##gff-version 3 ##date Fri Jun 14 17:18:58 CEST 2024 ## exported from the transgeneomics system molecule_59058635 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59058635 mpicbg region 9631 19199 . + . Name=dmel-5.43-3L;type=genome;start=14877342;end=14886910;strand=+ molecule_59058635 mpicbg region 19200 19272 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59058635 mpicbg region 19273 20261 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59058635 mpicbg region 20262 45492 . + . Name=dmel-5.43-3L;type=genome;start=14886911;end=14912141;strand=+ molecule_59058635 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59058635 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59058635 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59058635 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59058635 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59058635 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59058635 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59058635 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59058635 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59058635 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59058635 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59058635 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59058635 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59058635 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59058635 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59058635 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59058635 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59058635 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59058635 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59058635 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59058635 coding_transcript gene 19123 20867 . - . Name=CG34245;ensembl=FBgn0085274;id=50506889;identifier=FBgn0085274 molecule_59058635 coding_transcript mrna 19123 20867 . - . Name=FBtr0302580;id=50506894;parent=50506889 molecule_59058635 coding_transcript exon 19123 20439 . - . parent=50506894 molecule_59058635 coding_transcript three_prime_utr 19123 19196 . - . parent=50506894 molecule_59058635 coding_transcript cds 19197 20439 . - . parent=50506894 molecule_59058635 CLC misc_recomb 19273 19306 . - . Name=FRT molecule_59058635 CLC cds 19314 19385 . - . Name=BLRP molecule_59058635 CLC cds 19386 19406 . - . Name=TEV molecule_59058635 CLC cds 19407 19430 . - . Name=Precision cut site molecule_59058635 CLC cds 19431 19472 . - . Name=V5 molecule_59058635 CLC cds 19479 20195 . - . Name=SGFP molecule_59058635 CLC cds 20202 20261 . - . Name=2xTY1 molecule_59058635 coding_transcript intron 20440 20562 . - . parent=50506894 molecule_59058635 coding_transcript exon 20563 20867 . - . parent=50506894 molecule_59058635 coding_transcript cds 20563 20777 . - . parent=50506894 molecule_59058635 coding_transcript five_prime_utr 20778 20867 . - . parent=50506894 ##FASTA >molecule_59058635 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACAAATTATATTTCATCTATTG AAATGTAAGAGGTGCGTTTTTTAAAAGAATTACATTTTTTAATTTTCGTA TGCGTATCTTCTCAGTTTTTCCAATAGAATTATAATAGATAGATATATAT ACAGGTTATACATAGCACATAATCTTGTTTGTTTTAGTTACAACTAAAAC TAAATGGATTCCATTCTATTTTCGTACACGCAAATCGCATCAATTTTTTA TGCCCATCCACTTCACATGCTCTCAATACTGGTTGTCAGGCAATAACTTC AAACAGATATGACATAATAGATTTAGATAGAGGGCTGTTTTAAAATTTAG ATCCATTCGAGAATCACAAATGAAATGAAAGCAATACCGATGGATGGGGA CATAAAAGCCAATTTCACAGTACGCCAAGTGATTTATTGAGACAGAGAGC TCACCTCCTCTATGGTCCTCCGCCCCTCGGATTCCCTCATCTATCCGCTG CTATGCTATGTAGAGCGGCAGCTTTTATTTATCGCTAAACTAATAAATCT TGGCATAAAAATGGAAAATATTGTGTACGCCATGTTGTGCCGAGTCCCGA ATCGTAGGCTAGCAACAAAAAAAAAAAATAATAATAGAGGCCATAGTCCA AGCAAAAACTCATAAGTGGCAGCGGTTTAAGCATTGGCCACAAAAAACTT ATACACATATAAATTTCATATTAAATAATGGTTTAATGATTTTATTTGTT TACTCGTTTCCGGCATCCAAACAATTAACTCTAACGAACTGCAAACTACT GGAAATAAAAACAAAATAATAATGCTATAAAAAAAATTCACAGACACGCT GCGTGTCAAAGTACAATGGGTGAGTGCCAGCGAAATTAATTTTTTAATGC CTCTGTCCTACAAAATTTTATTGGGCATTGTTTCCCCATTGAGCTTCATT CTTCGCTCGATTTTTTTATGATTATTACTTGATGTTTGCCTTGGCAGAAT TATATTTGTTTGAATTTTTACAGCTTCCGAGGCAATCACAAATCAGTTTT CTTACGCCTGAACTTCTTTTTTTTTTTGCATATTTCTGCTGCCTACTTAT CGGGGTCTCGCGTTTCGTAGGCCTTCGACTTTTAATTGCCAAAGCGTGGA CAGGCGAGTTTTCGCGCTGGTATTGCCACAGGATTTGCGTGGAAATCAGC GACAGGAGCAGCACAAAATTTGGGTTTAATGGCATTGCGTGAGGGTAGCG CATTAGGGAAGAAATTCAGAGGAAAAAATAACAAGAGCAGATCGCACACG TAAGTACTGCTCTAAAATAATTGTTATATTTATGTCTGCCTGTTTGTTCG GCATTTTTTTTTACACAACACAAACACTATGGTACTTGTAATAACAATTA ACAATTAACTTTTTATGGGGTCATGCATGTTGTTGGACATATAATAAATG TTTGTAAATGCCACCTATCGATTCTGTTATTTTTTATCCCACTCCCTACG TGCTAATTATATAATTTACAGCAGCATATGCTTCCAGTTAGTAGTGCTGT AAATATGAGGCATTAATGCGAATATATGTGGCGCCCGCTTGGTGGCCTCT GACTTGAATCAGTCGTGAGGCATAAGCGCACATCCGTATTAATGTCTGAA TCGATTCGTCCGCCAGTCTCCGGTAAGTATGCTCCAGCATACAATGATAC ATACTTGTTGATTTTATTGCCAGGCGCTCCAGAAATTACCGCATATGTGT AAGAGTGAGTGTGGGCTCGACGGATGCTTCACTTGGCCGGCGTTATGATA ATTGAGACTGATTGACCAGTTCGAGCAACTGATGGAATCGTTAAACCCAA ATATAATGTAACAAAAGCGAAAAATTGCTAAGAGTTCACCTATACCATTG