGGCTCTCGGCCTCGTCCATGATG TCGTCGATCTCCTTGATCACCTCCTCTACCGTCTTAATCGGCTGGTCGTC CATGTCACCGTTCAAGCCGTTAAGGATGAGGGCGTGCATGTCCAAATCGT TGGCCACCGCCTCGTCCTCACTGGTCAGATCGTTGAACTCATCGCCCGGA GTCTGGGCATCCAGGCCGGATCCGGATCCGGATCCCAAACCGTTGGTGTG TGGATACGCCTGATGGCTCTGGTTGTGCAACTGCTGCTGCTGGTTGCGAT TCTGCTGCTGCTGCTTCGTGTGGTTCTGGCCCAGATTCAGTGTGGGCATG TGCATCTGACGGGTGTACGACTTGGACCAGTCGATGGGCAGAATGTTGCC AAAGTTTCCTGTGATGGTCCACCACATTCTGCAAGTAAAAGGTGTTGTTT TCAGATCAGTAAATCGAAATGAATTCATGTGAGTTGATGGGTAAACATTC TATTCTGGGTAAATATGAAAAATCGCAAATAGCCAAATCAACGCTACAGA TATGGAAAACCTTTTTGCCAAGAAAATACTTTCCATGAATCGCCTTGCAA GCGAAAGAAACGCCATTTATTGGAGTGCCTCGGCAGGCAGGCAGTAATGA GTTTTTTCCTTTCATCATTCGCCCATTCTTTGCATAGCTCTTGGCACCTC CTTGCCACCATTCAGCAACAAATGTTCCATGTACTTGTCGCCACCCACAG AACTCGGCGAGGGAAAGAACTGGCACAATAAACCGCCAAGTGCTGCCCGC GTTTCTGTTCACGGAAGCCTAAGCAACTGACAAATTGCCCCATGCACATC GTTTCCGAAGATAATGAGGCAGCTGCGGCTGCATCTCGGATTGGTGGGGG GCAGTCTCAATGGGGGAAACTGCCACTTCGCACCCGTCAACAAGGAAAGT CCTGACCGACAGTTCATTTCTTAACAATAAAAACTCGCACACAGCTGGAG AAATGAGTTAATGCTCGTAATGTCACAGTGCGTTTGTAGATAGTTCACTG CAATCTCTACCAGTTCCCTTGGCTTTGGCATTGGGCCCACATTTGCTGAC AGAAGAACTCGTTTGCCAGTCAGACGGTTTGTCTGTTTCGAGTGCGCTGG CACAGTTGCTATCAAATTTCACGATCACTGCCAATCATTTAATTGCCCCG ACAAGACGGCCACCGATTTCCACTACCCACCCAGTGGAGGGATTCATTAG CCCATAATTATTCATGCTCTATATTGCCAGGCAATTGACTGCACTTTGCT GATTAGTTCAAGATGATTCACTGCTAGTGGGCGTTTTTGTGGGAGTATAA GTCAAGGGGAATCGGAAGTGACTATATGAGTTCTGAGCGCGAAAGGGAAG CACAGCACTGATGGTCATACAGCTCTGGTACGCACTGTACAAGTAGATGG ATGATTCGCCTAGTGCAGAGGCTGTATCTCGGCTCGGAATGGAATGTGTC GAGGCCGCCATGAAATGTGTGTGCATACATATCTATATGTATATGTACGA GTATGACTGCTGTATGTACGTGTCGGTGGTGTGGGCAACACTTTTGGAGC ACGCAGACGAGGGACGAGGGGGGGGGGGGGGGCGAACAGATTACGAATGA ATATTTAAACTGCCATCAAAGCGAACTAATTACGAAGCACTCACTCCGCC GCTCGACAGACACTTTCGGTGAAGCTGTGCTGGCTAATCGGAGTCGGAAA TGGGACGGAATGGCCGGCTACCAAGTGGAATTATACGCACCAAATTGACA CATCAGTGTCGCTATTCGCGTCGCCAGTCCAGTCGCAGAATCTGGGTCAG ATCGAATGGGTAGTCCGGAACAGAAGGGCTGTGACCTCGATCTACACAAA CACCAGTTTAGTTGGTTGCCAGTTGCTGCACTGTGTGCTCATCTTTTCCG GCCCGCCATCTGCAGAACTCACTTCCCTATCGCAAACAACCAGCTCAAAT TGCAGCCGCGCACTCCCTGGCCATTCTACGCACTGGCATTCCCCGATCTT CCATCATCGCCTCGGGCAATTAGTGCCCAGACTCCATTCGCACCCATCGG CAATTATAATTACGAGCCTCGTTTATCATGCGCTGAGATGGGATCTACCC TGACCACCCATCACCCAACATCACAAGTGCTCCCGATTCGGAAGCTCATC TCTTGGCCAGCCAGCGGTGACCCCGACCCGATACTTCGAGGCGTGCCGCA CTTCGCCGGCTGGCATTGGAATATAAGTTTCACAACAGTCCGTCCGACAA TTAGCTGTAGCTGTTTGGTCTCGCAAATCGGCACACGAAACATGAGATCA TCGTTTAGACAAATATCATATTTAATAACAAGTGGGTTGGGCGAAGTTCC GCGGCACCGAAGACTACAGTACTCTTACACTTCACCAAATTTTTTTTGAG TAGTTTCACATGTCCAATAGTCATGATGCCCCCCGGCTGGGTAGGGTACA AAAAAAAAGCGGATGATGAACATTTATTTATTATGGAAATGGCAATATTT TAATGAATTTTAATTGCGCGTACTTAGATAACCGAATCAACTTGTGTCTC CAGCTGATGAATCAGCGCCGCTCGCCATGACGATGATGATGATCAGCCAA GCTGTCCAAGTGTCCCCCATATCATCCCTCCCCTCTACATTTTCAGCCAA TTGTCTTCATTTCGCCCACGCCGTGGCGAATGCTTTAATGTTTTCCCCTT TCTCTGCGGTTTTTTGTTAATTGTGCTTGGCATTTTTTTTTTTTTGGCGC TGCTTCTTCCTGATTTTCGTATTTCTGTGTTGACTCCCCAGTAAATTGAA ATTTCATAGGAAATGAATTATTTGGTGGGCCGCCTCATCGCCGCAAACAA TGAAGAAATAACTTTCTAACACGGTTCGATGTGTGGTTATAGCATCCGAA GGGTAGCGGGAAAAATGGGTGGCATGGAAGTGCTATAGCTAGAGGAATCT GAAATGATAGCCAACGTTGGGTCACCAAGTTACACATGTATGTATGCATA TGTAGTCAGTGCCACTTGGTATTGTGCTTAGCAAGTTCTGGCTGAATCTT CGATCCGCCAGCATTGTTATAGGTGAAATGGGTGAAATTACGGGTAGTGA AGGCAATAGAGCGGACACTATCAGGTTTCTCAAGCTATTTTAGCATTTCA AATATTTGTTTCGGCGGCTATTGTTGTCTTCATGTTGTTGTGTGTTATGT GTTGTGTTTTGTGTTTTGAGGTTCGTTCACACGTATTTTCACTCAACCGC AACTCGCTGTACAATCGCACTCTTAATTTTCGGCAAGTTGCAGTCGGCAG ATCTCTGAAGGACAGAGACTACTTGATACCCTGCAACATGTTAAGTCACA TGGCAAGTGCCATTCAATCACTCCACTAACTATTTCTTCCAGTGAAAACA GCTGAGTGGGAGGCCGGGCTGGCGCAGCTAATCGACTGGCTTTGGGTTGT TACACAGCTACATAATTTCTCTTTGTTTGTGTGAAAGTTTTCTCTGGCTC CCTTCGCCTTTCTCCTCTCCGTAGGAAGTCACAGGGTGACCCTGTGCTGC TTATTTTCCACCTATGAACACACACACACACACACAGCTGGGGCGAAGAT AATAGCACCCGCTGCCGCGGACCTACATAAACTTTTTGATAACTTCTTTG AATTTGAACTTTCCCCAAGCAGAACGAGGCCTTTGAATATGGCTGGATTT TAATGTCCATTGCATATCACTATCAACTTGGACTTCGCTGTACGTGTTTA CTGCGACAGAAAATTCGTGGATAGAAAAATGCCACCGCAAACTAAAACAC ACACTTGCAGCGAAAAAGAAAAAAAAAACTAAAACAAAAATAAAAACAGC CGCGAGAGGTGGGAAAATCATGTCTTGCACACTTCAAAGCGTTTCTAATT TTAGGCCGTTCACACTTTGCGTTGGCACAGGAGCCGCATAGCCCATTTAG TCGATCCCAATTCATATCGAGCTGTGGGGACCGTGTGCTAATGGACTGCG GGGGCCTTGGATGGATGGGGTGGAGAATTGGGGACACGGCAAATGACATC GGCGACAAGAAAGATGACCTGGGGGAGTTGGTTTTGAATTCATTTCACGT GGTTGGGTGGGCCGCCTTTTGAAAAACATTCCTGGCATTTCGCTCGGGCT GAGAACATTGCACAGAAACATATACGATTACATATACGATCCATAAACAT GCAAGTGATATCTTGAAATGATCCATAAACAGAAGACATTTTATGACGCC TAAACAAAACAAAACAAAACCGAAATGAAATGAAAACAAACAATTTGGAC TTTTAAGCGCGAGTTGCCATTTCGGACTTGGTTGCGTGCTTGGGCAAAAT CAATTTATAATTAATTTGTTTAAATAGGCCATTAGCATTAACAAAACGCG CGAGAGAGAAACTGGGCAATGTTGTCTATGGCTTCGGTCTTGGCATCGGC AATCTTCAGCGTCCGAAACCGCAGAGGAAAATGCTGGCAGTTATGTGGCC CACAAACAGATAACAGCAAAAATGCAAACAAAGAACGAAACCCACATTAT GTCGTATATAGCAAATGTATACTGTGGTATAGGTAGGTACATACATACAC CACCGCAGTATAGGCAGTGAAGATTGCTAAGAAGCAACGATTACGATTGA TGGGCCATCTCGATGGATGATCTCGTTTCGGTGGCGAACTGCCTCTGCCA ACACAGAGTTCTGCCAGAGTCCCCGGACGAAGATAGTCTGAATACGTATT TATGTGAGTAGGTACATTGCCATACACTTTCCCCAGTTCCCCTGTCCGCC AATTCAGTTGGGTTGGCACGAGAAGTTGTGCCGAGAAGTTATTGAAGCCA AGAGCAGACGGTCGCCCCCGCTGGCGACGGGCTTTGTTTGTTTCGGGTTC TTCAAGGACCCTTGTGAGTGGTTCCCTTGGCAGGGCATCCACTGGAGTGT