##gff-version 3 ##date Tue Nov 28 12:01:27 CET 2023 ## exported from the transgeneomics system molecule_59058579 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59058579 mpicbg region 9631 30864 . + . Name=dmel-5.43-X;type=genome;start=1084411;end=1105644;strand=+ molecule_59058579 mpicbg region 30865 31819 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2436;strand=+ molecule_59058579 mpicbg region 31820 31926 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3813;end=3919;strand=+ molecule_59058579 mpicbg region 31927 42161 . + . Name=dmel-5.43-X;type=genome;start=1105645;end=1115879;strand=+ molecule_59058579 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59058579 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59058579 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59058579 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59058579 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59058579 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59058579 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59058579 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59058579 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59058579 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59058579 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59058579 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59058579 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59058579 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59058579 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59058579 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59058579 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59058579 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59058579 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59058579 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59058579 coding_transcript gene 10664 15925 . + . identifier=FBgn0040359;alias=EG:BACR42I17.7;ensembl=FBgn0040359;Name=CG11380;id=50385750 molecule_59058579 coding_transcript gene 18871 22174 . + . ensembl=FBgn0040358;Name=CG14625;id=50385724;identifier=FBgn0040358;alias=EG:BACR42I17.8 molecule_59058579 coding_transcript gene 23032 24688 . + . id=50823106;identifier=FBgn0029568;ensembl=FBgn0029568;Name=CG11381 molecule_59058579 coding_transcript gene 26022 26714 . + . alias=BACR42I17.9;id=50949524;identifier=FBgn0040357;alias=EG:BACR42I17.9;Name=CG14624;ensembl=FBgn0040357 