TTTCTGATAACAAAATATTGAATTTCTTAGGAGCTTTAAATATGTGCATA CAAATTGTTATTATATTATTTTAAGCGATAAGTTCCCGAACTTTAAATGA ACAGCAACGTATGACAAGTATTATATTAAGCCCCTAAAGAAAATATAATT TTTGACTTATTAATAATAATTGCAGTCTATCCTTGCGGAACGCCTAATTC GGTTGTTATTTGCTTAAGCATTTCATAAGTAAACCATACAAAACAATTTC AAGAAAATTCCGTAAACAATTAGGAGCTGTCGAGGAAATTCCTTAATTTA ATGAAGACATTCTGGCACGCCATCAGAACTAAAACAGATGGCCGGACCAG GATACCATTTAAGCTTAACCACCTAATGAAAGACATCTGGCTGGTGACCA CAAATGGCCACCATTTTTTGTTCAGTGGGTGGGGGAATGGGGACGGAGTG GGCGTCTTTTGCATACTGTAACTGTACGAGTAACAACATGCACACGGGGC AAACATTTTTGTAAACACAGTTTACAGTGCGGTTAACAAATATTCATGGC GCACATGGCGTATGAGTGTTGCCCTCGTGGCACTTGATAAAACGCGAACA CTTTGGTCCACGGGGAGGCGGTTCGTGGTGCAAAACAGCAAAAAGCCAAC AGAAAGTTGATGGAGGTGAGTTGTGGGTGGTGACCGGGTAATGGGACAAA CAAAATATAAAGGAACGCCTGAAACACTTCATTATACTTTCTAATTTCCC TTTTATCGTTGCTGGCTTGCATCTTTTTCTGACTTTTATGTTGGGTGATT GGGTTTAAAAATCTCCTAACTTGTACGTTATACAACTAGTTATTTTTGTA AATCTCTTCGAAAACAGTAATTCTAAAACAAATATCCATAACATACTTAA AAATCATTCGTTTTTGTGAAATATGGACGACCCTGCAGTTCAGTAATATA ACTTTTACCCACAAAAGGTAATCAAATTGAATATTACGCATTCATAATAT AATAAAAGGTATTCCCAGGAAAAGCATTGTATCTCGAAATAAAATTACCT AGACCAAAAAATCCACCACTATCCCCAAGGCCACTTCCATACAGTCACTG CAGTGTCGACCACAATTAATTGCTCATGTGCGAATGTTCTGAAATTACGG AGAATCGTTAAACTTGCTTAAGCCGGGTAATGAGATATCATTCCGATGTC ATGAGCTGGACTCTTTCTGGCCGGATATAAGCCGCCAAACAGAAAGGGCC GGGTTGAAATGCTTAAGCACGAGTGGAGCTTACCGCATTTTTACAACACA CACAGCAATACATACACACAGTCAGTTGCTCTCATACACACACAGACAAC GAAGGCCAGGACATTCAGGCAGACAGTGAAAAATATGACACCCTATTTCC GTTTCCCGTACGCTGACAATAATGGCAGACAATATGGCGCAGCTTACGCT CAAAAGTGATTGCCACACCAGCCGACAGCTAACCAAAGTTTCGTTGAATG TAAAAACAAAAAAGCCGCTCTCGCACACACACAGAGGCAGAAAAGCTGGC AAAAGATTATATGTCTGGGATTTTTGGGGTAATTTAAGCGGCTTTTTGCC AGGAACCAAAAAGAAAATCCCGAAAAAAATTATGTGTGTGTGTGTGTATG TAAAGGCGCTGCCTAACCCGGTGCAAGTTTTAAATTAATTTTCATTAAAT GTGGCGCACACGAAATTGTTTTAAAGTGATTATGGCCGTGGAAAATTATG CTCCTAATAGAGGAGAGCAGAAGGGGATGAAAACGGGCGCCCAAAAGCAG GCCACGGCTGTTGACAATGATGGCGCATTTAACGGTATTAGGCAGGATGT CGCTGTGTGTGTCTGTGTGTGTGCTTGTGTCCTGAAAACAGGGGATAACA GGCACGAAGACAGAGGCAGAGAGAAAGAGAGAGAGAGAGAGAGATAGGGA GAGAGATAGAGAATATAGAGTGTCCCTGGCTTACCCAATCAATATGAATT GCATTATTGTCATCCCTTTTTTAATAAATATCTTTTTAATTATGCATAAA TTATAATTAACTACTCGGGACGGCCACTACTGCCAGATCGGCGGCAGTCG AATGACAGTCACTGCATAATAAATGCCTGGCGCACATAATTAGTGTTAAT TATTGAATTAATGCACTCGCCATTGTAAATTCATATCCACGAGATGCAAT CGACCCCATCTACGCCCTTTATCGCTGCTATGCCCAGCATATTTCAGCTT ACTTTTTTAAATTACCCGTTATTATATATAACGCATTTTCCATGCAACAT ATTGTTTTAATTATGCCTTTAAGTGATTTACATTGATATTTTGCGTTCAA GTGGATTTCACGAGAATGCATAAAAAATATCAAAGACTAATGAGCAGCAC TTTTGGCTGAATGGAAATGTGTTAAATGAATTGATTACTCACACAAGTAC TTCAGTTGGCTTAATTATTGAGAGAACAGAAATTTAATAAAACCATTTTA TTGTGAGCACAAATAAGGAATGAGTAGCATTTGTCGTTTTCATTTATTTG ACTTTAAGCTTAGCATATAGACTGTCATCTAAAATATCGATGTTTGTTAG GCTTTGTTTATGCAGTCATTAAAATATCATTAATTTCATAAATATTGTGC TGCAAAAGTTAAGCCTCTTAAGCATTCTGTTTTTCAATTTATATGAAAAA AAGCATGATATATATATTATTTCCTTTTAAATTACACTTTTAAACCCAAC TAAATTATTTCTAGCCCAAATTAGCTTCTGGCATAGTTGAAATTAAGTAA TCCAATTGTTAGCTGCCTTCCTCTTATTAATCTGATGAACTATCGATTTT TAAATCGGCAATACCCATACGAGCACGAGCCTTTCAATATTCCTGATTAT TCAGCTAGAATGTCAATTCCAATTTATTTCCTTCAAAATCACCTGCAGAA GAAATGTAATAACCCCGACCATTAGAAGACAAACAAGTTCCTGAGCACCG CAATTGCCTGCGAATATCTGTCTTTGTCTGGTCGTGTTTGTGTTGACGCT GTCGCCCTCGCACCCGCACAGCCACATACCCGGACAACCTTTCAACTTTA TTTATTAAAAGTGCTTATTACTTTAACACTTGAGCGCGATTTAACACGAT TTGCTCAAGTATTTTCGTACGACAACGAGGACACATTCCGGCGTTCTCGT TCTCGTTCTCGTCCTCCTTCACCAAAGAGCAAGCGAGTGTCAAGGTATGT CTCTGTCTGGGCCAACTGTCTGACTGTCTCCACTGTCTGTCTCTGCTCGA GTGTCCTGTGCTGGGTCCTCGTCCTTCCCCATCCTAGGGATCCTTGAGTA TTTAGCTTACCTACCGAACACCGAGAGCAGTTTCATCTTTTTCATGTGCA GCGAGCAGCTCAGCCAAGAAAGCAGCTCCATCATTTTACTCTTTTCGCAC TCGAACACTGAGAGAAACTAATGGAAGAATTAAAAAATTCAAATGATTTC ATTGTATGTAAGTCTCCATTATTTTTTTAGGTAAGAGAATTTATAAGAAA AATGATTAATGTTGTGATAGAAAAATATAAGTGAAAAATGTATTACTCGT ATTGAATTATTTATCTCTAATAAACGCATTTGTCATTTTCAGGAAAAAGG CAATAAGGAAATGGTTTAACAATTGAATTATGATTACCATGCAAATAAAA TGATTTATAACATCTTTAGTATTATACTAATAGGCTTTTACAGTAATAAT TAACATGGTTCTCCTTTAAGTCAACATTAGTTAAAAGTACCAGTTATTAA ATAAATTTTGTTTTTTCGCCAGCGTGCACGCTCTGGTGTTTTCATTTTTA ATCACACATCACGTACTAGTTTTTTCTCTGTACACTGGCAGTTGTCCTTG GATGCTGTGTGAGGTGGTCCTTGCCTGCTCTTCAACGCCTGACTGTTGGC TGTAGATCGACTTGACTGCCTTTAGCTTCAGCTCCAGCGGCCGCCCCTTT CCCACTGCCACGCCCCTTTCCTGGCCTGCTATCATTGCCAGCACTTTGCT GGGGTTTTCCACGGGTTTTTCTGGGGTACAGGAGCTCTGGGGTCTGCCCC TAATATTGCCCTTGACTGTTGTCAACATGTTCAGAGCGTATTTGTTGTTC GAGTTGTTCGGTGTTCGGTGTTCGTTGTTGCTGTTGACTTTAAGTGTGTT GATTTCATACAATTAACTTTTTGTCTGTTTGTTTTGTGCGACTTCTGCTG GCGTTCGGTCTAATTTCCTGCTCCGTTTTCTGGGGCGGCTGCCGGGGAAG TACTGACATCGTTTGACAGGCCACGTGTGCTTTAACAAGCTGGGGCCAAA ATGGCAGATCTGAATCCGACCGCAACGTGGCGTATACGCAACGCGGATTG TTTTTTCCTTTTATTTATATACTTTTTTTTTGTGGCGCTGCAGCGCAGGC AACCTGAAAAAATTTAATATTTATTTTTATGTTTTTGATTTAATTTTCCT CTTTTCAACATTATGGGAATGTGCGAGTGTGTGTGCGTGTAAGCGGCCAC AGTTATGAGGTTTTTGCGTTGTTGCTGCTTTGGGGATTTATGAAAAATTT AGTTTTTCTTGTTATTTTTACTGCTTTGAGGTGATTTTTATTTTTATTCT CATCGCGCGACGCGCGTTAAGTTCCCGTTTTATACTTTTATTATTTCTCA TTCACTTTTTACGATTCTGTGTGTGCGATTGCGAGTGACTGTGTAAAATG TCATTTGTTTTAATTTGCCAGCCGTTCGTGAAGGGTATTATTTTAATTTA TAATTCACCTTTCATTTATTACTCGAACGCATTAAAGTGCTTGAAAATCT