CCTCGGCGCATCCTTGGCCCACCGCCCACTCCCTACACTCAATGCCAGAG TCTGCTGCAGATGCAGATGCAGATTCCGTGGCAGGATTCAGTCAAATTAT ACAACATCCGTGCTCGGCTGGCTTCAACCCCCGGTTATGGCCACTACCCC CATGCCGCGCCACTCCGTTCGCCGGGCTTTGTCCTTGACTGTGCCCCAAA CGTTGTTTTGTTTGCTGATGATGTAATGCGGCCGCAGGCAAAGGCTCCGC CTGTGTGGCTCGGCTTAGTCATCAGATACAGTATCGCTTCGATGGCAGTC AGACATTTCTAATATTCGAATGGCGCCGAAAACAGTGCCCGGAACAGTGG CTCAGGCAAAGTGGCTCCGTGGCAAGTTGAGCGAGGTTAGGTCGGCAATT AGCATTCGGGGGTGTACTGCTGTGCGCCCAGTGGGTGGCTGATGGCCCGT GTCCCCGGGCGACGCCTCCAAACAAATGCCCAAAAGGTTAACGTCCTTTG GCCCCTCGGTTTCAGACTGCAGCCCACCCTTCAAGGGGCAGGGTCCGAAA ACGAAGTGGCACTCGTGCACTCGCCCCGCTATCAGCCCCACCCCATTCCT TGCGCCCCTCCTGAATGCATGCGGATTGATAAGTTCTTAGCACCTTCGCC CCTGCTACCCGCAAAACACGCATACGACATGTTGACATGGCATGACTCAT CCAGTGGATACGGAAACCACCCGAACCACAGCGAATTTCTGTCGCCCGTG CGACACACGGAGAGAAGTGGCTAGTATTAAATTGAAGCACTCTTGGGTCT GCGCAAAAACTATAATACTCCCCGTGCATATTAACTGTGCTGTTGTTCCC ATTCGCCACTTACATCAGAGGGCGGTTACGCTGCCGCTAGGCCGTGTCCT GTCTACCAACCCCAGGCAATCATCCCCTGCCGCAATTTCATCTGATTATT ATTTATAGCGGGGACCTGCTAATTGATTACCATGCAGTTCAGTGGCTGCC CTGTGCCCAGGACCATGAAGGAAGGAAGCCCGATCTGGGCTTAGCCTCGG CCACCCCAAAGACACACTGCACTGGCCAGTCAGTGAACCCAAGAAGTGGA CGCGCCTTACTTGGGCTCGAGTCTCGATTTCGGGTAATGTTTTGAATGGC ACTCGGGTTCCAAGCACATGACATGAGTCGTCGTCACATAAGCGCATTGC GATCGTGGAACTGATTCTACAGTCGAAGAAGGCCGCAAACTGGTTAGCAG GTTGCCCAATCAACTGCCCAATTAAGAGCAATCGACGCTTCGGCCAGATG AGTTTGCTGATGCAAGTGCTGGCATTGCCTGTGGTCAATTAATAGCCGAG TGATTTAATCGATCTGACTGCAGAACGCTAAGATCGCTTAGATCGCGAAA CGCGATCAGACGACCAGCTTGGCCAGGCGAAGCAGCTTCTGGCATTTGCC GCAAATGGATGCGAACGAGTTTCGGTGTCTTAGTACGCAGGCCACGAGCT GATGATGATCCCCGACGACCTGCGAAGGCATCTCTGAACTACTCCCTACA TCTACAGCTTGGGCACACAGAAAGAATGCTGCAAACTGTGCAGCTCTTTG GTGGCAGGATGCAGGCCGTTGAACCCCGCTGCGGAACAGGAATCGATTGG CTCTTGGGGACTGGACGTGGCGCAAAAGTGGGTCGCCAGCAACAAGCCGA TTATGAGCGAAAATCAGCATGGTGTTTTGGGCCGCAGTAGCCGCACCGGA AGAATGCTGGCCATATGGAGCGCATTTTATCGTCGTGCCTGGCATATGGT CATCAGCTCGACTGCCAGTCGTGCCTGCACTACGTACTGCGAATTACGCC TTGGATAAAAGAAATATTAAAAGAATTATTCACTGGACAGCACAACTGTT TCTGTAAGTAGTCACCATCTTGTTATCCTGCAGTCTACGCTCTACTTCTT GCGCCCAAGAACATGTCCAAGAAGAGCCTTTCCGTGCTGACGCAACTTTT CCGCTCGAACTTTTCCGAACTTCGTCCTTGGAGCAGCTGCCACTAATCAG AGCGGAATGCAGTTGAAAACTTGGCCACAAGCGGATAAGGGGGCAAGCTG GGCGGGAGAGGAAGTATAAGTGGGGGGAGGTTGATGGTTCCCAGGACAGG GACTGGAACAATGGAGCGACCTTCGGCCCGGCTAGCCCACTCAGCAGCAC ACTTTCTACGGAATCACCAGTGAATAAGGTAAATATTGACAACTTGCGTG GACGGCGCAGAGCAGCTGCGTTTAATGCGCCAACACACAAGAGCAGATCA TCGGCACCCAGCATCTGGGGTCGAATGCGTGATACCCCACACACATATTG CACTTCTGGGACCACATAACCAATTCGATGCGATTCCGTTATGAATACCG CAGGGCACACATGGATGCCCCAAATAGAGAGCAGTGCATGTCACGTAACT TGACCCGCTCTCTTCTTCTCTCATTTAGACCCGTGAAAGTGTTCGAGAAG TCATCATGCCGCGATACCTATACCCTCTCCCCAGAGAGCGACAGAGAGAG CGAGAGCGGGAGAAGAGGCAGTTCAGTTTATGTGGGGCTAGAGAGAGGGC AGCGGCAGCAGAAAGAGGTGGGGATGAAGAGCGAATGAGGGGGAGGGGAA GTGGTGACAGCGGTGGCAATGAATACTCATAAAATGAAAAACAAAGAACG CAATTAAGGCAAACTGCATCACAGCGAACGACTTTGGCTGGCAGAGTTTC TTTATCTGTACAGGCTTTCAGCCTTCCAGGCTTCCAGGAGACAGAGGTGG GTTCCCAGCATCTACATACGGCTTCAATAGGAATTGTAGATCAGTGACAA GAGCATATATAAACACACACAAGCAAGTGCAAGTAGTATGTGTGATTATT TATTTCGTCAGTGCAAGATATGGAATTTCAATCACTGTATCTAAATTCGT CAAAATATTTTGAACACGCATGCGGCCACACATATTGAAATACAGTGAGT ACTGGCGGTACAAGCAATGATAACAAAATCTCATCCTCATTGAGCTGTCT AACAAGTACATACATATATCTAGCTATAGATTTACACAATCTTTCAAAAT TCAAAACAATAGATCATAGATCATGTGTGCAGGGTGCAGCTTAGCGATTG CCCACTGTGTGTTTATTTATTTGCACAGGATGTGAGTGAGTATTCGCACT CGTAAGCACACACACACACATGGACCGCGGCACTATGGGCAGCTCGATCA TTTTTCTGGCCCAAATTAATAAATCCAGAACGGGGAGAGATATTAAGATG ATTTTCTTTGCATAGGGTTATACTAGCACATATCTTTTATGACTTTATGA CTTTGACTTATGACTTTCTCACAAAAATATTTTAGTAAGACGACTTATAT TTTTCCGGTATTAAAGGGACAACACGATTTTTTTTTGGTAGTTTGGCAGT CACAAACACATAATACAAGCCACACTGAATACAACTAATTTTGCAGAATA AAAAAAAACGCTTTGGTTTAAAAGATATTAAAATATTTATATCGATGGAA AAGCTTGTCGTTGCAGACCTTTTTTTGTGCGTGCAACAGCTGATTTCTTT GTTGTGTCGCCATCTATACTTATTTCTGTTATGCAGAACTAAACATTAGT CAATTATAAATGCATGCATTTAATATTATCTTAATCGAACGACTTTCATA AAATGGGTTTAGGCAAAAAAAAAAGGGGGTACATTTCCCATAGTGCGCTG GTGTGCACGCGATTATCAAATTTATGGCTGATGTCAGCCGAGAGGGAAAG AGAGGGAAACACATCTATACAGTATTATTGTTTTCCCTTCTCGTTGGACT TGCATTCCACGTCGGAGTCGAATCTCTGAAGCCAGCCCCTTCACCACCCT CTACTTTCGTATCCATAGCCATAGTCAAGTCCACCCGAAACCCCTTCCCG CCTCCCTGGCAAATGCTCTGTGAAGTGTTTATCTGGCGAATGGACGTAAT ATGATTTATTGCCCCCACTTTCTATGATTGCCGCTTCCTTGACATAAGTG GATCAGCGTTACAATGGGATAAACCACGGCGGTGGTACCACTGCCAGCGA CATTGGGCGCCCAGTTGCATCCGAGGCAAAGCGCAACAGTCTTCGACAAC CCACATGAAAACATCGAGCAGCGAAAACTCCTGGCACTTTTATCGATCCA ACAAAAAAGCACTAGCCAACCGTCACCAACCACCCATCACCCACCCCTCG GGCGGTTCGGGCAGGATTACGTCGTTATGTGGCGCCTGGGCTGGAACAGA CAGCCAGGGAGCGTAGCGGAGCGGGGTGGGATCAGGGGTCAGGGGTTACG GGGTAGCGGTCCGAGCTCGGAGCATGCGCACTCAACACCCCCAGCGTCGC AATAGACACGAAAGCAGAAAACAGCACTAAAACGCAAAACATTGCAAAAT GCAGTTTACATAACTATAGGATTGGATTGTATCATGCGGCATCCTTACTA CGGCACTTCCATGGACTGTTGGGGTTACATGATGTAGCTCTACCAAAAGC CACCCCCAATGTTCCCAATCTATAAGTGGTTATAGCATGACATCAGACAT TTGGAAAAAAAATAACCCAATGCCTCGTTTCAAATTAAAATTTGCCAACT TTTAATCTGGTAATACGGGAAAGCAGTCTCCCATTACTTATTTACAAAAA TCAAACCCTTAACTTAAAGGAATGTTGGTTTACTTACTGGCATTCGTTCA TGATCTCCTCCTGGCTGCGCACCTGCACCGGAGCCAGCTCCTCGACGTTC TCTTCGTAGTTGCCGAAACACTTGGTTATCTTTTCGTCGAACGTATTGAC CAGATCCTCCAGACTTCCGCCGAAGGTCTCCGTGAAGTTGTCCACATGGT CGCCGACGGCCAGGGAGCGCTTCTCCAGACCGTCCAGACCAACGCCGGCT CCCTCGCCCGGCACCAATCCCACATCGGACAGGCCGATTTCAATAAGCGA