molecule_59058579 coding_transcript gene 29350 32028 . + . ensembl=FBgn0040367;Name=CG11382;identifier=FBgn0040367;id=51341710;alias=EG:BACR42I17.10 molecule_59058579 coding_transcript mrna 29350 32028 . + . parent=51341710;id=51341716;Name=FBtr0070205 molecule_59058579 coding_transcript exon 29350 32028 . + . parent=51341716 molecule_59058579 coding_transcript cds 29350 31929 . + . parent=51341716 molecule_59058579 CLC cds 30865 30924 . + . Name=2xTY1 molecule_59058579 CLC cds 30931 31647 . + . Name=SGFP molecule_59058579 CLC cds 31654 31695 . + . Name=V5 molecule_59058579 CLC cds 31696 31719 . + . Name=Precision cut site molecule_59058579 CLC cds 31720 31740 . + . Name=TEV molecule_59058579 CLC cds 31741 31812 . + . Name=BLRP molecule_59058579 CLC misc_recomb 31820 31853 . + . Name=FRT molecule_59058579 coding_transcript three_prime_utr 31930 32028 . + . parent=51341716 molecule_59058579 coding_transcript gene 33835 35503 . - . identifier=FBgn0040366;Name=CG11398;alias=EG:BACR42I17.11;id=50927226;ensembl=FBgn0040366 ##FASTA >molecule_59058579 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACTATGCCATTTCTCCTTTGGC GCTGGGCAAAGCCAAAAGCGAAAAGCCACTCCAAATCCCAGGCCAAGCCC AAGCGAAAACAACTTAATGCGCCAATTAAAGTGCCACTACTCGCGGACCT CCGGCACTCTCTTTTTTTCCCATCTGGATGGGATGCTCTGCAATTGTTTT CATGCAAATTTCAGTTTCTGTTTCGATTGGTTTGTGGCTTTATGCGGGCC AGCGGAATACAGAAATAATAATAATAATGAACCCAAAACGTATTCACCCG AAATGAAAGGCCCCGGAATCGGTCTTTTGAGTCCAGGCCTTTGTCATAAG CCAAAGTTACGCCAATATTTTTATGGCTTTGAACTTGAACTGGAAAAGCC AAGACAAAAGCGTCGCCGTTTTGTCCCCAAAGAAATTGGAAAGGTTTCCC AGTTCCCTCCATATCTGGTTATCTACTATACAATCATATATATAAATATA TATATATATGGCCCTTTGTGAAAGATTGCTCTCCCATGGCGAATCAAGGT CGATCATCTATGATTCTCAGCACGGGAAGCTCCATGCCTAGATGGCAATG GAAACTATTCAATGAACAAAGTGGGCAGGAATATTTAAACGGGCACATCT GTAACATCTCCCCTACTCGTATTCCAGTGCCTCAAACTACATCTTCCCAA TTCCGCAACTTTTTTTTCTCCGCATTTTATCTCTCTGTATCTGACCAGCA TCTAAAGTACTCCAGCACTTTGTTTACAGTTGCGGCAATCCCAGGCAACC TACACCTTCAGTCACACACAGCTACGTGCGGTGTCATTGGTGGTGAACTT CGGTCTTCTTTTCCCGATCCCCGGTCCACAATACGCCTTCGCCTTCGCCT TTGGCTTTGGTTTCAGCTTTAGCTTCAGCTTCAGCTTCAGCTTCAAAAAT TCAACTTCAACTCCAACTCCGAAGCCGATATTCCAGCTTGATGCAACCCG AAGACCAAGTTGTTATGCTGTGCTTGCGATATAAAAACCGCGAGCATCGC CAGCGCCATCCGCAGTAAGAGGCGCGACTTTTGAACGCTAGCACCGCTCC GATTCCGATTCCGACTACGAATCTGAGACGAAAATCAAAACCAAATTCGT ATAGACACTATAACCAACATAACTTAAACCCACCAGCCCGGCCGTGTACC