GCGCGCCAAGGTTATATACTAAAATTAGCATTTTGACCAGGCCCACAAAT CTTTGCTAATTTATAGCACTTGCTTTATATATTTTGGCCATAAAAAGCAG ATATATAAACTTGCCGCTCGGTGATTAATGCGTCATAATTAGAATCTCTG GCCGGGTACATGCATAATTCCACGTGGCAACCCTATAAATCATGCCCCAG TGTGTGTGTGTGTGTGTGTGTGCCGTAATCTAGCCACCAAATTCGGTGTC TGTCTGTCAGAGACACTTAACTTTCGTGCTGGCAGGTTCATCGGCAAAGT GTCAGCACACAGATATCCTCATACGCCCCATTTCCCAATACCAACCTGCT CGCAAAATAAATGCGTTATGCGTGCGCTTAAGTGCTCATTAATTTGGAAT GTCAAACTATGTTGACTAACGCAAACGTTCCACGTTTAATCGCTTTGAAG AGGACCTCGTTGCGGTCTTGATGAGTTCCTGGCATGCTCTATTCCGCATC CCTGTCAAATTGATTTAGAAGAGCCCCATAAAAGCAGCCCGGTCAACATT CAGGCCCACACAAACACAACCACACCCGAAAATGGAGGCAGACATCAGGT GGAGGATTTCACGTACCAAGTCATTTTCAATTGAGATATTTGCGAACGCC GCTGATGCTCAAACGCAGAGAAAACAAGACCAAGTAACTATTTTTGTTTT TAAACTAAGAAATAAATTATTGTTAAACTCTTGAACAAAGTGGTCAATTG CCAGTTAACTAACTAACAGTTACCTAGTTTGAAAGTAATCTATTTGATAA TTAGTGCTATTTTGTAATTGGTGGTAGGTCTAAGCCGTTTAGCTTCTGCG TTTGCAGGGGTAATCATTAAAATGAAAATGAAGAGTTATCTGAAATTTTT CCAAGTGCTCTGCATTCTGATTCCATCCATTGTTGCCTCGTGATCTTCCG GCTGGAGTCTGAAAAAATCCGGTTGGCCTAAAAGAGATGCGGGCTGACTG GCCAAAATGCAACTGGAGGCTGCCGACGTGCCTTGCGGTCAGTTGTTGCA CGTTGCAGGGTCAGAAGTCATTCAGCCTCTATTAGGCTGCTAATTGAAAT ACCAGTACGAGGACTGGGGCGTCCAGACCAGTCCAAAGGTTAAATCATGT CAAAGAGCTCGAGTTTCGATTGGAAAGGCAAGGCAAGAGATACGGAAAGT ATAAACTAATTAAGAGTTGCAAGCTCGGCAAAGGTAATTGAAAGTTAATT AATTAAATAGTGCAGAGATTTGAGACTCCAATTGATTTGCATTTTTCAAG AGTTCATTTAGTAGAGTTAATCGAAAGTACTCTTTCAGTACAATACGGGA GTTGGTTTGTAGATAAAGATCTTGTCGATAAACCTTCTTGAAGTATAAAA AACAGCTATAACTTTCCTTAGTTCTTTGCATGCTTTTAAAAGTAAAGTAG TTCAAACTAACTTACATTTTTTGGAGAGCTATGAAAGCGGAATGGCAATG CTCAAGCAAATTCTTAAGAAAAAGTCAACCCTTACTCATACCACCCGGTT TAGAAGACTTCTTGTCATTCGAGTAATTATCTCACGTTTATGAGTCAAAC ATTTGGCTTCGCTGTTTTATTTTTTCGCATCTGTTTACGTGCAATGCAGT TGGGAACCCGTCATTAGGAATTAAGCAAAAGTCAGTGGCGGAAGCCAAGT ACTTGTCAAGTGATGATGATGCCGGAGTTCTTTGCAAGGCCAAAAGTTTT TAGAGTATGCGGGTTATTCCACAAACTCCACGATCTCGTTGACTCCATTC AACTTTGGTTCGCTTCGCTATGCTTTTTTTTTTGTATTCATTCTTCCTGC CGGTGGTGTTGTTGGTACTGCTGCTGCTACTGCTGCTGCATCCTTAAATA TTTTCCCTTTAATTAAAATTTCAACAAGCCAGACTGCCGAGCGAAAGAGA CGGAACACGGAAGAGTGAACGAGAGGGGGGATAGCACAGACATGCCCGCA TAAATTAACTTTTGCGTAGGTGTATGGAGTTACCCGGGTCTTTGGAATAC GAAATACGGAGCGTGGTAAGCTGGGCGTAAGTGCCTTATCTTAATGCCCC GCCATATCTGGGGCCTAATGCATATAATAGGCCATGCCTGCTATTTAAAG TCTAACAACCCTTTTTATATGCAAATTGTTGCGCCACACGTACACGCCCC AACGCCTACCGCCGCCTCTTTTTACTTTTCCCCATTTTTTTTCCCACTTT TTTCTCCCCCCTCGGTTGACTTTACCATCCATCCCAGGGCAACTTGACAT TTTTTTAGATACTCCACCGTGTGCCCTCCTGTACCCCTTTTTAATTTCCC TCATTTAAACATTTTGTGAAAAGTCATATATATATGTACGAGCACACTCA TACGGATCTTTTGGTGGGCGGTGTGCGTGAATTCCGTTTCCAACTTTTTA CACGACTTCAGGTCTTTTGGGCATGTGGATGTGTGTGGAAAACGTTAAAA TAATTTGCAATTTAAATAGTTTTAATTAACTTTCACTAATTTGCTGTCGC TCAACTTGCACAAGTTGGCAAACTAATTTTAAAGTGATTTATTATTTAAA CAGCTTGATGATTGGCAGCGCCCCCCATCGGTGAAAAAAAGAGCCACTCT GCCAACGGCCTAATTAGCTAAAGGTGCGGAGGTCACCTCTTTTTGTCTGT GTGGTGGCATGTTTAAAATTGTAAAATTGATGCAATTAAGCTTTGACCTT TTGGCTGAAAAGGGAACTCCATGAATTGCTATCAGTTTATTGGCCACAAC CAATCGGGCATCAATAAAGTTCATATACAAACAAAACCGTTTGGGCCTAC TTGTCGTCGTCATCCTTGTAGTCAATGTCATGATCTTTATAGTCTCCATC GTGGTCTTTATAATCTGTCGACGAAGTTCCTATACTTTCTAGAGAATAGG AACTTCCCGAGGATCCGCTGCCGCCGGCGTTGCTGCGCCACTCCATCTTC TGGCTATCCAGGATCTGGCGCAGGCTGCTGGCCATGCCCTGGAAGTACAG GTTCTCGGGGCCCTGGAACAGCACCTCCAGGGTGCTATCCAGGCCCAGCA GGGGGTTGGGGATGGGCTTGCCCTCGAGCTTGTACAGCTCATCCATGCCC AGGGTGATGCCGGCGGCGGTCACGAACTCCAGCAGCACCATGTGATCGCG CTTCTCGTTGGGGTCCTTGGACAGCACGCTCTGGGTGCTCAGGTAGTGGT TATCGGGCAGCAGCACTGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAG TGATCGGCCAGCTGCACGGAGCCATCCTCCACATTGTGGCGGATCTTGAA GTTGGCCTTGATGCCGTTCTTCTGCTTATCGGCGGTGATGTACACGTTGT GGCTGTTGAAGTTGTACTCCAGCTTGTGGCCCAGGATGTTGCCATCCTCC TTGAAATCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTATCGCCCTC GAACTTCACCTCGGCGCGGGTCTTGTAGGTGCCGTCATCCTTGAAGCTGA TGGTGCGCTCCTGCACGTAGCCCTCGGGCATGGCGCTCTTGAAGAAATCG TGCTGCTTCATGTGATCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGT CAGGGTGGTCACCAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGC AGATGAACTTCAGGGTCAGCTTGCCGTTGGTGGCGTCGCCCTCGCCCTCG CCGCGCACGCTGAACTTGTGGCCGTTCACGTCGCCATCCAGCTCCACCAG GATGGGCACCACGCCGGTGAACAGCTCCTCGCCCTTGGACACCATGAATT CATCAAGTGGATCTTGGTTTGTGTGAACCTCGTCCAGCGGGTCCTGATTG GTATGCACTTCTGTAATTATTTGGCATTCATCGTATGTCCACAAAAACGT CGAAAGGCATCCACCAGAGCCATAGATATAGGCGTGATTGTAGTTCCTGG CCAGGTAAAGTCCAAACAAGAGCATCAACAAAATGACCACCAAAAGGCAC ACAGTGGCCACCTCTTCGCATCCATATCGTTTAAAGAAACTGTTAAATAT TTTAGGAACATCGCGGTTATTTTACTTATTGACAGATGCAGAATTACTTT GTTGTGGGTTTACATAAGTGTATACGATTGAATTTCTATTGTAATTTTTC TCAATTACATACCTCTGTCGTTTGGTTACACAACGAAGGCTTGGCTTTAT AAGACTTAATTGTTGAGAAGTTTTGACCCTTTGAACCGCCAGGAGAGCTC CATTGCCCACTTTTTGGCGATACTTGGTAAAGATCTCAGTTAAACTTTCC CTGGTCTGTCTGAGAACCGCTCGAATTGGTATTTGTGTGTTTCGTGTGCT GCAGTTACTTGGTGTGGATTCATTCATTTCATTCCATACAGTATTACAAA ATGTTAAGTCGTCAAAATTGTGACAAGTAATTCAAACAAATGAAGTCCTA AGAAAGTGTAAAATAATGATTTATTTACCTAATAATCAGAACGCGCTGTT CAAGTAAGTTGCATATTAATACCATGAACGCTTTAAATTAAACTTAAATC TGTAAGTAATTTATGATTATCAATTCAGATCGCTGTCTGGACATCTTAAG CCATACGAATTCTGAGTCGAATTAATAACATTATGCAAATTTTAAAACAT CCCATAAATCAACGCATTGAATTCGCCATAAAATAAATGCGCGCCCAAAA GGCAAATAATGGCAGAGTCATTAGATAAATTTATTTCGAATTCCACACAA