CCCACCCTGGAGCGTGTTGCAATTGGGGCTAATGGAGCCAGCTCCTCCTC CCACTACTCCTCCTCCGTTCTTGCTCACGTGCGCATCGCGTACAGCATCC TCTAGGAGCCGCAGCTTGGTGGCATCCGGCTTGCCGCCGGCGGAGGAGTC CTTCAGATTCAGGTTGAGCGTGTCGTTTATGGCATTCTGACTCGAGATGA AGTCGCAGCCGCCCCACTCGTCCGTTTCCTCGAACTTTGCCAATGGAGCC TCGAATTTTAGCTCGGCCATTTTGGTGCCGAGGTCACGCATGGCACGCGC AAAAGATTCTCTCAAGGATTCGGCGGAGTCCCCTTCCGATTCCGATTCAG ACTCCGATTCCGTTTGGTCTTTGGGGGCAGTCGTCGCTTGCGTGCTTCCC TTTTCTTCCCTTAGAAAACAAGTTCCTCTGACTTTTCCGGGCTGGCTGCA AAAACTTTGCAACCCCTAATTCGGCTGTTTGCTTGGGGGGTTGAGCGGGG CTTTCGGCGGGGAAAATGCCCCGGAATACGAAACACGGAACACTCGACTC CGTAAAACTGCGGTTCGGACAATTCCAATTGGATTTATTCCGCTTGCCCA GCGCTCGATTTTCTGGCTGTTTGTTTGATCCACTGATCTGCTCACGAGCA CACTAAACACCAAACAAAAAAGAAATAAATCACACTTGCACTTAGACGCG GCTGATTATAATGTTTTCTTTCTACAATTTGCGTTTCTGCGACCAGCCAG CGAACCGCTTACCTTCACAACTAATTTCGACTGAGAGTGGTGTGACCATA AACGGAAGACCACCAAATACCGTTTTAGGTGATATTTAGTACATTTGTCT GTTACAAAATATGGCAACGCTGGTGTAGTCGATGCACCCACCACCCCTTA TTTAGACACAAACCATATGGGATTTCTAAACGCTTGTGGTATAATTTAGG AAATTATTGACATCAATTCGGTGGCAGGGCCGACGATAACGATTTAGTAT AAAAGCACGCCTGTTATCGGCTAAATTTACAAAAAAAAAGGGAAAATTAA AAAATTAAAACACTTAAATAAACGCTTTCCTGGGTTAACCGCGCACGAAT GGCCACCCGTGGGGCCGGCTCGACTGTGGTCCACACGACGGTGACAGCGC TGACGGTGGAGACGATCACCAATGTCCTGACCACGGTGACTTCGTTCCAT TCGAACAGCGTCAACATTTCGAACAACAACAGCAGCAGTGGAGCGGCCCC GGGGGCGGATGCAGCTGGCGGCGATGCAGGGGGCGTGGCAGCGGCTCAGG CGGACGCCAACAAGCCTATCTATCCTCGGCTCTTTAACCGCATCGTGCTG ACGCTGGAGAACAGCCTCATTCCGGAGGGCAAAATCGATGTGACGCCATC CAGCCAGGATGGACTGGACCATGAGACGGAGAAGGACCTGCGCATACTGG GCTGCGAGCTTATTCAGACAGCCGGAATTTTGCTGCGCTTGCCGCAGGTT GCCATGGCCACCGGCCAGGTGCTGTTCCAGCGCTTCTTCTACTCGAAGAG CTTTGTGCGGCACAACATGGAGACTGTGGCCATGAGCTGCGTGTGCCTGG CGTCCAAGATCGAGGAGGCGCCGCGCCGCATTAGAGACGTGATCAATGTG TTCCATCACATCAAGCAAGTGCGGGCCCAAAAGTAAGTGCTTCTCCTGAC AATCCAAGCATCTAACACCCAATAAACACTTATTGCTTATATTGTTCCGT AGGGAAATCTCGCCCATGGTGCTAGATCCTTACTACACGAACCTCAAGAT GCAGGTGATCAAGGCCGAGCGGCGCGTCCTCAAGGAACTGGGCTTCTGTG TACACGTGAAGCATCCGCACAAGCTGATCGTGATGTATCTGCAGGTGCTT CAGTACGAGAAGCACGAGAAGCTGATGCAGCTCTCCTGGAACTTCATGAA TGACTCGCTGAGGACGGACGTTTTTATGCGCTACACACCAGAGGCGATTG CATGCGCCTGCATCTACCTGAGTGCCCGCAAGCTCAACATACCTCTGCCC AACAGCCCGCCGTGGTTCGGCATTTTTCGGGTGCCCATGGCGGACATTAC GGATATCTGCTACCGTGTGATGGAGCTGTACATGCGTTCCAAGCCGGTGG TGGAGAAACTGGAGGCGGCCGTGGACGAGCTGAAAAAGCGGTACATTGAT GCGCGCAACAAAACGAAGGAGGCAAACACACCGCCGGCTGTAATCACCGT GGATCGGAACAATGGCTCGCACAATGCGTGGGGTGGCTTCATCCAGCGTG CTATCCCACTGCCCTTGCCATCGGAAAAGTCGCCGCAAAAGGATTCGAGG TCACGCTCGCGATCCAGGACGCGCACCCATTCGCGGACACCTCGCTCCCG ATCACCCAGGTCCAGGTCGCCTAGTCGCGAGCGCACTAAGAAGACCCACC GCAGTCGATCCTCCCGCTCGCGCTCCCGTTCGCCGCCGAAGCATAAGAAA AAGTCACGTCACTACTCGAGGTCGCCCACGCGCTCCAATTCGCCGCACAG CAAGCACAGGAAGTCGTATGTACTCTAACGGTTTAGGAACTGGGTGGACT TATTAGCACTTATTCCTTTCAGGAAATCCTCGCGAGAACGCTCTGAATAC TACTCCAAGAAAGATCGGTCTGGAAACCCAGGCAGTAGCAATAATCTAGG TGATGGCGACAAGTATCGCAACTCCGTCTCCAATTCCGGCAAGCACAGTC GGTACTCCTCCTCCTCGTCGCGTCGGAACAGCGGTGGTGGTGGAGACGGA AGAAGCGGAGGAGGAGGTGGTGGCGGCGGTGGAGGCAACGGGAACCACGG CAGCCGAGGGGGGCACAAGCATCGGGATGGCGATCGCTCCAGGGATCGCA AGCGCTAGTGATTGATAGACAAGCGAGACAAACACTCCCTTATATTTAAT TGCTCTTTATTTTACAAATTTACAGATTATTTCTACCGATTTAGTAATGC TAATGTGTATTGAAAAAACGAACGCGGGTAAACAATAAATGTAACTCTTC AATCAAAAAGCATTCTGTCACTTCGAACTACCCGATCCCAGTCTTTGGGA AACACTTTGCACATATCACAGCAATCCGACAGAGAAAGAGCACCGGAAAG AGAGGAAAGGCAGGCGAGAGGCCGCAGTGCACATCAGCCGCTCAGCACAT CGTCCTCGAGGCCCGTGCTCTTGCCACCTTAGATTGTACTTAAAATGTTG AAGGTGAAGGAACCGCTGCCTACTTCAGACGCTGATCTCTACTATCTGAT CTTCTGATCTATGAAGGTAAGCTCTAGATGGTGGTCGAATAGGACATCAG GGCAATCTGGGGATGCGACAGCGACACGTCGCGGAACTCATTCGTGAAGG AGAGGATAAAGAAGCTGAAGACGGTGGCGATGACCCACTCTGAAATAGAG CTGACCACGTGGAAGTACCAGCCGCCGTCCGAGGGATACCTAAAATGACG AGTCGAGAGGTCAATCGTAAGTATCTCCCTGATAGAAAAGACAGTCTGCA GACTCACCACTTTCGAGGATTCTGTCCTTTGAAGAGGATGTGCGACATCA CGCCGGTGACCGCCAGCAGGATGAACAGGATCGTGCAGACAACGGACATG CCCAGCCGCAAGTGAGCGTTAATGCGGGTACCCGACATGGGGAAGATCAG ATACGAGATGAGCGCCTGCATCCAAAAGTACAAGGTGCCGCAGCCGAAGC AGCAGAAGGCTCCGATGAAGTGGACAATCCGCACGTTCGTCTCCTGAAAG TTGCCCACGAAGCTAATGCCCAGGCAGGACACCAGTCCGAACCACAAGGC TAGTCGGTTCTGGCGCAGCACCGACCCGTCCAAATCCGGATGGTGTTCAT AAAGCTGCAGCACCTGACGGTAGCGTACGTAGATGGTAATTCCAACTGCA AAGCATGAGACACTTAGAAAGTATAATCACACCGCTGCAAGAGCGTCTAA TCAACAGATGACTCATCGTCTCTGGAGACGAGACGGGATGCCGGGAGAGG AACTCACGCAGAACGCTGCCTATGTTGATAAGCTGCCCGAACACACAGCT TTCCGGCGAGTAGGTGGCCGCATCGCTGATGTAGGGAACCGTGGGCACCA CATGCCCCTCCAGCACGGCGAAGATGTACCTGGAGACCAATGAGACGTCA GTCGGGTCAGAAAGCCCGGTAATCGGGGAAGCACCCCCTGCGTACTTACG TGCCAAGAAAGGTGACCTGGAATATCAGGAACGTGAGCACCGGCAGCAAG TAAACCTGTGACATCGCGCTAGGGAATGGTGTATCCGGGTGGTGGTAAGT TGCAGCACTGGCCACAACTAACGTATCTTATTTAATTGCGCTGCAATAAC ACGAACAAGGGAGCGAAATGTTTGGGTCTGTGGCAGTGCTGCTCAATCGG CTAAATTATAGCCGCTTAGCCGAAGTTTAGTATTTTTGTTTGGCGGATTT TTGGATTGCTCCATGGCGCAAAAATTTGATTTTACCTTTTTTGGGGTAAC CTTTGAATCTACGACACTAGGCGAACAGAAAAAAGAATAGGGCGTGCATC GATCAGCTGATTACTTCTCAAGCTCAAAGTACTACGAAATTTACAGTTAT TTCAGGCCTGTCGTGATTGGCTCTAGTGTGTATGTGCTTAGTTGCAAATT AACGGTTAACTTCCCCTCTTGATTTTCTATTGGTCGAATATTGACTGGAA ATGCATAGACAGCAGCCATCATGAATTATATCAGATGTTTTGGTTTTAAT CTGTGCTGCCAACTGACAACTGCTATGATTTCTGTTTGCCTGGTGTCGGA AACCAAAAACGATACAAGAAAATAAAGATCTCGTCCGCGGGCTGAAACAA GACTTAGTACAAAATAGCAACTTTCTCTGGGTTCAGACACTAGTCGAACA TAATTTTCAGGAGGTGACCAAGGACCATTTGGTTTCATGGATTTTGTCAC