CTTGGTATTTTTTGTTTTTGTGGTTCTCGAAGACACAAATGTATTGAAAA GTGCATATATTATTACATATAACATATAACGTCAATATCAAATTCGGATT TTGTGAAAAAGTCGCTGTGCATGCGCATTGATACCTGGAATCGCCATGAG ATTAGCGTTAATATTGGTAAGAGTAGGAGTAAGATTATACAATCTCCTTT AGAAAACCCGGAAAATAGACCCACCCACCAATCGAATTGTGCAATTTGTG CGGGATAAAAACTAGTCGTCGGCTGACAAATTAATTTGCATTCAAGTGGT GCAGTGCTGGCCAAGCCGGCTTAGAAAGTGGTTGCAGTTCAACCAACTCG ACCAGGTGTACGATACAATGAACTCCCAACTCCCGCTGTCTATGGTGTCT CCATATCTCGATAATCTTGACCTTTTCACTCGCTCCACTGACTCCTGCCC TTCGGCTTCTCGGCTATCTGACCCTGCCCTTGCCCACTTTGCCAGTCCGT GTCCAGATCCATCTATCAAGCAGCACGATGGAGGAGTAGTGGGGTTGAGT TGCGTCAATCGCCCACTAATTGGACGCTAAGATGGTAGAATCACAAATCT GGCGATTGCCGAAGTGGCCAGCAGAGATTCGTTTACGCAAATGTGCACAC TGAACGAAATTAAGGGGTGGTAGGTGGTAAAGTGTCTTCACATTGAATCA AGCGGCTATAAATATTTATTTGCATTACTCATAAAAGAAATCATCTTGTG ATATATTAAGTAAGTAAGTTTTGAACCAACGTACTAAAGTACCTAAATGT CAGGCAATAGCGTGTATTTAATTTATAAGGGCACTTTACAACTATGTCAA CAAAGAAGTTCGAACGAGAAGCTTAATTTAACTTTTATTAATATTCGTAC ATATTGTTAGTCTATCCACATATTTGGATGTAGTCTTTTCCTTCGCAGCG CTGGAAAGACTCGTTTTCTGGAGTCGCCACTCGTGTGGTTACATAAAGTT ATTACGCCCCATCCGATGGGGGAGAAGGCGCCGCTCAGCCACTGGCAGGA TAATCTGTAGACGTCTAATTTACATTTTATTGTTGTGCTTGGCTTTGATG TTGCAGCAGCTGCTGTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTGCTG GTGATGCAACAACGAAAGTGAAACAATAACTAACACACCGCAGCACACAA ACTGGGCAAAAATCCAAGTCCGACTAATTTGCACGCGTTGCGTGACGATC GTTTGCCCCGACTTGCCGTTGTTTGTAGCTCGTAATTTGCAATGCGGGAA TGGGAATCTCATCTCTGGCGCAAAATCGCCCACCAACCCGTCCACTCGGT TCGATTCTTTGTGCGGCAAGTGAAAGGCAAGGCGACTTCGGGACTTGATG CAATTAAATTAAATTATTACAGAAAATAATTGGTAAAGATAAATCAATAC GAAGACAGATCTAACTAGTTGCTGCTCTGCTCCTTCTGTATGAGCGGTGG AGGTTACATAAAAGCAGTTCGCTCTTCGGGTCCCACAGCTCATGCTAGCA TTTGACAAAAATCCGCAGCTATTCGCTGTTGCGGCTGACTTGTGGCAAGG CGAGTGTGCCAAAAAAAAAACTCTTCCTGCTTAACGACTAGGCTAAATAA CAACTGCTACATAAGCAACCAGCAGTAAAGAGACGACAACGACTATTAAA ATGACTTGACACACTGTCCTAGTTTCGGGTAACATAACACACACACTCAC TTACTCACTCACTCACTGGATAATCGAGTCACAAAGTGCAATTAAAACTT AACTAACCAAGCGAAGTACGAAATTATTGCTGCACATGGAAAACTGGGAG AGGCGCATGCTGCAATTATGGCATGCAAAGTCAGTAAACTATTTTGCTAC TTGGAGGGCTAATTCGATTTGAACCGTAAATCTGAAATTAAAGAGTAATG ATCAGTAATGACAAGAACCTAGCCTAAACTGGATTAAATGAAACATTATC AGGCTAATAACCCATAATTCGCATGTATCAGTAACAGTTAGCGACCGTAA CCCATAATCGTCACCCAGATAATCATCATTTGATCGATGAAAACCGAACC ATTAGTGTTATCTACCACCATTTGCGAATCAAATGACTGAAGGCACGAAC TGCGGACAAGCGCTAAAATGAAAAGACTCAAGACACGAACTCAAAGACAT CGAGATTCAATTACAACACCAATTCGCCTGACGAAATGTCAAATGTGAAA CCTCTTCTCAGCGTGTGTTGTGCATCGAATGGCTTAACGATCGATATTGA GAGCGATAGATGGACCACAGCTTTTGTCTCCAACTCCCCCTTTGTCACCC