ACAGGGGCAAATTGAAAAAAGACAGCGGCAGCAACAACATAGCCATCACC AAAAAACAGATAAGGGGGAAATCGATAACAACGGGCAAATTGAAACCGAA AATTTACAGTAATCAGCATAATATAGAAAACCGCCATTAAAATCATTATG TACCCAGTTTAATGCCTATTTATGGCTGATTTCAATTTAAGTAGCAATCC CCGCCGCCACCCACCGACTGCCGCAAACAAATAGAAATACACACTGGAAT ACCGAAAACCTGCTGGCGTTAATTTCCAATAAAAAGCCGCTCTGCAAAAA GTAATTAACAACAAATTACGAAACCGTAGCAAACAACAACGTTCCCGAAC AACCGCCACAACCAACACACTTAAAGCTAATTAAATTTTACGCTGATTCC CCCTCCCCCCATCTCTCACACTATGAAAATCTCCTACCCATCAACATACT ATCCATAACTGATTGTTGGCAATAACGACGACCGCAGAGAACCGAGAGCC ACAACATCTGGCATGGGTAGAGCCAAAAATAATGCCATATATATATTAAA TAAAAATGATCAAAAAGTTTTGGCATTCATTTGAAGGAAGGCTCGTTCGG TCGGTCGGTCAGTGAAATCAAATAAATTAAGCGCTGACCAGCAGCCAAAC ACAATTTGAAGCCACCTAATTGATTTGCCAATAAAGTTAAAAAAAAGGAT TCGCCACATGAAAGGCGAGGCGCCTTCATAGCCTGTAATTTGTAACCGGC CAACTGCAAGAGCCAAAGTAATTGATGCCCAACACACACTCGCACTCGCA CACACACACACACAGACACAAGTTCACACGAACCCATACATATGTACATT AATTACCACAAAGTAAAGGAAAGCGAAAGGTGGAAGGACTATGGTCCAAT GCCAACAGGACTATGACGACACCGACGGCTGGCCAAAAACCATTTGGGTC CAGCGAAGCGAATCTAATGTCGAACCGCCAGTAGAAATGTCATTCGTGTG CAATTGCCGCTGCCCGCTGTAATTTTCTTTTTGCAATTCTTCCCGTTTGA AGAAAACACCATCTCGGTGAAATGGGGAGTATCTTTTTATTGAAATGCGT AGACAAAGAATTACTTTATATGATAACTCCAAGAATTTCTCTTACACATC AGGTAAATTCTAATCACAGAATATTATCTGAGAATTTATTGTTTTTCCCT TATTTGTAATATTTATATTTTATATCATAAAACTGCGTCTTGAAAAAATA AATGTTGAACCAAAGATTATAAAATTAATTTGTCTTAAACTCTTTTTTCA CTTCAAGTTCGTACTTGGATCTCGGATATTGTAGACTTGATAAGAGCCCA TGATCGCCTAAAAAAGTGATGTACCAGTGTGGAGCAATCGCCAATGGTGC AGTGCATCCACGACCGCAAAGTGGACCATCCAGCCGTGTGAATGCGAGTG TTTCGCTAGAGCCCCACAGCGGGAATTGCAATCATATTAAAAGCAGACTG AGAGCCTCAGTGCGAAACATTTGATGCCAAAACAGCGCGAGCATGTGGCC AGCAGAATGCGGCATGAGGCACGGCGTGTTGCGCGAACGTAGGGAATGGG AATGGCTATGTCTGCGATCCTCCGACCTAAACTAATCATGGCTACCCATC AACTGCGCGGTGGCAAAAGCGAGAAAAAAAGCAGCACCAGAAACCGTAAC ACTTTGGCCAGCCATTTGCATTTCCCCAGGAAAATGGAGGAGCATTGTGG CCAAACTGGCTCACAGCGAATGCTGCCAAATGCTAATTTCCTGGCTGAAA ACTTTTTGGTCATTTGCTTTATTAACGACAAAAGATTTAGAAAGAGGAAA GCCAAGGTTTAACCCACTCAAGGCTAGAAAATAAGGAATTTAGCAATACT GAATATTTACAATTTTTAGAGTGAAATAGCAATTTGTTATGCATTTTAAA TAATTTTCTAAGAAATTAAAATGAATAAATTTTTAAATAATTGTAATTTT ATTACCATAACAATTCAAAATATTAAAAAGAAACACGAAACGAAATGCCT GAAGTCTTTCCATGGAATATAATCCCTGACTTGTGACAACTACTAGATTT AAGATATATGTTTCTGGGGTTAAGCAAATGTGCAGGTTTGAATTAAATTT CTAAGATGCAGGATGTGGCGCTAAGTGCACACCCGCTTCCATTCGAGCTT TGCATAACTCATTAATGGCGAAAGTTTCTGGTGCTGACACTATCTGAGAT GGAGATAATGCCCCCCGGCTGGCCACAAAAGACAGGACCCCGAATTGCGA GTCGGAACGGAAAGAGCTGAAGACATCTCGACTGGCACAAGGGTCAAGTG GGGCATTTATCAGGCCAGGGATTGCACAATATGGGCGCATAAGGCATGGC CATCTGCATCATCATTATCCTTGCGATCACATGCTGCATGTACGCAACAA AAATTAATTGTGCCCACATTCAACAGGAAACGAGACCGAAACGGATCCAA ACCCTTGCCGCAAATGAGAAACTTGGACAATCGCATTCACACATTCTCGG CCAGAGACAATTGAAACTTTTTGTTCGAGGATGAGTACGAGTTTCAGAGT GAGATTGGGAATGGGAATGAGCACGACTACGACTACGAGTACAATTCTGG TCGCATTCACAATTGAGGACATGAGCTTTTCTTCTTGGCCGGCCAGCTTG ACATGCGTTGGCAGGACCTCCGTTCCCACTTTTCAACTTCTCCATTCTTA TGTGCCAAAGCATGTGTTTGAGCACTGAAAAATGTGAGCAACTTGGGCAA TGCAATTAGTATTCTGTTAAGCAATTCATTTTTAGAAGCATTTCACTAAG TTCATTGAAAATTATGATGAATAATTCAATTTTTGTACGTAATTGGTTAT GATAATACATCGTATAAAAATCTATAGAAACTGCGACATCTCTAACACAT AACAAAACTCCTATATAACTATTTATTTATTTTATTTGATTAATCTGTCG AACGCTTCTTGTTTTGCAGTGCATGTGCGTTCACATAAGTTGGCCAAGCT GTTGGGCTGCTTGTGGTCGGTTTGCCTTCCAGCCATATTCCCATCCATTC ATTCAGTTTGACATGGCAGCTGCCTGGTCAGCCATCCGACGACTCCCTTC TATATAGCACCTCCCTTAGCTCGATTCCTTTCCTTTCCTTACCATGCCAT TCAAAGAACTCTTGTTATGCTCGCCCTGCTTGCGGTTTTGTCCATGGCCA AATGCAACAGCGTCTATGGGAACGCGGTGGTGGTTGGGGGTTTGTTGTTC AGCTGAGTGGCAAGACAAAGCTTGAGCCGCAATCGCAGACCCCCACACGG TGGAAAAATATCATGAGCATTCGTAATCAATCAATCAATTACTTCTCCTT GTTTCTAGCTTATTTTTAAGTGCTTATTCTTAAATGTTTAAATTGTACAG CTTATATAATATTTTTATAAGTATTATAACCAATTGTTATAATACATTCT AACTTAGTTAAAGCAAAACAGTATAAATGTACTTTCATTTCATTAATATC CTCTTTTCGTCTGTATAGCCAATGACCATGTCTTGTAGCCGTAGTAGTTG CCGGAGTCGCAATCGGAGTCAGTTGAGTGCCTTTGTTGCGGTTCATTCAG TTGTATATGTGGCTCGGCTCGGCCGAAAGTCCTTACCGTGGCTTGTTGCT TGGCTTATAGCTCTTGGCCTGCTCCTGGGCCCTCTGATGCACTGTTGCCG TCGCCTCATCGGGGCTGTCGCATTCTTCAATGTCTCCTTTTAGTAGCGTC ATGGGCTTCATACTTTGTATTGAAAAGTTTTCGCGCGCGACTGACAGCAG CTGAATGGGAAGTCTGCCTTTCTTTCCGCACATATATAGATATATATGTA CATTCCTCGTCTTGGGAAACTTTGGCTTGCAGCGGATATCCCAATGCTCC ACTTGATTCAACTTCAAGTGCTATATAATCGCAATTAAGTCAGTACTTCC AATTGAATAAGTACTTCGAAACGTAATCGATTGCCTGCCCAACATAATTG TTACTACAATTATACAAGATATAAACCTCCATTTTTAAGTCTTAAACGTT TGGAATATCTTTTTCAAATTTAGTTTGTTGGGTAAACTATTACTTTCGCC GTCCACTGCAGTCAATGTGTTTCTTTCCCTCTTTTTGGCTTGATTGTGTA TATGTGTCTGTGTGTGTGCATTGTCCTCGTTGCCATTGTTTAATGGTCAC ATTAAAAATGCCTCATTGTTGGCTCTGTTGTCGTTGTCAACTTCTGACCG CGCCCTTTGCACAATATTTTCCACTGCATTTCGCCATTTCGCCCACCACC CAATGTTCGCCACCCCGGCCATTTTGCCATTTTCCTGCAATTTTCTTTTT CTTTCGGCCACGGCGCAGAAAAGTATGCAATACAAAATGCATGCCGGCGG CATTGGACTTTTTAGTGGCTTGCATTGCACTTTCTGTTTACTCGTACTTT GCAATGGTGTGTGCATGTGCGGGAGTGTGTGTGTGTCTGTGCATGAGTGG GTGTTTGCACGTGAGTACATTAGCTGGAAATTTAAGGTGGGCACGTGTGT GTGCATGCTGCTGCACAGTGGGCATTTACAGCAAACAAAACATCCTTTGT GGGCATCGACTTTTCGTGGATTCTGCCACCGCTGCCGCAGTACCAGAGTC CTTCATGTGAGCACAATGCCGAACGGCAACAAGGTGCTGCAGCCTGCACT TTTGCACCACCCGCACCTTGTCCCACCCGCTCTCTGGGGCATTGAAAGAG CTCATTATGGCAGGTACCTTTTTACCCAGTGATGCTGGAATCTAATCCAA