ATTTTACTGTAGCTTTCTCAAAGTTAATTTACGGTTGCCTTCCACATAGC TATTTCCCATTGGTCGAAAAATTACTGGAAAACAAAACAGTTATTTTCAT GTTCTTGCGGAAACCAGCTGGCACCTGCTATGATTTCTGATCCCCTGGTG TCGAAACCAGGGAAACTTTGCATTTTATTGCGTCGAAAATGGTGCATTAC AGTGGTCCAAATACCTCGTTTACCTCGTAATAAAACTTTAATCATTTAAA TTTTTTGCAACAAATCATGATAACCCTTTCACAAAATTGGAAATCAAGTG ATGGAAATTGTTTTTATATGTGATTAGCTTTGCGAAACATTACTTTTTCT AATTGTGTAATTCTTAGCCAATAAATGAATATTTACTTATCAAAATATAA GTATTTTTAAAGTTTTCTGATTTTAAACGAAAATATCGTTTGAATGCCCC CAACGCAAGCGAACGTATGCCTCGGTATATTTTAGTATATTTATGTAGTT TTCAAAAGCGTTCGCAACGTGCTGCTGCTTCTCCTCGTCGGTGCCTGATA TCACTCGCTTCTGCTAATTTCTAGTAATGGTGGCCACCGGTGGACAGGCT CAGGATCAGGGCCAGAACCAGGAGCCGGATGTGCTAAACCCCACGTCGGC GGTGACGGGGTTGCCACAAAAGCGCTACTACCGCCAGCGTGCGCACTCGA ATCCCATTGCGGACCACAGCTTCGACTAGTGAGTAGACCACGAAATGGAC TGCACACACTAAAGGCTCCTTCACATAGTCCTGCTCGCCCGGAAGATGTG GACTGGCGCTCCATGTACCCAGGCATTCAGCAGGGCCAGCAGGTAAGTTT TGCGGACATAGGCTGCGGCTATGGCGGCTTTCTCGTCACCCTGGGGGAGA TGTTCCCCGAGAAGCTGTCCATCGGCATGGAAATCCGCGTCAAGGTGTCG GACTACGTGGTGGACCGGATTGCGGCACTGCGTCGACGATGCGCGGATAC GGGTGCATACCAGAACATTGCCTGCTTACGCACCAACGCCATGAAGTATC TGCCCAACTACTTCGTAAAGGGCCAGCTGGAGAAGATGTTCTTCCTCTAC CCGGACCCACATTTCAAGCGCGCCAAGCACAAGTGGCGTATTATCAACCA GGCTCTACTCTCCGAATATGCCTATATCCTCAGGAAGGGGGTAAGTCCAA CAGTTTCCTGAAAGTACTCGAAATGCGGTCTGCTTACTGCTTAGTCTGCT TACCCAGGGTCTGTTGTACACCATGACGGACGTTGAGGACTTGCACAAGT GGATAGTGACACATATGGAGGAGCATCCGCTGTACGAGCGTCTTACCGAA GAGGAGGCCGTACGTAGTTCAAAACCGAGATCACGCAGCCAAGTCACACA TTAATCATTACGTTTAAACCCACAGAATGCTGATCCCATCACCCCGAAGC TGTACCAAAGCAGCGAGGAGGGCGCTAAGGTGGTTCGAAACAAGGGCGAT CATTTTCTGGCCATTTTCCGGCGCCTTTAGGACACGTATATTCTCTATAT ATGTAGACATTAATTTAAGGTTTCCTTAGAGTAAAGAGATCTATCGATTG TTACTTGTCGTCGTCATCCTTGTAGTCAATGTCATGATCTTTATAGTCTC CATCGTGGTCTTTATAATCTGTCGACGAAGTTCCTATACTTTCTAGAGAA TAGGAACTTCCCGAGGATCCGCTGCCGCCGGCGTTGCTGCGCCACTCCAT CTTCTGGCTATCCAGGATCTGGCGCAGGCTGCTGGCCATGCCCTGGAAGT ACAGGTTCTCGGGGCCCTGGAACAGCACCTCCAGGGTGCTATCCAGGCCC AGCAGGGGGTTGGGGATGGGCTTGCCCTCGAGCTTGTACAGCTCATCCAT GCCCAGGGTGATGCCGGCGGCGGTCACGAACTCCAGCAGCACCATGTGAT CGCGCTTCTCGTTGGGGTCCTTGGACAGCACGCTCTGGGTGCTCAGGTAG TGGTTATCGGGCAGCAGCACTGGGCCGTCGCCGATGGGGGTGTTCTGCTG GTAGTGATCGGCCAGCTGCACGGAGCCATCCTCCACATTGTGGCGGATCT TGAAGTTGGCCTTGATGCCGTTCTTCTGCTTATCGGCGGTGATGTACACG TTGTGGCTGTTGAAGTTGTACTCCAGCTTGTGGCCCAGGATGTTGCCATC CTCCTTGAAATCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTATCGC CCTCGAACTTCACCTCGGCGCGGGTCTTGTAGGTGCCGTCATCCTTGAAG CTGATGGTGCGCTCCTGCACGTAGCCCTCGGGCATGGCGCTCTTGAAGAA ATCGTGCTGCTTCATGTGATCGGGGTAGCGGCTGAAGCACTGCACGCCGT AGGTCAGGGTGGTCACCAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTG GTGCAGATGAACTTCAGGGTCAGCTTGCCGTTGGTGGCGTCGCCCTCGCC CTCGCCGCGCACGCTGAACTTGTGGCCGTTCACGTCGCCATCCAGCTCCA CCAGGATGGGCACCACGCCGGTGAACAGCTCCTCGCCCTTGGACACCATG AATTCATCAAGTGGATCTTGGTTTGTGTGAACCTCGTCCAGCGGGTCCTG ATTGGTATGCACTTCAATCAACTTGTTCACATGTCCCAAGCCCTTGCAGC TGACTAGCATCTGGCCGCCGGGCTCCATCGCCACATCGAACTTGACCCCT GTCATTTGCTCGGCTACATTGATGGCGGTGCGCGTGTGATTGGTCAGCTT GCCTGTGCGCATCGTTGAGCGGCCCACGGCCAGGGCCATGTAGATGATGA GCTGGTCCTGCATGTAATCATCAACGCAGACCTGTTTGCGCATGTAGTCG CCCAGTTGGCACGACGCCTCTGAGCCGAGAACGTGTCCGTCGATCCTCTT TTTGCCCAATGCAGAAGCACCTAGGACAACGTCGGAGGTCGTGTTGACAG TCATCAGGATGCCGGCTCCGTTGTGGAATGCCTTCTGGCGTGAATGCTTA ATCGGCTCGATGCTGCACTGCTGGGACGGCCACAAACGATGTATCTCGCG TTGAGCCGTCTGTTGCATGTCAATAGCAATATTTACCGGCAAGCGGCCGG CGCAGTAGGCCACTCCGCTGACCGATTTGATGCGGCCGAAAGCCACTAAT TTTCCGGAATTCAGCTTGGTCACGGGTTGCACGTCCAACTGGCATCTGCC TTGGCCGCGTGGATAGAAGCCGTACCGCTGCACCTTCAGGTCGAAACTAA CCCCGAAGTGTTTTAGGTTGGGCAGCAGCACCTCCTGCATGTATTCCACC GGAGGCGCAAAGTCGACGTTCGTGCCCCCGGATACGATCAGGCGGGACGG GCGTCCGGCAAAGAGAAGTACTGGGAGCGCCATCTGATAAATCAGAGTAA TGCTGGCCGCCGTGTGCGTTTCCACGCGATACGTGTTGTCCAAAATGGTG CGCGGCGTGAACTCCACTGTGGAGGAGAGCAAGTAGTTTCCCACCACGTC CGCATTGGTTATGTCCCGCAGGAGGTTCAGCCCATGCAGGTGCTGGTGCG AGAGCCCAGGACTCGGGCGGCTGGCCCGGATCTTTACCACGCGCACCGGT TTACCCAAAATGCAGCTGAGGCTGAGGGCGTTGCGCAGGGCCTGCCCGCC GCCCTCCAAGTAGGAGCCGTCGATCTCCAACATTTTTTCCGCGTCCATTT TCCCAATTTATTTATGTTCAGGGATTTTCAGTCTGGTTTCCTCTCAGGTT GTCAGCCAAGTGTGTGTCAGAACAATCGGAGCAATCAAATATCACAATGA CAGGGGCTAAGAATAACAGCTCCATTTCACTCGATTGGGACGGCACACTG TGATCCGGGCAGTGTGCCCGACGCTCGCGTTTGCTTGGAAACAAACACCT GCCACTGTGGAACCACTCAAGGCGCGCACCATTCGAACTGGTCCGGCAGC ACTGGCCAGACGTAAACAAGCGAACTTTTACAAAATAATACATTACCAGC GCAATAGTTAAAAGTTAACTAGAGATGGCTGTGTAAGTGTGCAGTGTCCG CCGGCGCATGGTCGTACGTGCCGCCTTCAGGCGATTAACTTATCTGCAAC GTGCCATCGCGAAGGCAATTATGTATCTTGTTCTAGTCCAGCTTAGCAGT GGTTTAACTGGCCCGAGGCATCGAAGGCGAATCACTTGGCAATTGGGCAA TCGCTAGCTTGGTCCTCCTTCTCCACTGGAATGCTTGACTGGCCTTTTTG CCTGTCCGTGTCCAAAGTAGGAGGGCTGCAAATAAGAAAAAAGTAACTAA TAACTAATACATTTAATTGAAACCACTTTCCGTTGGAAAATGCTCTTCGA GTTTTTAAGGCTCAACTGTATTTTGAGAGTCCCATTCCCTGGGTCTGATA AAAATAAGCCTATCCGCATAACTGGACTGTGTCAACATTCGCTCAAGCAG ACATTGACGGAATGGGCTTAGGACATAATACACCTGACATGGCTTCCATG CGTATAGAATGATATTGAATGTGTACGCTCTTAAGAGCATTATTTTCGAA CTCCTTAACCAAAGACAAGAATACAATGTGTCCAAAGATACAATGTTTAC CTCGAGATAGCGAGATATCAACAATTTGTTCGGTACTATCCGTATCAACA GGTCTAAGGAACAGCCATTTCCCAATTACTTACGAAGGCAGTGACGGAAA ATTTGGTTTACTTATCGTTCTGGTTATTCCACTCGAAGAGTCATGGCAAC CGCAATAAAACGCTGGTATTTCGTGTTCTTGTTCTAGTTCCGCTGGCGGT GATGCAATTCTGCCGGCACTGACTGTGGCACGATGGGCTTAGCTCAGCTC AGCCAACAGGTACATATGTTGGTCGCCAAGTGCATTGGTCCGAATCGCGA