TCTATTGTCTTTGCCTCTTACCTTGAGCCCGAACCAAGATTGGCCAAAAC GAAACCAACAATTTTCACAATTTGATTTGAGTTGATTCCGACAACGAACC TAATGTCTTTCCAGCTTTGGAACATTTTTAAATCGTTACAAATTCTTGAA AAGCTAACTTCGATAGACTTCCTGTTTGTTTCAACTCGCAAGCTGGTAGC TAAGCTTTAAATAATATCAAAAAAGCAATTCCTTTAGTTAAATGTATAAG TCCTATAAAATTGATAAACATTTTACCTTGTGTTTGTCTATATTTCACAG GGCACTCTTAGTGCTATAGTGTGCTTGGCCAGCAGCTTGAGCCAGTCAGA GGCGAGTGGCTCAAAGGGCAATGGATTTCCCAAAAAGGTTACCACCCTGA AGAAGCGACCAACAAAAACGCCGACCACAGTTCCGATTTCCATCAGCAGA GCAACCACTTTGAAGCCCAGTAAGCCACGCGTGAAGATCGGCACATCGGC AACCACCAAGAGCCCCACGAAAGCACCGGCCTTAACCGAGACATTTGGCA ATCTGCCGGCGGATGACCTGGAATTCATTAAGGAGCTGGACAAGCAGTTC AAACTGCACGGAAACAAGATCAAGATCAAGGTGGAGAGGGATAATTCCAC GAGTAGCGGCGGCAAGAACAGCAAGAGGACCATCGAGGGGGATTTGGGGT GAGACCATGGATGACAGCATTTTGACTGACCAGATATTAACCCATCTAAC TTCTATATCCAAACAGATACGGCTACTCGCATCCTGGCTATGATTACACG CCGCCCAAGTTCATGTTCTATCCATACTCACAGCATGATATTCCCTCGGG CTTTGCCCTTCCACAGCCACATCCGGAGGAGCAGGAGGAGGAGGCACACC AGCCGGCAATGCAACATCATCACAATCACGAGCAAGTGACCAGCGTGACC ATTGAGCCCTCGTACTCCTACGAGCTTAAGCCCCAGACCAGCTATGAAAC CCAACCGCAGCACACAGCTCCCGAGCAGCCGCAGATTGATCTGCCCCAGG ATGAAGCGGAAAGTCCCAGTGGTGCAGGTGGTTCCAGTGGCCACGGGGGA TATCAGGAGCCCGTCATTGTCTTGCGTATTCCAGGACCCGCCAAGTACGC CGCCCATTTGCAGACCCTTCTCCAGCAATATCTGGAGATCAGAGCGGCCC AGTACCTCAGCTTGCTCCAGGAGGCCGATCAGCAGCAACAACAACAGCAG CATCAGCATGTGGATCCTTCGCAGCAATATGGACCACCAGAACCGGCCAC CTACCATCAGGAAGTCAGCTACGCCCACCAACTGGCACCCACGCCGGCAC CCGTCCAGTACGCACCCATCGATGATGTCTACCAGAGCTACAAGGGTCGC CACCAGCAACAGCTGCAGCTGCAGCAGCAACAATATGAGCCGCAACAATA CTACGCGCCCATGGACTACCAGCAGCCCACACAGTTCTACTACGCTCAGC CCCAATCCCATTTGCAGCAGCAGCCTCAGCTCTATCTGATAGCAATGGCC CAGCCGGAAACGGAACCGGAGCCGCAACCACAGCAGCACCATCATCAGCA GCACCATCATCATCTTCAGCAGCAGCAGCAGCAGCAGCAACCAATATACG TTCCAGAATCTGATCCACCGACGGGTCCTTCAGGTGGTCCTGAACAGGAA CCGGAGGCGGACCACAGCCTTCCCATAACGGAAAACAACCCACGACCCAC CCACACCAAGGTCATTTTTAATCCGTACCCCTACCAGCAGCAGCAGCATC AACCGCAACAGCAGACCACCAACATCGAGGAGCACCAGCACCAGCCTGAG GGCGAACGCCCCTTCAACTACCACGCCCATGCGATCAAGATGCGCCAGGG CAAAAGGGCGGCCAAGCCGGAACCCGCGGATGGGGACGTGGGTCCCAGTT CGGGCGACAAGGGACTCCAACAGATCAGGGAGTATGTGAGGGAGAAACTG GGCGCTGAAATGGGTTCGGCTGTCGAATACAAGACGACACAGCTGCTCGA GGGCTGAGGTCTGGATAAATGTTCAGATGTTCGAAGGCATGGAAACTCAT TTGACCGAACGCACTATCTCTGCCTGGATGAACTAAACCAATTTTTAAAC TTGGCAATCTTCAAACGATTTTATCAAAGGTTTTTTCGGATGCCTTAGAA TTCTAGAATTAAATTTTAAATCGCTTACGCACGTTTTCTATGTATATATC CAGGCAAGCCATCTTTAAAACAAATTCAAACATCCGTACATTATGAATAT GGGGATCAAGTCCAGCAAGACAGTAAAATTCCAGTGAGTGCCATGCCCAC