AACGAGGGCAAGATGTCTACAAAAAAGTTACTAAAACGTTCAACGCCTTT AAGAAATATGCAATCCAATAGTGTTTATTCACAGAATTCTATAATTACAG AAACCAAATATATAAAATTAAACAAAGAAAATTGTAAAAGAATCTGGTAT AGCTATTAAAAATTTTCAAAATGTGTATTTACGGTTCCAAATAATATAAT AATATAAAATGGATACCAATATATTTAAATAATGTCTGAAATACCATTTT ATGTTATCAAGACTTCCTGCCAGCACAGTCCCTAAGCACTCTCATGCACT TTGATTGGTGGCCGAAAGTGGGAGGCACAAAGGAGTCGTATTGGCAACAG AAAGGAAGCTTATTTTAGTTGTTAACTGATGTGGGCGTGCCACTGTTGGC TCCTCTAATAGTTTGTTGTTTGCCAGCTTGGGTCTGTTGGGCAAAATTAG ATAATTGAAATTGAAACTGGATAGAATGATGCTTCAGATCGAAGCTACGT AAGTCAGCTTAAAAGTTTACCTCTGCGGGGCATGAGAAAATTACTTTGAA ATTGCCATTGGGAAAAAATTCCCATTTAGCGGAGTAAAGATAATCCGCAG CTACTTTCATCTGATGATTCAATTGTGTGGCAATTCACAAAGCTGGCGAA ATAATTAAACAGAAATATGGCTGAAAATCCATAAATCAGGCAGCCAGCCG GAAATGGCATTAAAATAATACATTAACTTCACCAAAACGTTGCGTCGCCC ACACAAAAATGTGATTAATTTAAAAGAATGCGAGGGCGTACGGCGAAGGA AACTCACGAAGTTATTAACGGAGAGTCCTCGCCCCCAACCAATACAATTT ACGAGTAATAGCATTGTAATAAAAACAAATTTCCACAAACGTTTGGCCTA ATTGTACGATAGAAAAAATGAAAGCATTACCCCAGCCAATCTCTACCACC CGCCAATAGAATTTATTTCTGCGGTTTAGTGGGAGTGTACTATTCGCGGG GACTGTTGCTCGTGCGACCAGCGTGACACAGAAAATTTCACAGCACTGCC AAAAGCAGCGAAAATAACCCACAAATTGTTTTGGCCAAGTAGTTGCATGT GAGTGGCGCATAACCAGCCCCCTCGAGGACCCCTCTATCGAGGGGTATGG CACCTTCTCTATGAGAAAGGTGCTGCTGCTGGATCCGTGAGGTTGACGTT GACGTTGCTGACTAAGGCGACGACAAAACACACGAACATAAACCCCAAGC ACACACAACGACGACAATATAAACACGATAAGCAAAAAACTGCGACTTCC CCTCGGGGAACGTGCCCCAAGTCAGAATTTGAAAGCGAAGTGGTGGTGGT TAATGGCGGTGTTGGGACGGGGGAAGTCAGGTACTGTGGTGCAGTGTTTG GGAATTTCGAAAATATAAATATAAAGTTTCAATTACGTACCATTAATCCA GCTGCCATATCCAGTCAAGCGATTATAAAAGTTAATCGTTGGGAAAAATG TTTTTGCAAGCCTCGGATATGGCTATAAGCATATATATGCTTGCTTATTA AATTATATTTTACTACAATTGTCATTAAATAATCATAGAAAATGTTGGGA AACTCTCTTTAATGTAAATAAAACAGGGCTTAGATAATTTGTATTATTTT CTAGAAAGTGTTTGTGCCTTTCCTTTGACCATCTTCTAAACCAAATATGT ATTATATCATTTAGAAAATAGCCATCCAGCTTATTAAAGTCAAAAAAATC TAACCACAGTGCCATGAAGCCTTTGAGCCACAGGGGGTAAAAGGACCTGC TTTAGCTAAAGCTACGGTGTTATGGTAAGCGTTTCCCTACCCTGCAGCTC TCCCCTGGAAATCAGTTTAAAGGCCGAAGCTCCGCCGCGGGCAAAGACAC AATCCCACAATCAATCGGTCAAAGCCAGGAATCTACTGGATCCCATGCGA ACATAATAATTGGAGAGGATAAGGAATCTCCTGGCGACGCCACTGGTCGA CAGGTAATAGTGCAATGAGAAAGGTGAAAAAGCCAAACAGCTAAGAGAAC ACAGCAAATGGCCCACTGGATTTTCCTTTGCACTGGTATGAGTGCATGTC TGTGTGAGTGTGTGAGTGTGTGTGTTTGTGTGCGAGTGCTTGTGGTTTTC CTAAGCAGGGCACAATTAGTGGTGGAGCAGCGGGCGGGAAGCGGTGGGCA GTTAGCCCCATAAGTCAGTCACTCACACAGGCGAACGTGTAATTCGATTC GCGATTCGAGGAAAGGAGGTAGAAAGAGAAAGGCACTCTCTAAGAAAATT GGCTGCGTCGCCAAGGAAATTTAGAGTGGACAAAAGGCAGCAGTAGCAGC AGAAGGTAAAGCTGCGGGAAAACCAGCAGAACAGCCAGCAGGCAGCGCCG CTCGAAACACACTTCAAAAACACTTTGACCGGCAAAGTTGCCACACGGAA TTTCTTCTTGTGCATCGGTAAATGCCAGAAAGTAAGCAAAACTTTCGCAC TTTTGTTTTGGCCAACTTTCTTGCCAGCGCGAGAGATGTTTTAATAAACT CGCCTTCGAGTTCATTAAATTTGATTCAAGTAAATGGGTTTGTGCTATCC GATAAGTGAGTGTTTTTCCCGTTTTTCCCCGAAAAACCGATCCAAAAGTG GAGACAATTGCGGCTGATTGATAGGCAATTAGTGGAAGTGGATGCTGCTG ATGTTGCAAGTGGAGAGGCACAACTGTTTGTGCATAAATAACCCAAAGCA ACAACTGCCGGCCCAAGTGTCATTAACCTAATTGCCGCAAAAGAAGCCAC CGCGCCACTTTTACCCCAACCGAAAAAATATACGGCCATAAATACGACGA CCAAAAGGAAGAAGCAACGTGCAACGTGTTGCAATAAAAACAAATTTGCA TAAAACAGGTAAATCCAAACCCAAGCCCGCCGCCACCCCACAAATAAAAA GGTGAAACCATAAAAAAAATCAAGTAAAAGGGCTCACCAGTGAAAATTCC AGCTCCCTTGGCCCACAAATATTTATTTTTTGTTGCAATTGTAAAATACA CGAAATTCCAATGCAGTGAAAAGGACTTGGATCCCGGTTTGTGTGGAAGT GTGTGTGAATGGTTGTAGGTGAACTGTGTGTGAGTGTGAGTGCAGAGTGG TCAAAGACACAAGAGACCAATGCCACTTAAGCCAGGAGTCGTCGGCTTGT TCCCTGCCGTCTGCAATTTTTCGGTGCTTAACACTCGATGCACTGGGGAA AAATCAGGAAAAACAGCCAGAATGATTTTCCTTAAATCTAAAATCCTGTT TCTGGGGTATTCAGATGTTAAATATAACAAATTTGCAAAGTGATATTGCG GGTCCTTTTGTGCGAGTTTTTAGTTAGATATTAGTAATAATATATAGAAT ATATATATAAAGATACAACTAGAATTGTTTATGCATTTATTTTGGACACA ATATAGTTCTTGAACCTAAACCCAAAATGGTTTAGAATTTTTTCATACGA CTTCGAGTGTACCCTCATCGATGTGTGAGGTAGCCAAATGCAAGGCAAGG CAAGGCAGGGCAAATAATACGCGATATTTTCGGCCTCTCCAGCGGGAGAG GAGAGGAGTGGAGCCGCCTGAACTGTGAACCCTGAACCCAGAACCCAGAA CCCTGTCCCTCGACCCCGCAGAAGTGTGAATGTTTGTAGTGCCCACGCCG AATGGTTGAGTGGGGCTCTTTGGTCTGTTTGCTGGGACAAAGGCAGTGGC AAGTGCTCGCCGGACAGCCCATTGAATCCTTTGGAGTCCTGTGAAGTGGG GGAGTCGAGCAGCAGGCAGGCTGAGAGGGCGGAACTCTGGAGAGCCCTGG GCAATGGGAGCATTGGACACATTGCATCGAGAGTTCGTGGCATATCGATT ACGTAGAGGGTGAGGATATAGTTAACAGTTGATATTTCTAAGTGCAAGGC TTGAGTGGAACAAGGACCAGGACATATGTATGCTGTGTTTGAGGATTATG AATGAAGACATTACATGGGAATATATATTCGATAATTACAATCTATTGAC ATGTTAAAGGCTATCAGAGAACTGTGAAGATTTGGCATTGTTTCTCCACA GTTGGTACATGATAAACAATTTTGAATCACGAATATTATAACTGATAGAT TCCTTAACAGAATTTACTTCCAACCTTTTATAGACCTCTTATATTAGGAG AGTGACGTTCGATGTTCGAACCGATGTTTTATAAAAAAATGTTTTTTTTT GGTTCCAAAAATATTATTTAAAATGACTTAAATTAAATCCTTAATCAAAT TTCTAATCAAACATTTTCCACTTTAGCCAGGCCAGCAACGTAGTTCTTTG CTGGGCAACCAGCGACTGCGTGCTCGAAGAAAACCTCCAAGAAGTTGCCC CCCTTTTGGGAGCTCCAAGTTTTCCTTTGCGTCGACGCGACGCTGCCCTT AGCGATTCCGTTTGACCACAACAAACCGAGCACGCAAGTTGAGCCAATTC CTTAAGAGAAAGCTGACGTGACTGCTTTAGGAGCAGGACAAGCAACAGTA CCAACACCAGGACAATGTCCAACGAAGAGAACGACGACTATATGGCCAGC TTGAGTCAGGCCCAGACCGGCGAGGATGAGGTCGATGGCGGTGGAGAGGC AGCTGGCAGTAACGACTCCGTTCTGGGCGGCCAAACAATGCCACAAATTA GTCCGAACGCACCGCTCGAGGGAAACGTTTCGCCGCCACCGACGCAGCCC CATTTGGATGATAATCTGCACAACGGGAACGGGAACGGGAACGGCATCCA CAGCAGCAGCAGCAACATTAACAAGCACGGCAGCAACATCAACGGCAACA ACGATAGCAACCGCAGCAGTCCTGCGAAGAGTCCCAAGCGCCCAGTGTCC