AGAAGGCCAGCTATGTGTTACCCTCTACGACTTCTTGGTGCTGGCCACAG GCTGGTGGAGGAGATTGCTTCGAAGTGAAGTGCGGCGACGGCAAGGTCGC GAAGTTTTTGTTAGTGGAACACACGAGAATGGTCGGAAAGGCTGACAACT GCGGTCAGCGTTATAGTTTCCAGCGCTCTGCATTGGGTACCTCATAGGTA GTTTATCCTGCCAAGAAATTTTCTTGTTTCGTCTAGGTAGTCTTGGCGCT TGTTTCATCTATAATCGCATTATACACATGAGAGATGCATTGAACAGGGA GCGTTGCGATTACACAGTAGGGCTGGCTCCTAGTATCTTGACCGTTCCTG TGTCCACGGACACACACAGAGCCCAGAAGTGCGTGTGTGTTGGGGAGGCA CGAAGCTTCCAGTTCCAGTCGAATCCAGCGACGAAGTTGCGCGCCATACG CGGTCCGCAGTTCACGCGCGCCAGACGTGCCTCGCATTGCATTGGCTCTT GCTCTCCCGGCTCTCTCGCAGCGTTCCTGGTCCACTCGACTCCACTTCGC TTATCTCGGCACAGACGCGGACCCCCGACCTGTTGCACGCTCCCAGGCTC TCATCCTCCCTTCCACGCGATATTCCAGTTGTTTTGTTTTTGTTTTGTTT AGTGTTGTTGTGGAGAGTGGTGAGTGATGATTGGCGACTAAAAGCAATTC GCAAATAAACAACGACGTGTGTTGTGTGTGCTGCAAAAAACAGCATCTCG GACACGTTTGGGGGAGTTCAGCACATCCATCTGCGGCTGATGACTCAGGC TGTGGAGGAATAATTAAATAGAAATGATTAACACGCGGGAACTAACTAAC TGATAACGAGCTTTGGCACAGTGATTGATTGTTATTAAGTGAAAAGTAAA GCTCCTAAACTGGCCACTCAACTTTCAGGTGGCAGTCCCCTCGCACAGCT CTGAGCTTGGTCAAAACGAAACGAGCCTTTGAAGGCCTTCTGAGGATACG CAAGCTCCCGTCCAGCCAATCCTGGAGGATACTCAACGCCCCGTCTTTTG CGAGCCACATCAACAACCGCCTGTTAAACACAATGGGTTCCGTCAACTGC AAGGAGTACAAGACCACGGGCAGCACTCCCAAAAAGGAGAAGTCGACAGG TAAATGCACGATTTACAGATGAATAGTTTTCGAAAGGTCAATTGCCAAAC AACAAGGCAAGGTCGCATTTCCAATTTGACTGCGCCACTTCTAATCTCGC AAATGGTTTCTTCCCAATAAAATAAGATCATCTTGCCCAAAAAAAAAGTT CCAAATGTACTTAAACCAATCCCTTCGTTTTCCGACTTCAATTCGAAAAG TGCGTGGTAATGTCGTAGATGATCCGATTGCCACCAGTGCCGTGTTCCTT TTACCAACTAAACGAGGCCAAATGGCTTGGAGTTGTGATTAGGAGAGTGG GAATGACCCGCATTAGATGGGTGTTTTCGGGCCGGGCGTAGGTGCCTAGA TGATTGTCTCAGCGGCACAAGTCCAAGAGATTGGCAAAGAGATAGGGACG GCGGGAGGGCGCAACTTGCTTGAACTGCTGCTGCGTCATTGCCACAGTAG CTATCGATGCGGGAATACTTAATCCCGGGTACTAATTCCCCTAAAGCGAC AGTTTCCCTGTGGATATCCAATAGCATGGCCATCTTTACCACCTTGAATG GAGTTACAGGAGCTCCTATGTATGGTTGCGACGCTCTGAAGTTTCCTGTT CTGAGTCTTACAGGGTATCTTTGCGTGTCTCTGTTAGGCAATGGCCACTG TACCACTGCGGTTAGTCACCGCCATCGGAATTTCGTCTGTGTTGTGTGCC TGCCTATTGTCTATTGCCATGTCTTGCATTCGTTCTCTTGGGCTCTCCAA TGAGGCCCCAGTTCGCTTAAATTGGCTGCTCCAACGGCGGTCTCCAGTTC ATTCGTTCGCCAACTGCCGGCAAGCTCTTAATATCAGACGGAACGTTCTC TTAGCTGCGGCCTGTCCGTCCTTTTCTGTGATACCCGATTTTGTGAGTTA TATATTTCGGTGAAACTTGTTCTCGTGCAATTGTTATTATTATTATTATT TGGCCTGGCTTTTGACTCACTTGAGTTGGACAAGGCCAACCGGTTTGGTT TGCTCCCATGTATACGCGTCCGTGTGTGTGTGGAAAACGCAGCTGTGTTA TTAACATGGCGAATCATTGCTAATTAGATGAGAGAACTGAAAGAGATTGG CAAATGTACAGTGCAGGGTCGAAGTTAACCGACTCGATGGAAAAGTTGTC CCTACATCTGTTTCGCTGGGTAATTCATGACTTGCTGTTTTTCATGTTTG CTGCTTCGATGGAAATGTTTGATTTCCGATCAGCACGCCTCCGTCCGCAA AAAGCCGAATCATCAGCTCCTCTATCATGGGCATATCGGCGATACATATA CCAGCGATACCATATTACCATACATCATAAAGCCAGTCACTTGAGATAGG GGCGTGTAGACATTATCGCCATATCAGAACAGAACCGACACACGTTTACA GGTGTTACGGTTACGCTTTATACAATAGGTGTTTTCCTCACCGCCTGGCT TTTCTTGATGACGTAGCAACTTGAGGTTCTTAGGTATGCCTAGTTGACGT GACATTGCAGTAGGTCGGATGAGTCAATCGATTCGGACTTGTCGCTAGGA TCCGCTTTGTTGTGGTCAGGTAACCATCGATGGCAATTAGGCAGCTGCTA CCCTATCCTCGGTGTTGCTTAAAATAAGTGCCCTGACACACACAATTTTA CAATTACATATCATGGTTTTAAAGATAGTTAGTATTTATTGCTTTAGACT TTTCATTAAGGTGACTGTTCAATCTAATTTTAGTTCAATTGTTTTCGGAA ATGGTCACAAATCATTATGAAACGAACTTTACTTATTTGGTATAGTATAA TTTCTCTGAATTTTTGACAGTGACTCAACGAATCTGGTTATGAATGATGA TCTCTGGCAATTTAAGTAAATAAATATTGATCCTCTGTTTAATCTCAAAG CTCAACTTTTGGATAGATGGATTTAAGTGTTTGATTTACTTAGATTTTCC ACATATTTTAGTTTTTGTTCGAGCCCTTCTTGACGGCCAAGAGCTCCAGT CGCGTAATAGCATCGTCCAGAAACCTGCGCTGCTCCTGCAGCTGCGGTAG GAGCTCCTCAGCACTAAGTGGGTGAGTGGGCTTAGGTGTTGCCAAGCCCG TTGCAGCTGATTTTGCGGATTCAGTCCAACGACTCCGCAGACCTGATACT CCTATGGATGGCCTAAGCATGTCCAGCACTCTTTTAATGATAGAGGGACT GGAATCCTGCTGCGGATCCGGGGAATGATCCTGCTGGTGGTGGTTATGTT GCTGGTCGCTGGCCACACTGCCCTGTGGAAACTCTGGCATGGTCAGCAAG GGTCCCCACAAAAAGGAACCTAATCCGGGGCCAGCCGGCGATGCGCCTTC CGACGAGTGTCCTTCCAGTTGCTTCCCTTGGGAGGCAAAGCGTCCGTCGA GCAGCTCAAGTTGTCGTTTCAAATCATCCAATTTATGCTGCAGGTGTTCA AAGTCAGCCGTTAGATTGATGGCCAGCCTCTGCGTGGTCTCGCCCTTGGA GATTTCCTCGAGCTTTTCTATCTGAACGCCTATTTGATGATCTCTTAGCT GTAGATCTTCCAGCAGAAGTTGAGTTTCCGCTCGAAGCGGCTGCTCTAAA AAAAGACGTGCGATCTCCGCCTGCAATAGCTGTTTGTGGGTGCGCAGCGC ACTTAGCTCCAGTTCCTGAGGATTCCCAAGATTCGAACGGACCAGAACTG ATCCCAGGATCATAAGCAAACACACAAAGACTTCTGAACGCGAGCGAAGC ATTTTCTCGACTGATATTCGTTTTTTGTTGTTTCTACCTGAGCAGCAAGC GGTGCCAGAATTTCCCTTGGACCCTTGGAGAAAAACTGGAAAATTTTGAT GTGTCCATTCACCTACACACTCTTCTTATCTGTATTGTTATCTCCGTTTC TCTTTGCTTGTCTCTTTACATGATGGCTTCGGCAGGTGGTGCCGTGGGTT CCTACCAGTCCAAGTGCAGCAACCAGAGTCCCAGTACAACCATGTCGACG GAAGAGTCTTCGCCGGATTCGGAGTACACAAGTGCGGTCCCCGTGGACTG CAGAGTTACGGATCTGAAGGAGAACGAAATGAAGCAGGTGGACTTCGATG AGGACACCCGCGTGCTGCTCGTGAAGCAGAACGATCGTCTGCTAGCAGTG GGTGCTAAGTGCACCCATTACGGAGCTCCGCTCCAGACTGGAGCTTTGGG TTTGGGTCGTGTCCGCTGTCCTTGGCACGGCGCTTGCTTTAACCTGGAAA ACGGAGACATTGAGGACTTTCCTGGTCTCGATTCCCTGCCATGTTATCGC GTGGAAGTGGGTAACGAGGGACAGGTGATGCTCCGTGCAAAGCGATCGGA TCTGGTGAATAACAAGCGACTCAAGAACATGGTCCGACGCAAGCCCGACG ATCAGCGAGTGTTCATCGTGGTTGGCGGTGGTCCTTCTGGCGCTGTAGCC GTGGAAACCATCCGACAGGAGGGCTTTACTGGGCGCCTAATCTTTGTGTG CCGCGAAGACTATCTGCCCTACGATCGCGTTAAGATCTCCAAGGCTATGA ACCTTGAGATCGAGCAGCTGCGGTTCCGCGACGAGGAGTTCTACAAAGAG TACGATATCGAACTGTGGCAAGGAGTCGCCGCCGAGAAGTTGGATACCGC TCAGAAAGAGCTGCACTGCAGCAATGGCTACGTGGTGAAGTACGATAAAA TCTACCTGGCCACAGGCTGCTCCGCCTTCCGGCCGCCTATTCCCGGTGTT AACTTGGAGAACGTCCGCACTGTCCGAGAGTTGGCGGATACAAAGGCGAT ATTGGCATCGATCACCCCGGAGTCCCGCGTCGTCTGTCTGGGATCGAGCT TTATCGCCTTGGAGGCAGCTGCTGGGTTGGTCTCCAAAGTGCAAAGCGTC ACGGTTGTGGGTCGTGAAAACGTCCCACTTAAGGCCGCATTCGGCGCGGA GATTGGTCAGAGGGTGCTCCAGCTGTTCGAGGACAACAAGGTGGTCATGC GCATGGAGAGCGGCATCGCCGAGATCGTTGGCAACGAAGACGGCAAGGTA TCAGAGGTGGTGCTGGTAGATGACACGCGTCTGCCTTGCGATCTGCTGAT CTTGGGCACTGGCTCCAAGCTCAACACCCAATTTCTGGCCAAGTCGGGCG TGAAGGTAAATCGTAACGGATCCGTGGACGTCACTGATTTCCTGGAGTCC AATGTACCCGATGTGTATGTGGGCGGTGATATAGCAAACGCCCACATTCA CGGGCTGGCCCACGATCGCGTGAACATCGGGCATTACCAGCTGGCTCAAT ACCATGGACGAGTGGCGGCCATCAACATGTGCGGCGGGGTAAAGAAGCTG GAGGCCGTGCCCTTCTTTTTCACCCTCATCTTCGGCAAGGGAATTCGGTA TGCCGGGCATGGCTCTTACAAGGATGTGATCATTGACGGCAGCATGGAGG ACTTTAAGTTTGTGGCCTACTTCATCAACGAGGCGGATACGGTGACAGCG GTGGCTTCGTGCGGCCGGGATCCGATTGTGGCCCAGTTTGCCGAGCTAAT CTCGCAGGGCAAGTGCCTCGGTCGTGGCCAGATCGAAGACCCGGCCACCC GTGAGGACTGGACAAAGAAGCTTGGCCAGCCGTTGCCCCAAGTTCGCTAA ATAATCAACTTAATGTGTATTACCGCTGAGATTTGTTGTTATATTTTCAT GCAATCGTTGAGTATTTATTATGGGTACTCGTATGCAAAACTCTATAAAC GTGTAACTATATCTGTGTATATTTATAATTGTAGTTGTGGGGACTTCCTT GAGTTCCCGCCGCGGTTGCCACTTTTGGCCCAAGAGATCAAAGATGTAAG CGTTTCATTCCCTTGCCACACAATGGCGTATTGGTTTACTTTTGCTAAAT AAAGAATTTTAACGTTTCGTATTTAAAACAATAGTTTTGGCTTTTTTCCT ATTGATGAATTTCAAACAAGGTCGTTAGCTCCTCGCTTCACCCGTTAACT TACAAACGGTTTTATCCGTGAGTATTTCCGTACTTTCCACACTTGCTTAT TTTTACACAGTCTAACTAATTGTTCGCGTTCAAACCGAAATTCCAAATTA GGAACGTAACTCTAGAATCGATGGCCTCACCTAGTCGGAGTTCCCAGCGA TCCCTGCTTAACGCAGGCCTCCAATTGTTTACCACAAAGCTGGGTAGGAC CCAGCACACGGTATGGCTTTTGAAAATGGTCATGTGGGGTGTACTAACTT ACCACTTTGTCGGCGAATAGCTTCCGCTGAGTGATTTATCCTCGCTGCAT GGTGTCGACCTACATCATCAGAATACTGTACCGACTGGGATGTCCCAGCA GCTGGCGGATGTCCAGAAGCGCACCCAATTTCTTGAGGAGCGGAACCGCC AGCTCAGGAATCTGGTTTGTAAAGATTCGTCCGACCACTGTTTGTAGTAA AAGCAGTTCCTCCTCAGGCGCTGGATAAATCTGACCTCTTCGAGTCACGA ACTGCCATGCTGTGCTCCCGAGCTTTCGACATCAGTCAGGAACTGTTCGT AACCAGGATGAGGATTAACGACGTGGAGAACGCCTGCACTGAACTTCGAA GGTATTGTACTGACCGCAGTCGTCTAGTTGGGCTATCTAGTCTGTTCTTC CACAGTCGCATCCTGGACGTAAAGCTGCGACGCATCCAGCGTCTCCGGCT CCTCTGCCACGAGATACAGAAACTGCAAGAAGCACTGGAACACCAGCTGC CCCCGATCCTGATGCACGTCTGGCACAGACTTTGTTTCCTATGGAACTGT GTGGACTGCCTGGCGCTTGTGTCCTGCGGGGCCCGTCCCGTCTTCGAGGC AGAGAGCAAAATGGATAAAATGGATGCCCTCAATCTCTTCGTGGCGGGCT TCTGACATGTTCCGCCTTGTCCTGGCCCTTTAGTATTTTAAACACTGGTT ATCGAGCACCGCCGAGTTATCGACAGTAATCGGCTAATCGAGTCGGGAAA AAGTTACTTTAAACCATTGTAAATCACTATAGAATACCGACACTGAAATG TAGAATGTAGTCATAAAACTTTTTTATTACGTGTTTAACCATTCTGCGAC TAGTTTTTTTTTGTGCATAATATCGTAAAGCTTTAGCGATTATTTTCGAA ACAACATATCGCCATATCTACTGTTGCGATAACTTTCGAAGTTACCTATC GAACTGTTTGAACAACCGATGGTTTTCGAAGACACTATCGCAAATCGCAT ACCGAAGTGATTTCTGGTGCATTTTTGTTTCTTGTTTGTGCACGTGCAGA ACGCAAATAAATGCGCCGAGCCTGAGTCAATGCGAGCGGACAGGAGGACA GCGGATAGCGGGCGGCCATGGATCAATTCTCGCACGATCTGACGTTGGCT CTGGACCTGACGCTGATGGACAGGGCTAGTGGCGGCGTCGGTAGGTGGGG CTCCCGCCGCAGGACACGTTCCACGGGCAATCTGCGTAAGTAGCCATCGC ACGCCGACTCCTGCTCGCGGTAACCCCCCTCTGCTTAGCCTGCGCCCCTC AGCCCACGGAGGACTCCTCGAGCAGTCCCACGGATGCGCTAAACCAGGGG CACCATCACGGGCATCATGGCCACCACCACCATCACCACCACACAAGTGC CAACGTGGACGGACTGGACACACACAACCTTAAGTTGCCAGCCAGCGACT CTGACGAAAAGGCGGAGGCGATGCTGCCTCTGCGTCTGCCACTGACCTTG CCTATACGCATGGGTGCCCTGGAGTCCGACTCGCTTAACGAGACCACCTT CAGTCCAGCCAGGTAAAATGGTTAATGCTCCTCATGGTGGTCCCCAACCT TATCGTTGACACACCCACAGATTCTACAAGCCCAACTCGCGAAGGAAACG CAAGATCAAACGGATGTCCATGGAGTTCGAGTTCAGCAAGGATACATCAC ACACCTTCACCGAATCGCCACTGCAGCCCAGCCTGCTAAGTAGCAGCGGT TCTGCTACTGGAACCATACGCAAGCGATTGTTGAAAATTGACGCCACTGG ACATCGCTCGCATTTGTTCTTCTGCGGCAAACGCAAGCGCTCAAACCGTG ATCGCTACCATGAGCAGGATTCGGTTAAGCTGTACGCCTTGCCACACTCA CAAGTAGATGACCAGCACGTAGAGCAACCACAGCACCAGCAGCAGAGGAT GCGCCCCCGCAGCTACTCCTCCACATCGAAGCCACTCAGTGACCGCCTGC TTCCACTGAACAAGGGACTGCTGTCGAAGATCAACCGAATGGCTGCCCAG GGACAGCAGACTAAGCACACCCAAAAGACTGAGACAAAGGACAAGGACTT GAAATGTCATCGTTCTGAAGGACCCGAAGGAGTGAGCCTGGAGATGGAGG AGCTGCCCGATCAAAAGGACGCGGTCCAGAAGCTACCTTTGCCAAGTGCT GATTTTACGACCGCCAATTTTAACTCCATCAGCATGGACACCATTGTGCC TGTGACCGATATTGATGCCTTGTTATTGAGTACGCCACCAGCTGCTCCGC TGCTGCGCAAAAAGGCGCAGGGGCAGGCGCCGGGACACAGCAGCAGTAGC TCATCCAAAACGGAACGTCGCCGCCGCTTCCAAACGTTTCCACAGCCTCA GCTGCAGCTCCAAGCTCAGTCAATGGATTGTAGCGAACTTTATGACTTCT TAAGCTCTAGTTCCCTGAGCTCGTCCACCGATAGCGAGGCGGAAGTAGGT GGTCATCGACGGCACGACACCGATCGCGAGGGCGACGATGAACTCACCGA CTGGCCGGGAAACGAATTCGGACCCGGAGCCAGATACGATCCAAAAAGGA AGCTTACAAAAAAATCACTACTGCCTCAAATTCGCTCGGATGACACAATT GGAGAAGATGACACTCTTATGTCTGGCACCGAAGCGGGAGCGGTGGGTAT GGAACCGCCTTCGAAGTCTCCAGTCCAACTTCCAGAATCTCTTCAGGATC TTTCCCGCTTCCAACCAGCCGGCGTCTCCGAGCCTATCGAGATTCAGAAT GCCTGCTCAGAGATGGAAACAAATGCAGATGGCACCATGCCGGCTTCCCG CCAAATCGAGAGTGAGATGTCCGGCGAAACCTCTAATCCGTTTCTTTCCT CGTCGCCTCCTGGACACGCCCAGGGACAGGAAGTACGTGAGATACGAGCA GGGTGTCGCCGCATCAATGGCGAGCGTCCAGGATTCAGCATCAAGATGAG CGTCAATGAGCGCATCGCCCGATTTTTGCAGGATTCGCAACAGACACAGA TCCGTTTGCCGGATATAGAGCTTTATGAGACCGATAGCATGAGTAATCTG GCCACGCTCTATTCACTTACCATGGTGGTAGAGCACGGATGTACAGTGCT CACCAAAACCGGGTAAGGATAAAGGGATACTTATTCAAAGTCTATAACTA AGTTGTTGCTCTTCCAGGAACACTACGCAGACGGTGAGCATGGATCATCT TCAACAAGGTCTGCAGCCGCGTGCAGATCTCTTTGGCGATTTTAAGCGGC GCTGCTACGGTGAGGAGGGAGAGGAGGAAGGAGAGCAGCAGCAGCCGCTT CAGCAAGATCCCGGCCAGATTTAGCCCCAGAAAGCAACACTATAATCCAA ACAAGACCAATCCCTAGCAAATGCAAACGTACAGCCATCAGCACTCGAGG TGAAACTCTTGGCATACGCTTGCATTTCTAGGGTGGAAGAAACCCTTAAT CTATGAATGCTTTTAGCTTGTTTTTGTGAAATCTGTTCCATGTACATAAG