TCCAGCTTCCGGATTCAGAACACCAGCCGGTACGATAATGATGAGGAGGA CTTAGCAGCCAGCGAGCAGGTGGCTGGTGGAGATCGCCAGGTGCCGGATT ATTGGCAGCAACGGAACGGTGCGACCACTGGTGCAACCAGTGGGCGGCAG AGTCGCGCCATTAGTCCCGGGTATCTGGACAACATGAGCGAGAACTCGGA GCAGCCGCCAGTGGTGCCGCTGGTGCGATCTAAATCCCGTCCAGAAATTT CAAGTGCAGCGGCATCGCGATATAATAATCTCTCCTATTGGAAGGCACGC CGTGTGGTGTTCTACCGGAATGGGGATCCATTCTTTCCGGGTGTGGAGCT GCGCTATCGTCCCGGACGGGATGTAACCTCACTGGACAATCTTCTCGATA AGATCTCGCCCAAGATGGACTTGCCACGGGGTGCTCGATATGTGTTCTCC ATGGACGGAGATCGAAAATATCATCTCGATGAACTGGAGGATGGAGCCTT CTATGTCGTATCCTCGTTCAAGGCCTTCAAGGTTAGTACCAGATTATTTG CATGCATTTCTGCTTTCAGCTCAGCTAAGTTTTTCATTATTTTGAAGTTT AAGTGAGAGTTTTCACGTCAGGCGCAAAATCAATATAAATTTGAATATTT TGGTATAATTTTAGTTAGTGTGCCGGTTGTGTGTGTAAGTGTGCATAACA TACATAAAACTATATACGAGGTTTTGGCGTTTTTTTGCGGTCAGCGCTGT GGAGTGAGAAAACTTGGTCACTTGGCCTAAAAATCAAAGGCGTCGCTTTC CTTTCGGCTTCTTTGTTTTGCTCCCTCTTCTTCGGAAAAGCGGGTCCTTG CGGGGGAAATGGGTGAAGTGAGCGGGTGGGTGGTTAGTTGTTCGGTGGGG CCACATTTTTGCATGCAAGCACTTTCGTTTTCTCTCGCTCTCATTCACAT ACACATTCGCATTCACTCACTCTCGCTGTTGTGGGAGTCTAGCCCTAGAA ACAATGCCAACAATTAGCACGCCTTTTGGCCTGCCACGAGGGCAAGTTGG GAATTAGGTCTTAGCCTTTATGGTCGACTGAGAGTGGGCTAACTTGAGAG TTGGGACGGCTAAGAGAACAGTGGTTCTTAAGAGTAGCTCAGTTGAGCAA AAAAGGATAAGGACATTAACTCTTTAGGCCGAAATGGTCAGCTGGCAGTT TATCGATAAGTTCCATCAATATACTGAAAGCGGTGGATGGAATCGAATTA AAAGTAACAGATTTAACGATAACTTTTCATCCAAAAGTTCGAGGGAGAAA ATTATTTCTTTTATTTACATAGTACATTAATTTCTTGATTCTATAAAACA AGTTAATTATATTAATGTAAAAAGACTTAAGTATAAGAAACAAGGGGATA AAGTCATAAAAACATTGTATGAAATTCGAAAAACCATTTCGTCACCCAAG GACATTTTTTTAGGCAACCCATTTGAAGGGTTGACTTTCGCATAAATTTC AATCAGATACTCGCCAAACAGTTGGCTTAAAAGTCTTCTCTTTTTACATC TGGCCGAGGCAGTTGGCCAAAAACAAAAAAAAATCCACACAAATCGCAGA CATCATGCGGGTGCAGCAATCAAGCGTCCGCACATCCAACATGTTCCGGA ACAACTATTGAAAAAGTTTCCACCTTCCGTTTGACAAACGTTGTGGGTGG CTGATGATGATAAGGCTGAGTGGGAGTGGCTTTGGGAGTTGGGGTGTTTT TGTGGGATTGGCTGGAGAGGCTGCGGCAAACCATAATCGCTAACGACCAA GTCAAAAGCCATCCCCGACTATGCGTCTAATGCAGTCGAAGCGTGAGCCA AAGTCAGGATGTGCCAGTGCCCAAGACAAAGAAAAAAGGCAGCCATTCCA TCCCGCCAGGATACCCAAGACCCCACACCCGCCATCCACCAGGTTGGGGC TTCTCCTCCGGGCTCCACTACGGGACACCAAGTACCGACTGCGACTCCGG CCTCAACTTCAGCTGCAACTCGCTACGGCAAAGGCAATTGCGCCTGGCCC GCGGCTAGCAAACAAAAGCGCAGCATGGAGCATGCAGAGTGCACTTGCGA AAATACTTCAACCAAGGATATTTTTTTTTTCGGTCAAGATTGACAGAACT CATACATATATATTCGGATTTTTTGTTCTTGGTAGAACATGAGAGAAGTG TCGAAATATTTGAATTTTTTGTTTTTTCTTTTCCTCAAAGATCTTCGGCA ACAGTTTAATCTTATTCTGAGCGTTTAATAAAATAGTGTCATTTCATTTT TTAACTACTGCGCTTGAAATATTGTATTTAAAGTACTGAGTATGTAACCT GATTTTGCAACATTAAAAAACTTTTGAAAAAATCACCGACATAAAATGAT TGAACTGAGAGTTTGCGGTTTTCACCAAAAAATATGGTCAATAAAAACCC AAGGCCAAAATAAACCGCAATTCGCGGTTTTGTTCAATTTATTTCTGAAA ATTGACTATTTATGAAGAATAACTATAACTTGATGTAGCTGTGGTCAAGA ATGGTATACATTTAAAGTGAAAATATAAAAAAAATTCCATTATTGCTAAT TTAAAATTTGAATGCGATTGGTAAAGAAACTTTAACCGTTAAGCCGAAAA AATTGTGTCAAAATCATAGAGTTATTTTGGCCGTAAAGTACAAAGGTTTA GTAAGTTAGCCAAAAATGTATTTGTGATGAATGGCTCAGTTAAGTATTTA TCCAGTATGTATCCAAAATCTCAGAATTTTCAGAAAATTTTATCCGGGAA TTGAAAATGTACTTGTTCCTGATACTAATTTTGGTGTGCAGAACAGGAAT CTTCGATGAAAGATGTTTAGCCCTACAAATTCCCAATGAAATAAGAAAAG TACCCATTTTTTCTCTATGTATAGGGCTTCGCTCCATTCGCTGCACCGCC TGAAATCAAAACTTATGATGAGCCAGCGGCGCTCTCTTCGGCAACCAAAG GGGATCCGTTGTGTGGGGTCGTGGGCTCCAGCTCCACGCCGTGGCACAAA AGGCCACAAAGAACAATGGAGCTGCGGGCACATATATACTCATCAGATGG GAAAATGCATAGAAAATCAGCCGGCACTTCGGGCGCTCTCACGCGAAAAA GGCCAATTTGAAAACTTGTGGCGTTTCACTTAGGGAAATTAAAAATGTAT GCAAAGTACTACGCCGAACGGGAGGGGCCAAGAAATCGGGCCAGAGCAGG CGCAAAGTGCATTTTGGCCTGGCTAATAATATAAATTCATTTTGCGGCCG AGCCGAGCGGACGAAAACTGTTTACAAAATCATTTATGATAATTTATTCA ACCGGGCATGCGTGACGACACTCACGCCGACACGCGAAATTTGAATGATT TTGGGTGCAGCAAATTGCATTAACCTTGTCAAAAGCTTGCCCCGCCAAAT AATTGCTGTGTTGTGCGCCAAAAGAACCCGGAGTGGGTGGCTTGTGCACA CAGTTTGTAATCAAAATTTAAATTTCTAACCATCCAGAGAAGGTCGAAGG CCCAACAGTGGGTTGAGACAGAGGAATTTTCAGACAATGAAAAGGAAACG TCGTTTTTGGTTGTTCCAAGGAGCCGAGGGAAAATAATGGGGAAGGGATT AACGAGCATTAATGGAATTTGTTAGCTTTCTCTGAAAGGAATTCAAGTTG CTGTCGCCTTAACAATTTTTCATTTCCATATTCTTAATTTGTTTATGGTA TACATCTTCTTGGTAAAGAGGATGGAAAATAATCTCAAAGTAAATTTAAT AAAACCAAAGGAATGTAAAATGCAAAACAGAACCCTTTTGTAATATATTT TTTGGCCGTTATTTTAGCCTTGGGCCGCATAAGGATATTTCATTTAATGC TAAAGTCCTCAATCGGTTAATGTATAAATCCATAAATGCTAAACACACTA AAAATTGAACTATTTTACCCTTTAACACATGATATAAATAGTATCGGCTC TGACCCCATAAAAATTCAATTTAAAAGCTGACCAACTTTCAGTAGAATTA AGAATGTGTCATGCCATAAAAATATTACAAAATGTTTGGTTTCAAGAAAA TGAAGAAATGATTTAATACCGCCCTGCATTTTGTATTTTATTTAATTTAT TTTGTTCTTCTGCCACCACACCTTCGAATGCAGTTGCAATGTCATTTACA AGCTTTTCTCTTTTTTCGACCGCAATATGAAATTCCATTTGAATTCTCCT TGCTGGCCAATTTAGCGGTGAAATTAGATATATATCGTGCAATTTAGCAA CTAGCCCAGAGACCAGAATTCTGCTGACCGATAATGCCACTGTGCCATAA ATACGCCTTAAAGGTGCAGCACGCCAATTATGAATGATGGTCAGGACTTT CCTTTGCTTTCCTTTTCCTGCTGCACCCCAAAACCCGGTTGGCCAAGAAA AATGGACACGCAGAGCCGCAAAGAAATTAAGATTTTTGGCACAAACGTGA GCGGCATGCCAAGAGAACAAAAGCCAAAATGCGGGGCATGCAGCACGCAA GGTCAGCGCCATTGTAATTAACTGCATATAAAGTGGGCAGTGGGTGGTAA TCGGCAGTGGTAACGGGCGAAAGGCGAATGGAGAGCGACCAGATTTCACG TCAATTATTTTTTTTTTTTTTTGCCTGCCAAGGCGGCCAACTTATGACCA AACAAGCTGCAGTGACATGTGAACAAGATTAAACCCCACAAACCACCGTC TCGTCTGCGTTATTTTCCAGGTTTTCCGCCCTCATCGCTTTTCCACACCG CAGAAAGCCAAAAACTTCGGAACTTGCCTTTGGGCTATAAAGCGTTTGAT