TTGCATCGGTCCGTGTATATACTAACTGACTTCGTTAGGGAATGGCGCCA GCAAGACGGATACCGGATCCCAGATCCCGTCGGTTTGGGCTCACGCTTGG AAGCGAGCGAGATGACACGTTTCAGAGACAGAGAGAGAGGACCGACCGAA AGCCGTCGGCAGCCGTTCCACTGTACAAAATATTTAATGTAAGACCTTCA GCGAATATGAATATAAGAAATATATATGTGTGGTCATATCCGGAATACAT GTGGACTTCATTTTTACCTAGAATGTGGTGGATATTTTATATAAAAGAGC AACATCCCAATACAAATCAGTAGCAAAAGTATATCTGAGTATATCTGAAA AAAATTTGAAAATAGTTCAAACTCTTTCTGTTAGTTGTACCGGTCACTGT CTATCTGAAAGCTGAATCGGTGAAACGGGTTATATTGCATACTGTTTTAC GATCAAAGGGCGCGAAATTCAAATGAATTCCATCAAACTTCCCACCCTCG CGAAAAAGTTGGCGCATGCTCGATGCTCGGCACTTGGCGCTCACTTGGCA ACCCTCATGTGTGTGCTGGTGAGGGTCGGAAATTGAGGGGCGAGTGGGTG GAATGGGGCAGACAGCGCCGAGCTTGCGTCAAATACGGACGCCAGTTGGA CGCAGCTCGGGATTGGAGGCAGCCACGTTTCCTAGCCATCTGCCGTGTGT GTCGCAGCGACTGTGTCTGTGTGTGCCGTGCTGTGCTGTTCCGAGCCGCA TGTGTGGCGCTCCGCGGACGCGATGTAAAGCGGATCCTCGCCAGCGTTTA TCCTCTCATAGCCAGTAACCGGATTCGGATTAAGCTGGCCCAGCCTGTAG CCTATTCTCAGTTTTTGCCACCGCTCCTGCTCGAAACTTCTTTGTCAACC GGCGAGGCTTGTGCTTTTAACGCTTTCACCAATAACGGTATTTTTGGGGA GAGCAGCTTTAAGGGGAAATCTCCTGGCAGTGGTTCTGAATCGGTTGCAC TGCATCCTGAAGGAAACAACAGTGGCCACTGGCACCGCGGAGCATTTCCA CGATGCGATGCGGTTGCTCTGCTTATTGATTTTTCACCAACACTCACCCA CACACATACACTCGCACGCTGGCACCCACACACTTTCAGCCGCACACACA GTCAGTGCTGGCACCTCGGCCATTTTGTGGCTGGAAAAAAAGCCATTTTG AAAGCGGAAGTGCAGCGTCAGCCATTTTCGTTGAATGTCTTCCTTTTGGT GGGCACTAACAAATGGATCTGCATGTCTTTGAGGACCTCAGCTAATGGTT TTTAAAATATTTGTCTGTACCTGGTGCGCATATGCGATATGCGAGTGAAA TAACACTATTATTATCGTGATAGATTAAATTTAAACGTGAATCCAGTTTA CCATTGCAATTGAACTGTGGCAACACTGCCTGAGAAAGAGAGGGAGAGTG CAGCTTTGGTGGCTTGTGGAGTCCGCGTCCGAAAGCCATACACATACACA CTCGGAAAGCCGAGGTAATCTCTTATCAAGCGACGACTGCCCACCCCTTC TCCGGAGTCATCCCGTTCTTTATTGCACTTACATATTTTCTATGCACATA TATGTACATGGGGAACACACAACATTAGTCGCACATCCATTCAAAAAGTT TCAGTTCATTATTGTATTGTAATTCTACCCAAAATATACCACTCTACTTT TTCTATTCCCGCAGAAGCGCTGTCATGAGACAGGAGGTGTGTGTGAGCAT GTGCATCACCATCTCGCTGTCGATCGCGATCTCCCACTCCCTCCGCCTCG CGCTCTCCGTGTGAGATTTCCCGCCCAGGGTGGCGCAGTTGGAAAATGAG CACGTGCGAGGCGGCGGCCGCTGGCGAGAATGGGAGCCAGGCCAAGTCCG AGGAGAGCCAGCCGCCGGAGGATCAGAAGAAGAAGCAGCCGCAGCATGAG AGGAACGAGAAGCAGCTGGATAAGCCGCCGGAGAATTTGCCCCAAAACGG GAAAACCGAAGCAAAAGGAGCAGAAGGAGCGTGTTCACACCCCCCACTGG ATGCCCTCCGGAGCTCAGTGCTCCTGGATGCCGGTGCTGCTTCGCCCTCG ATAGACGCAATAGTGGCTTGCAAGGATGCACTGCTCGCCCAGAAGCTCTT TGCCAGCGGGGGTGGCTCCACGCCCGGTCCCAGTCCCACATCCTCTGCGG TGGGCGCGGGCGGTATCAGTGGCAAGGACCTGCTCAAACTCAAGGAGCCC ATGCGCGTGGGCTTCTACGACATCGAGCGCACCATTGGCAAGGGAAATTT TGCAGTGGTCAAGCTGGCCCGGCATCGAATCACCAAGAACGAGGTGGCTA TCAAGATCATTGACAAGTCGCAGCTGGACCAGACAAACCTACAGAAAGTC TACCGCGAAGTGGAGATCATGAAGCGCCTGAAGCACCCTCACATCATTAA GCTCTACCAGGTCAGCAGAATTTGCTGTGGCAGATCCTGCCAAGAATCGT ATTCCTAATCCCGTTCTACCAATCCCACAGGTTATGGAGACCAAGAATAT GATCTACATAGTGTCGGAGTATGCCAGCCAAGGAGAGATCTTCGGTGGGT TGAGGCTTCATTTTAAAAAAAATTTTTTAAACTCGGACTGTAGAGTACAG TACTCGATTTAGTTAGCAGACTTTTGAACCCACATTGCGCACAGACTTGT TGACCTTTGGACGAACAACACTAGCTTTAAATCTCTCGCATTCTCTTAAG TTGATAAGGGTTTCAATGAGATGGACTTACCTTTATATTTTATCCAGATT ACATTGCCAAGTACGGGCGGATGTCCGAGTCGGCGGCGCGCTTTAAGTTC TGGCAGATCATATCGGCGGTGGAGTACTGTCACAAGAAGGGCATAGTGCA TCGGGATCTCAAGGCGGAGAACCTGCTCCTGGATTTGAACATGAACATCA AAATAGCGGATTTCGGGTTCTCCAATCACTTCAAGCCGGGAGAATTACTG GCCACCTGGTGCGGATCACCGCCGTACGCAGCTCCCGAGGTTTTCGAGGG AAAGCAATATACGGGTCCAGAGATTGATATTTGGGTAAGTGGTGCGAAGT ATACGTGTCAATTTATCCAAAAATGTATAATTTCCTGCAGTCACTGGGCG TCGTGCTTTATGTGCTGGTATGTGGGGCCCTGCCCTTCGACGGATCCACG CTGCAGAGCCTCCGGGATCGGGTGCTTTCCGGTCGCTTTCGCATTCCGTT TTTTATGAGCTCCGAGTGCGAGCACCTCATTCGCCGGATGCTGGTACTGG AGCCCACAAGGCGGTACACCATCGACCAAATCAAACGCCATCGCTGGATG TGCCCCGAGCTGCTGGAGCACGTCCTGATAGCCAAGTACAATCTGGGCGC CGAGCGGCAGACGTCCGTGGAACCCAGCGAGGACATTCTTCGCATCATGG CCGAGTATGTCGGCATTGGGTCGGACAAGACGCGAGCCAGTCTTAAGAAG AACACTTACGACCATGTCGCGGCCATATATCTGCTCCTGCAGGATCGAGT TAGCCACAAGAAGGAGCAGAGCAACGGCTTAGGCGCCAGCGCCCTTGCCT CGTCGACCTCCGCCAGTCGGATGATCTACAGCTCCAGAAATGACCACCAA CCGACGCAGCAACAATCGCAGCAGCAGTCCAAGACAATATCCACCAGCTC GATCCTGGCCAAGGATCAGTGCCACAAAAGACTTAGCCGCCATCAGACGG TACTCATGAGTGAGCGTAACGCCCACGCCGGCGCGACACCCACAGTTCCA GATCCCGGTCCCGGATACTACGCCAAGTATGGCCCACTGCAACTGCCACT GCCTCTGACGGGCCACTCCCACCTGACTGGGTATCTGAATGGAGGAGGCG TCGAGGTGGATGCCAGCGGCATTCCGCTGCCCATGCGGTACACCCCGCTG CCGACAGCCGCGTCGCCCGCTCCCTCTAACTGCTCATCCACATCCTCGAG GGTAGGACGACACAGTCTAAGCTCCAGCTCGCCGCGAAGCCATCGACCGG TGGCCATTTCGCTCAGCATCGACAACAACCCCTCGCTGGCCAACCTGCGG TGCAGGGAGATGATGGAGGCTGGAGGAGGACCCGTTGGAGCAGTGGGTGT GCCTCTAGCGTCCAAGCAGCTTCATCAGACCATCAGCGAGTTCATCATCA AACAGAGCACCGAAGACTGTCGTGCGCTGCTGCAGCAGGTGAGTTTTCGG CTGATTCTATCCCAAGTTATTTCTATCCTTATACTTTCGGCAGTCCACAG CAGTGGCTGAGGGTAAAGATGATCCGCCAAAGGCGGAATCAAGCGTAGGA GGCGTTCCTCCGCCCGCCTCTACCACACCCACATCCAGTACAGCGGGACC GGAATCGGGATCGGCTCCCTGCCCTGGTGAGATTAACGGCAAGACAATAA AGACTATGTCCAGCTCGAGCAGCTTCGATTCTAAGGCCAATTTGGGCCAA AGCTTTCGCTACAAGATGTCCGCCGAGGCCAGCAAGCTTTTCCAGACTCT CCAGGAAAGCCCACTGCCCGTGGAGGTGAGTGATACGTGTGAGTTAATAA TTGCTTCCAGCTGACAAATTCCATTTCCTCTCCAGCAAAGGACTAAGCGT CGTGTGCACGTGGGCAGCACCAATGGCAGCGGCGGTGACTCCGGCCAGGA AACGAATGATGCGAAATCGAATGGCGACAGGTGAGTCTTGCAGTCACAGC GATAGTTTCTTGACTAATGTCGTTTTCTTCCGTTTCCGCAGCCGCTCGGA GAAGAAAGTTCTGGCCCAAGGCAGCTCCAGCACAGATGAGGGCTGCGAGA CAGACCAGGGCAACGATCCGGGCTCTGCTTCCCAGGAGTCAAAGGGCAGC AATGGCGGCGGTAGCGGTAACGCCAACGGCGGACCCACCTCGCACTCCAG CAGCGATCTGACGCGGCTCGTTGGAACCACTACCTCTGGACAGAGTCACA AGATGCGCTCGTATGCCAGTAGTAGCTCGTCCAGTGGCGTTCTCGCCGGG AGCGCTGGTAGCTACTCCAAAAGTCTGAGCCAGAACCTGAGCCGCGGCTC GTCCAAGAGCAATTGCAGCGGTCCCTACGATAGCTTGGACTTTGCCTTGC CTTCTGGCAAGGGCAGTCTACCCTCGTGCATGGGCTCAAGTTCGATGCTG GCCACGCCCACTCCGGCCTCGGCATCGCCAGCGGGAATCTCATCGGAGCA TTCATCGGAAAGATCGCTGTACGGGAGCCACAACTCCTGCATCCATATGC CAGGAGCTCTGCCGTTGGGCTTGGGCCTTCCTCAGAGTTCAGCCTCCACG CCCACGCCGAATCCTACGCCTCCGCCAAATGGCGGTGGTGTCACGTTCCT GGACAAGCGTTCACCCATACACTTTCGCGAAGGAAGACGGGCGAGTGATG GCCTGGTGGCCCAGGGCCTGCTTAGCTCTGGTTCCTTGCTGGGCACCAGT CGTGTGTACGGAAGTTATCGCTACGAGCAGGCCAAGCGTCACGGTTGGCT GGAGATCCAGCAGCTGCAGCAGCTGCAGCAGGAGGCGGCTGTGGGGCATT CACACCCACATGCCCATCAACATCCGCATCAGCATCCGCATCCTCATCCC CAAGCGTACGGCTTGGAAGAACTCTGTCAATTTCCAAATGGTCAATTCTA TGCTCTGCCGGGCAAGCATCATCCGCTGCTGACTTTGCCCCATCATCATG CGCATCCTGCGCAGCATCACCATGGCCATCATTCGCTGTTCCATTCAGGC CACCAAGCCACACCTCTGCTCCTGGAAGCCGCTGCTGGTGGGGATATGTA TGGTCATGGATGCTATGCTCCGCCACCGCCGCCACCAGGGCTATACACGC ACCATCAGTTGGGCGTGGGTATGGCCGTGCCCATGTCCCCGATGCAAAAG CCACCGCTGCAGCAGCAGCTACTGCAGCACCGCCTGCTTCAGCAGAAGCG TCAGTTGTTCCAGAAGCAGTACGCACTGGAGGCGCAGCTAGCCGGTCGAC ATCACCACCATCAGCAGCACAGCCATCACCACCATCACCACTTTGGCCAC AGCCTGGGTCCGCCACCGCCGCCGGCTCCGGCTCCGGAACATCACCTGGC CGACGAGTTGTACGAGTTGGCCTTGCTTGATCGGCCCAGGAGCGGAACTC CTAGGCTTCAGCACTCCATGACCATGCCCGGAGCTCATGCCTTCAGTCAG ATGAACCTCAAGACTTCCTACATCAGCCAATCGGACCAGGTGCCTGGTGC GGCGCCTAATGGAGCTGGTTCCGGAGGATCAGCTGCTGGGGTATCATGCT CAGCTCCACCGTCCACGGCGCCGGGTACGCCCACGGTCAAGTGCAAGCCT ACCACGCCCCACGGTCACAGCCTGGACTCCGACTATCATGTAAGTAAGCT AGATAACGCATATTAAGATGATTTCTCAGGCATCCCAAGTTCGTATATAA ACCTTATCCGTTTTCTCCTTGTGTCCTCCGCAGACATCGACGCCGGTGCT CAGCCTTTTCACGCCCAATTGGCAGTCGCTGGTAAAGCCGCTCAGCGAGA GCCCCATCCTGGAGATATCGGAGCACCTTGAGTCAGTCTGAGGCCGTGTG TGATGTTATTCGGTGGAGGGGTTGGGGCAATTCGAATGGGAGTAGATTTG TAAGTGGAAGTCGGTGGGAAAGGAAAAGGGGTAGGACTGGACATCGAACT ATAATGGGGGCTGGACCGGGACCGGGGCCACCTTTTTATTAAGCTCGCAA TCGCAATTATGAATTATTTGATCCATATACGATATACACCCATACATACA TATAAATAGCCTATATAGATATGAATGCGGGTCGGAATCGGAATCGGAGT TACATCGATTCACGTTTATTGGAACCGATAGAATCATTACCGAACCGGGC GAAGCAGTAATATTGAATGATTTAGTTGTGTTACTAGTCTTAAGTAGTCC AAGTTTCGTACGCATATACGCAGACATATACAATATGTATATTGATAATA ATAGCGTTAAGCTATAGCTCTACTTATGATTACACTATACACTATTGTAT TGCCCCCACGACAGTGGACGAGAACAACGTAACTACATATATCAATTATT CGAAGCATTTATTGGGGGCATAGAAAGGGCGTATCCATATAAGGATATAT CTATTATGTATTGGTACAATAATTAGCGACAAGCAAAGAAAAAAAAAACA AAATTTAAACAAACATCGATTGTTCTTAAACATGGAATTCAAATGTAAAC CAGATATTAAAGTCATTTGGTATAAAATGCAATATACTTCTGGAGTTCCT ACATTATATAGATATAGATATAGATATATATGGGTGATCTGTGTTTTCGT GTGTGCGTGGAAGGGACGACCGGCCGGATCATGTGACTAGAAATCTTTTT TGGAGGCACTATAATCACCAGGGGATCAAGGAATTTTTTCTTACCGCAGA TCATTCAACATGACATTTGGGTACTTCTCCCATCGTATTACTACCATATG GCACACATATATCATATCCCGCTAGGACGGAGGACGATGAAGGTGTTAAG GCATCTGTCGGAGTCACGTCGTGGCCTTCACCTGCCGATTGGACTCCAGG TGCTTTCGCTTTGCATTGGCCTGATTCCGCTGCTTCTGGGTATCTGGAGA GCCATGGCAGCGCAGCAAGTTCCAGTAAGCTCTTCGGTATTCGGAGCTCA TCAACACGTAGATCAGCGGGTTGATGCAGGTGGTCAAGTAGATAAGTAGA TAGCCAGCAATGTTGAACCAGTGCACCTCGGTGGCGCTTTTCCATATTTT GGCCACCGTGATGGGCAAATAACAAATTACAAACCACACGAAGATTACCA GTATCATCTTAAGCAATCTCCGGTCCTTGGCACTCATCCTTCCCGGGTAA ATAGAGGATGCATTTGAGGTATTGCCCATGGAGGCGTAGTGGGATTTCCG CGGGCTAAACCGTGTGAAGGAGGTGGTGCGCAGGGATGTAGTGATAGGGT TCTTTCTGGAATGGATTTACGCATTAAGGTTGAGTGAAATGGCAAAGAAG CCTTCAACAGCTACTCACCCATGGGTTTTGCCCATCTCTAGTTGCGTTTG ACTGCGTCCCAGGCTGACCTTTTCCTGATCCCGATCCCTTTCCTTCTCCC GCTCCTTGAGCACCACATTGGCATCAACAGGCGGTGGCTGCTGGTCCTGA TCCCTCCTCCGTATGCTGTACGAGATCGGCAGACTGTCCGTCGAAGCATT GTCATCGATATACGCTAAGTTTTCCTCCACCACAAAGGGTCGTCCTGCGA TCGGTTCGTTCGCCTCGCCGCTGGACGTGGTCACCTTCTCCGGCTTCTTT GGTGTGGCCATGGCTTGAATCTGATGCTGCGGCGCGGAGCTGGGAGTCAC ATCGCTGACATTGGTCTTGCCAGCGGTTCCCGCGCGAATGGCCGCCTTTC GCACCAGCAGGAAGATTCGGGCATAACAGATCACGATGCAGATGCACGGC ACCATGAAGGCGGCGATGAAGAGGAACTCCTTGGGGGATCTACCATACCG ATCATGCATGATGGAACACGAGCCGATGCTGACGTCCAAGCCAAAGATAC CCCATACGCCCCGCCAGGTGGGTATCATTATGGAAAACGTGGTGATCCAT GTGCCGGCTACCATCAAAGCCAAATATCGTCGCTGGTAAATTCTGGAAGA ACGGATTTGAACCAGTGGGAATTGTATTTTGTACCATGTCTAATTTGATA ATAATATATGCTCATTGTATTCAAATATATTATTTTAAGATATCCGTAGC TCACGAAAATAAAAACTAGCTAGTTATTTATTTCTCCAGAAATATTGTAG TTCATATTTTATAAGATATTAATTTCCGTTCAGTTTAATTGTTTATTACG AAAATATTGAGATCGCTGAACCGACCTTTTCTATAGCATTTGCCTCTAGC AAGTAATGTTCTCTTTTTTAGTTAATTAAAAAACATCTACGAGAAGCCAT ACATTTTCCTTTTTATAAACAAGTTCAAAAGTTTATAAGTTCAGAAACAC AATAACATATGTGTGGGTTTTTTTCTCAGATTAAGTGGTAGGTTACCATG CGTATCATAATAAACAGATAAGCACCAAGAGGAAGAGTTGGGCACTCTGA ATACCCTTCAAGATTTAGGCAGGACATGCCGATATGGGCAGGCCCATTCT CACCTTGGATACTGCCTGGGATGGGCGATAATGATGTACCGGTTGATGGT GATCAGCGACACGGAGAGCAGGGACACCGCCAGCAAGCCGTAGCGCAGCA TCGGAAACAACCTGCACAGCAGATCACTATGGGTCCACGCCCGCTCCTTG AAAGTGGACGCGGCCAATGGCAGATTAAAGCAGCCAAAGAGTAGATCCGA GCAGGACAAATTGATTATGAATATGGCCGTGGAGTTGCGGGTTTGACGAC CTCGCGACAGGGCCACTATGGTCAGTAAATTTCCGGGAACGCCCACAATG ATGAACACTATGCAGGCCACCCAGGCGATGGTCAGCAGCTCGTCCGAATA GCCCTCGAAGAGCACCTGGCGCCTGTCGTCTACATTGAGATTAAGATTCA TATTCAGATTGAGGTCCACGTCCACGTCCAGGTCCAGGCTGTCGGAAAGG GGTACCGGCAACACCGCGTCCTGATCCGCCATGTGATCAGTAGCATAGGG ATCCGAAAGAGGCAGCGCTATCGAGATCGGATGCGGAGTTGGTCCGGATT TTGGTGGGAACATCGCGCGGCACTTTGTGTTCGGCAAAAGACGCGTTGCT CGTTCCTGCGCCGAATTTGTACTAAAACTGAATTCTCCGCATCCATACAC CGACATGGTTCCCACCCAAAAAGTGGGCCCGAAGGCAGTCGCCGCCAGCC AAGCGTACAAAATATTGAGAAAAAAAAAAAAAACAGCAGGCGAACTAGAA