AAATTTCGCTGCCATTTACGTGTTGCACGCGCCAGGGATGTGAAATGTGG ATGAACCAGCTGGCGAGCGATGGCGATGGCGATGGTGTGGGCTCAGATAG TTGACTATGGCTAACAGGTGGGGTATGGACTGTTGGTGGTGGTGGTGGTA AAGACGAGGTGAAAGGGGGTTAAATGGCGATGAGGGGCCGGGACAACTGT GTCCGTTGACTGCACCTGACGACATAAATTGCGCATTTGCGTGGTCGTGA TCCTTTTCACTTACAGCGCCACGACAAAATCTCGGTTGCCTCCAGAGCTG CCTTTTGCCCCTCCCAACCCTTTAGCTCTGCACCCTACCCCTCCATTCAC TTCGAAAATTTAACAAAAGGTGCAAGCCAACCGGGCGTATGAGTAATGCG CGTTTGTGTGTGTACAACGCGTCTGCTTCACAATTACAAGAGGATTTTAT ACTCAATACCCACTGAACGAGCGGTGAGCAGGGGAATATAAATTTGGAAA ATAATGTACTTATAATTATTTTGAGAATACGGATATTCATACTCAAAAAA AGGCAACAAGCCAGATTTATCTTATTTATTGATTAATTTATAGGGAAGTA TATAACTCAATAGTTTTAAACGTGGCTATTTATTTTAATTATACAATAAT ATAAAAATATATATATATTTCATAAATTCGTTGCTAAATATATTGAAAAC TGTACAGAACTTCAAAGAATATTTATGAGTATATATAATTAATAGAAATC CATTAAACTTTTATATAAGAAAAAATTTCCTGATCACTCCACAGTTCGAA ACTCCGTAACTTTTCCAGCTCCTTTGCTGCTGCTGCAATGATTTTTTAAT TGCTCGACACAAATATAAACACAGACTGGCCATTTTTTGTTGTTTTCTGC TGTCCAGCATTGTTGACCGCTGCTGACTCTTCTCGGCAGGATCTACTGGT GCCATTGTGGGCTCATTTTAATGATTTTCTGACTACGTCATCAGAGCCAT GCTTGATTTACATTTTTGAGTTGTCCGCCGGTGCAGCATTACGGCTACTG ATTGCATTGACAGTTGGCACACGTAGCTGCTGCAGCATCAGGATATTCAG GGGATTCACATCGAGATTCTGGAGTGGCAGAAGGATGGTGGGGAGTTTCC AGGCGAAATGCCATGGATTTTTACCGTTTAATTGCCGCCTTTCATCGCAT TCTTAATTTGTTGTTCGCTGCCATTTTTTTGTCCTTTTGCACTTTTTCAT TTAAATTTGTTTGCCAATCAGGTCGTATGAAAAGGTCCGAAATAATTGCT CCATTCTGCGGATAGATTCGATTATTGAAAAATTACATTACTACTTGTAT AATTAAATGGCTTTCAGGCCGGGAACAATAACAAACAATTTGTATCACGC CTTCGAATCTAATTGGAGTCAAGTTCGAATTGAGTCGCCAAATTGTTGAA CAATATGCGTGCTCGATTGAGAACATGTATTACGTGTATGTGTTTAATTT GGTCGCACATAATGAAGATGCAGCAGGCTGAAATGTTGTCTATACGACAG AGGGAGGTTTTTGCAGTTTATTCCAGAAACCAACAAAAAACTTGGACTTT TTGTTAAAGATATATATTATTTTAAAAAATATATAATATAATATACATAT ATAATATGTATATAATATATATTATGTAAACTATTAGGCTTGTAAAGATA TAACGTATATTTTTGGCTTAACGATTATTTTAAGGACTTTTACATTTTTA AAGTAAAAGTGATATTACACACGTAATTAAGCTCTACTGCCCTTTATTTT TTCGTGATAATAAACTGCCCTTGTTATTTTATACAATATTTTGGTCTCCG ATATGAATTTCCATATAACTGACTTATTGCAAACGATAATCAGCATCAAT CCGTATTATTCGACAACATTTATTCCTTAAGAATCCTTGATCAACCCTCT GTAGTCATAATTATGTGTTTACATATGTATGGACATATGTATGGGCTCGA ACGCGTCTATAGCCTTAAGGCGTTTTGCAATTATGGCAAAAGCTACAGCA ACAGCAGTAGCAACAACCATGGAAACTTGGGCGGGGAGCCAAGAGATTTT GCTTACGAAGACGCCTATTAATATTACGCTCTCGCCGTGTTGCAGGCGCA TTGGCTTGGAAAATGTGACCCAGACCGCCATTGTTGTTGGACTGCTATAG TTTTCCTTCGGGCAGGACTAACAATTAGGAGCATCCAGATGCCTCGACGC AATTGGGGCTGGGATTTCGTAAGGGCATTAATAAAGCACTTTAATAAATT AGTCCAACCGAAGCACTTAAGCGTCTTATCAAATCAGAGCAGTTGCATGC CGTGGCTTAACGCACACATTTGCACGAGTGCGGTGCATAAATATGTGAAT ATTCATATATATGTTTACCCGATCCTCATTGTGGTTGACATTTAAATGGC TCATTGTTGTAGTTTGCGGCCATTGAAATTGCACTAGCAATACGGGAGGC GGGTTGCGGGTGTCGGGACAGCAGCGACCGCATGTGCGAGTTCCTATGAA AATATGTAGGTGTTGAAATCGAAAAACAGCTCCGGACAATAATAACAATT ATTGAAAACAATGAAACACAAATGAAAAACAATATTACCAGCCAGCCATC CTACTGCCCGCAAACATCCATGCCCATAAATGGCCTACGGTGGGTTATTT TCGCCATTGAGTTATTAAATGTGCCTGTCATGTGCTAGTAAAAAAAAGGA GCCTCTAAAATAAAATAAAAGTTTAATAGTCGTTTGGTGTTCCTCTCCAT TTTGATGGGTTAAATAATATGTATGATTTCATTTGGAGCATTTCAACTAT TTCGTGCAATTTTAGTTAGCACCAAAACAATATCAGACGAATAAATATGT TTTGGAGATTATTTTGAATAACAGATTTAAATTATAACATAATTTCTACA CATACTGAAAATATAATGCCATAGCTTTATTACTGGCAATTTCCCTCATT GTCCCACAATCAGGCATTAAGCAACCCACACACTCGCAATAAAAGGACAT GCCGTGAGCTCTTGTCCTGCCACTCGCCCACAAGCAGAAAGGACGTGCTG GACCAATACAGAGGCACTCGCTGGATTTTTCTGTATAAACATGACAATTT AAAACGCATTACAGTGCGGCAATTAATTAAACTGTCATTGGTTTGCAAGA TTCTGAATCGTTTCGCCGCGCCACAGAGTCAAAATAAATTGTATACAAAA AGCGCGCACAGGAGAACACAAATATTGCATTAAAAGCCAGGGGAATGGAG AAGGTTCGCCGGGTTGACTGGCAACAGTAAAGCATTGCGTAAATTTATTG AATTGTAAAAAGAACATATATCAGCGTTTTTAATTGCAACGCCAGCAACA ACAAGGAGCCGGCGTGTTGAATAAATAGCCGAGGACAGTTTAAACTGTTG AAATTGGAAGGTTTCCGAGTGCCAGTAACGGTGGAGAAACTATAAAAGTT TATCGAGTAGGCTACATAAAAAGGGTTGAACTTATTTGCTTACCCCTTTT ACGAGAGGGAAATTAGAATTGGCCATTTAAATCATCGAAGATACTCGCTC TTTTCCTCATTTGACCCTTATTGAAACAGCCGCAGAAGTAATCCACTTTA ACGAGTCCATAAATGGTAAACGACTGTTGTTTTGTTTTCAATGAGCTGTA ATAATTTCACTCGTTTTTACTACTTCCCGTGTCCATAAAACAAAATTAAA ATATATTAACTTAATCAAAAGAAGAGCGAGTCGCAGAACTTTTTGGCTGC TCGGAAGCCAATTTATGCTGGTCCAGAGCACAAGTTGCCAAGAACGGAAA GCCGCAAACTCCGAGAAAAACTTAGACCAGAGCCAAATGACAGTAATTAG AATTTGTTGGAATTTTTTTTTTTGGTTATTTGGCTATTTGTTTATTCGCT CTACGTTTGGCAACACGGACTCGGCTGTTGCCAAAAAAGCAAGTGGCCAA CTGGCAGCAACTGTAATAAATGACAACAAATTCCTCGCAGCCAGGGAAGT CGTCTAAACGTTTTTTCCCCGAAAGGCATAAAGGAATAAATAAATTATTT ACACTCGTACACCCACATCTTTTTGAATTTTCCGGAGTTACGAATGCAGC CCACTGGATATAATATTTTCATAATTTTGTGACTGACGTCACTCGACTTT AAACTATGCAAAACAACTCAATCCATCGGACCGTGGTGCTGTAAAGCACT CGGCCAACATTCCTGTCGCCCTCAAAGCGCACAGAGCAATAAAACACAGG CCTCCAGAAAGGGGTGTGGGCTGGAAAAGCTGGAAAAGCGGCTGGGGAAT GTCTTCAGCTCGAATTGATGGCGCTGACTACGAAATCGACTTGTGTGTGC CATATTGTGAGTGAGTGTGCTGGTGTTGTCTGTCCGTTGTTCCGCTAATG GTGAAAGTTGTCAAGCGGCTCAAGTGGTAAAGTGGAAGTACCAGGATAGT GGTTACGGTGGGCTGCGGCGTTATGGGTTCCGGGTTGAGGGGCAAACTTC CGTTGTTTTTCCCTCAGACAACAACTTTCACTTGAGAGAGCTGGCCCGCA GCACAAGGGAACTAAATGGTAGTTGGTCCGATAAAAAACACACCAAATCG GTATTACTCGGCCACCTTTTATACCATACTTTTTGGGGTACTCAATCATT GGATAAAAACGGCTTCTTTAAAGTGAAAAATATTTAATTAATACGAAGCT CTGTATTAATAATAACCAACTGTGGATGTGAATTAATTGCATTAGAGGTT ATCGAGATTGCTTTTAAACGAGGGAAATAATCTTTTTTTTCGTAATGTCA TAATTATTCTCTTTTCCGTTAGCTTTTTTAACGTAGAAAAACCAAATGTA ATGTTGTTAAAAATCTTTATTGAGAGCATGTAATTCATTAAAATTACAAA CATTAAATCATCTGTTGTTTTTGCAGTGCTATTAAATGAACATAGGAAAT GTAATATGTTTAAAAATCCTCCTCCATGTTTACGATTTTTTCTTTTTGAT TTATCTCATTGGTGATTAAACAGAATAACAATAGCTCAATGTTTTGAAAG AGAGTTAAAATATGATATTCCAAGTTTTTAATGAAATAACTCTTTTTAAA ATATTATGCTGATACAAACATAAAATAATATAAGCAAAGTGCGTGGTTTT TGATAATCCTTCCATTATTTCCGAATGAAAACTTTCTCGTTTAACTGCGT TATTTTCCACCTTCGCTTAAATAAGCAAAAAGTGTTTTCCACCCATTGTG TGTGGCACACGTCGTCAAACATATTGAAAACTTTTTAGAATTTGCAAACA GTTGTCCCGCGCTGCCAACCGCAGTGTGTTCCCTTCGATGCAGTGAAATC AATTTACAGAAACTATAGAAATGTACTTTATAATGTAATTTACACGAAAT ATAAAATGGAAATGAAAAATCAGTTAGCATTTTTGTTTGTCTACCCATAT TGCTTCATGAAATATGAATTTTGAAGCTTTTACTTCAGGTGTTACATTGG AAATTGTATCATAAAAAAACTCATTCAAATGATAAACAAAGATTAGCCTG AAAATAAGATCATTTAAAATTCGTGGGGTATTTTTTTAAGTGTAAGAAGA AGAAGTGGCTAGACGAAGAGGACGAGCCCGCTGGTCACGTCCTCGTCGTT GATGTCGTCTGAAACTTATGAGTTTTGAAATGAAAACTGGTACAAACGGA AATGCAATTGAAACGTCGCCATTGTTGTTGTCCTGTTGTTGTTGTAACTG TTTGTTGGGGTTCCTGGCGGTGGTGTTATTCTTGTTGTTGTTGCTGTTGT CGTTGTTGATGGCCTGACAAGTTGAGAGAGTGTAAGTGAGTCTTTGTGAA AAGCGCCTGTGTGAGTGAGTGACGGTCGTATGAAGTTTTTGCGCTAAGCT ATTTGAAAATGCCATTAGACCATGTCACACATACAGGCGCAATGTGACAA GACGCTGCTGCTTCTTCCTTCTACGTCAGCCATCTCCTTGCCCCTCTCTC CAGCGATTTTCCTTCGCTTCCCCTGGATTTTCCGACCCCCTTGGCTTATG TTTATGTATGCGGTGCAATATTTTGCGTCATATTGTTTGCTGTGGCCTGC GGTTTGGAAAACGCGCCTGACCAAACTTTTCAGCACGACTGTAGGCACAG TTTGGTGTCTAGCAGCGACTAATGCGGTTACATGGAAAACTCTCCGGCCA AAGGACCTCTTTTGAAAGGACTCTGCCCACGCGCCCGAAATCGTTCAGCC AGCGATTTAATTTCCGAAAATATTTCCTTGACTCGACGGCTGACGCAGTT GTGCAAATTCATATTTAACATTTGTTGTGCAAGTGACATTAATTATATCA ACTGTGATAAATGCTTTTTTATACGGACGTATTATTCAAATTACGCCCAA AAATAAATATAGCATAAATAAGCGTCGAGAAAACCTTGGCGCATAAATCA AAGGCGCAAATTGTCACGTGCTCTAAATTCATTTGTTTCCAAATCCGAGT CAAGGCGTGTGGTGGTATAACCAAAAAAAAAAATATATATATTGTCCAAA ACTAGGCTAAGTAGTCCGAGTGAGAGTGTGGTGGTATACGCCTTTGTATG CGTGTGCGTGTCGGTGTAATTGGCATTGTAAGTGTAATCGCAATCAACAT CGATGTACGCCGAATCGACCACAACGGAGATGACCGCTTATCCGCAGAGG GAGCCGCCGGAGAAGGCGACCCTACGTGATTTCTGGGCCAAGGAATCGGC TGTGAATGCATTCCTGCAGACCTCACATGTAAATATACACTTCGAATCAC TTCCCTCTCATGTCGATTGTTGATCGAGGCGAAACTTATGCGAGTGGAAG TAGGAATTTCGGGGTGGGCACACTATTATACTGCGTAATCAAAAGTGTCA ACATTTTCTCTTGGCTACCCCAAAAGCAATCTTAAACCAAATGGCGTACA CTCACTCCAATCAATACACCGATCAGCAAAGTAGAGAAAGAATGAAGTTA AGACAATGCAAGTACTTTTCAGGCATTTAAAAATTGATTTTTAATCATTA TGGTACTTGTTATCATACCCAAACGAAATTTCGTAATATTTTATTTTTTA CACCATTTTATAGATTAACTTAGACGCATCCAGTTACTTAGTTATTACAA TTCAATACAATTTGAATGTGTCAATGGTAGAAAAATATATTATATTATAA CTATACTTCGCTTTTTGAATTTTAAGGGTAGGCCAAAAAACGTTGTTAAC AAGTGCCTGCGAAACGATTGCAAATTTCTTGCCATAGCTTCTGTCAGAGT GTCTCTGCTGTGGCACTTCTCTTGCATTTTAAGTGCACTGATTAAGTGCA TAAGTGATTTAAATGCTGGGGGAATTTTCATCTAAAGTCATAAATTGAAT ATGTTTCAACTTTCGGCTTTTGCATGGGATTCAGTTACACTTTCGCATGG AACGGGGACCACTTGCCTTTGTTGCCCAGCTGGGCGTGGCTGGAATTGCT TAAAATTCTGCTGGCGCACTCAAAAACTTTTTAGTTATAATTTATCAGAT TTTCGAGCTCAGACATTTTACAACAATTATGCATAGTTATGCGCATTGCC ACAGATAGTTTCCTTTTCCCATTTCGATTGCACGTGTGTAAGTGTGTTTG AGTGCGTATACGTAATAACTAAAGAGAAGGCCATCACAGTTCACAGTTTT ACAGATTCTATGTGCATTTGCCATTGACTGGCAGCATTTTAGTTTCAAGA TTGCGCAAATGATTTTGTGGCATACGAATGCATTCAAGAAATCCGCATTT TTATGCTCTGTGAATTGACAAGTTCCGCTTACATCATGCGCCAGGTGATC CGATCCTGTGAGCAACAGGAGACCTCTGTACGATTCGGTTAACAAATTTG CATTTACAACTTTTGCCAGCTAATAAAAATTTCATATTCATCTTATGCCC AAGCCGAAAGCTGACAATGAAACTGAAGCCGAAAAGAGGCGAAACGGAAA CGGAACGGGGAAAACGGAAGTCAAATAATTCCGACACGTATGTCCACGCC ACTTTGAAGGAGTGGAGCGCATACAAAACGAAAGAAAGAAATATGACTCC GTACGGAATATTTATGCGAGAGCTCCTCCACACACACTCATACGGATATA CACACCCCCTCCTTATATGCCACACAGATACACACGCACACTGTGACACA TTTCCAAGGCAAAATATTCGAAACTTTGCATATGCATGATGGTGGCGGGG GTGGAGTAGGATGGCAAGGGATCGGTGCCATAGTGTGGCGTATTACATTT GTAAAATCTGGCACACGAATGCAATAAATCACAACACAGCACAAAATACC CCACCAATACCACCGCATCATCACACAGACACACACACAGATACGCATGC ATACAATGGCATTATTATTAGTAATGCAGCCTGCTCTCAGAACCTAAGAA CTCGGGGAAATTATTAGGGTCACATGTGTAAAAGGATATTTCCTTATTAA CTCACACACACGCTGGCATTAAATGAAATATGCTGCTGGCATTCTGCCCG GCACAAAATTATTATTATGGCGTCAAATAATGAGGCAAAAAGTGTCAAAT TTGCATGCGAAATATGTCTAGATGGCATTTACAATATTCCATCTCTGTAT ATTATTTTCGATGCCGTGCAATTGCTCCAAATTAATTGCATGGCATGTGG TGTTGCAAAAATGGCACGTCAAACCAAACGAAGCTCCCAAAATGCACAAG GACAAGCGGTCCTCGCACAGTAAAGATTGCTGTTTAGCGAAAGTGCTAAA AATTTAATTTTAAGATTTCTTATAAGGAGCCTAAAAGTGCATTAAGATTA TTTTGAATTTAGATAGATAATTTTTTTTTATATTTTAGATAAAATAAACA AATTGAAATAACTGAACAACTCCTTATAACGAGCCGTTGAGTAAAATTCA ATTATTTAATTATTCAAACCATAATAATAATTTAAATAAAACTTTATGTT TTATTACTTTATTATTTATTATTATTTATTATCAATATTGACTTATTAAT AAGGAATTTAATAAAGAACTAAAGAATTTTTGCAGAAAACAAAAAGTAAA GCCCAAATTTTTAATTAGAAGTAGAATAACTACAAAGGGTTTCCCAGAAT CTTACGTGGAATTTCCGATTTCAGACAGCTCTAATTTGTAAATGCGGTTG TATCCGTGCATGCTAATCTAACTTGACTGTCTGCATTTCACACTCAGACC AATTCCCGATTCCAAACCGTGGCAGTCAGAGCAAACTCTATGGGCTCGCA CATAAAACTCAAACTAAGTAGGGTATAAATATTTGCAATGCAAAATGCTG ACTCGACCTAAACGAATGAGATGGGCTGAATGCGTAAGAAGGAGTCGGAA AAGGACGAAGGACCCCTGAGAGTTGTGAAATCTAGTAGGTGGATGGATGG ATGAGAGGGTACCAATAGGCACTAGTGAGGGTTTCTGGCACTGCACACTC GTGCAGGGCACATGCAACGGGGAACTGCCACTCACACATACATACCGCAG ACAGATACACGCGCACGCACACCATGACAATGGCATAATATATTGGTGTC TAAAGCAGACAGGACGAAATGGCCGACTTGAGCAGAAGTGGGAGTAGTGT GGCGAGCCAGCTTGGCAGCACTTTCCAGATGCACTGCACTGG