GTTCACTCGTATTCTTAACACACAATTTGTGGTTGCTTCTTGTGCCTGAT ATCCGCTCATTAGTATTTATTCCAAGCTAGAGGAGCAGAACGATCCCGGG GTGATCCTCCAGCTCCAAATCTCATCCAACACCTACCCGCAATCCCTGAG CTACACAGCCAAGGCATACTTTTGGCCGGAAAAGAGGGCGCCTAAAGATA GGCATAGTTTTCTTTTCTTAGCGAAGAGGTGCTGCCGGGACACATTCGCT TTTCATTATTTTGTACGACGTTTTTTTTTATGTTGTTTATATTGTTAACC AAGAAAATGTGCTGCTGATCATGTGTGCAATATTTAGTCTTAATGTGCTT CTTGATTTACCTATATTATGTACTTGTATTTTTGTATGATTAAACCGAAA AGAAATTAATTTGAAAACCAAATAACTCTTTCCATTTTATTCGAATATTT GGCCAATTCACGGAAGTCACGCAGCAAAGCCATAAAAATAGCATCAAATC CGGCGTAACTGAAGTACTAAAAGCTGAACGATTTTGACACGAGTGTTACA ACAAATTTTTGTTAAATTAAATACACCGAATTGTTAGCAGGCACGCAATT GGAAAATGCGGGGAAAATCCCGGAGGAAATTTGCGAGGATGATGGCCCTC GCCATTCCAAAGAGTTCTCTTTTCCCTATCAAGTCAAGTAGTTAGCATGG CAAGAGTTCTGGGTGTGTGACTATACCTGTAGTTCAGCGCAACAAGATCC TCAAATGCACAGCATCATTGTACATAAAATAAGTTTATATGATCTGTGCT ACACAGTGGCTGCTTGTTGTGGAGTGGTTTCTGGTGAAGCTGACGTTTTA TGGGTCCATTGTTGGGACGTAGCAATCGTTTATTCAGATCTTAAAGCAGG TGCTTTTCACTTTTTCGGCACAGCGAAAGGAAGTACTGGATGATTGATAA GATTCCGGGACAGGGAAAAGACCCTGATTCCCTGAATGGCCTTACTTTGA AAGCAAATTGGAAGGCTTCCCAAAGGTTCAAACAAAACAATGTGATCGAC GGCGCACTTCTGAATTCCCCGTGCAAAATGGCCAGGCGTAGAGATCACCA TCCCGATGGGAGGAGGAGGTACGGCATTGGGAATGCAAATGCAAATGCAA ATGCAAGTGACGAATGAAAATGCGAATCTGCCAGTGAGTGCGGAAGCTGC CGACCGCTTTTTAATTTGAGTGGAAAGTAGTCGACAGGCGCTGCCGCATT TCAAAATTATAGAAATTGGCACAATTTACCATCCATTGCGGCAGCTGATT ATGCTAATTGTTTGTCAGTAGTATCTCGAATCTTTACGTAAACATCCATG TGGCAAGATGGATGTGGCAAAAAGGAAGAGACCGCCATGTGAAAGTACTG GGCTTGTTGGGGCGGCAAATCGTAGCAAATTACAGTAGATGACTGGTGCA CTAGATTAAGTCGGACTTAAGTAGGTTTCTGTCACTTTATTTGCCGTAAA GTGAGTTCTGATCTCTCTGGCCAGAACTTGCGTTTTTTAGCAGCAGAAGA GGTCACTTTTCAGATCTAAACGATCATCTTGAAAGAAAATACCAGCTCCG GCTATAAACAACTAATTGCTTTACAATGTGTGGCAGGGTGGGAGATGAAA GATGTAAGCAATCCGATCCACAAACATAACATTTTTCAGCATTGTCGAAG CGTTGCAGCTGCCACAGTGCAGCAAAGGCAATAGGAAAGTTAAAGAAATA AATAAATGCTGATCGGTGTATGAAGATGTATGAGATGAAGAACTTAAATA CATTTACGATACATTTCAAGCCGCAGTTAAATCTTTGATTGAATTAGTTA AATTGAATTAAAAACCCAATCCTTGGCAAATCAATTGGTATTGAGACTGT TCATCTGGTGCGGCTGCCACAGCTGTTTCTTTGGCAGCTGGCAGCTGGTA GTGGATTTGGTAGTTTCTGCAGTTTTTGGCCGCATAACGGGGCATGGATA GCCATGGCTATATGTATCTATGTACCTATGGCAATCGCACTCGACTGCTG ACAAGGTTGTTGATCTGCACATATGTGGAGGAGCCGAAACGCTTTGCCAG CTTTGTTTTGCTTTGCTTTAGCCGCTGCAAAGTTGTTTCGCTTTTATTAT TACGGCTATTATCGTTAGTGTTAAGTGTGGCAATTGTTTCATTTTCAGTT TCAGTTTCGTTTTTCGCTTCTCATGCAGAATATTAAAATATAAATCATAC GCCCTGTGGGCCAGCGCCATAGTCCGCAATAAAGAAATCCCCGGCCAGCA CGTAAGGGAAATCAATGAAATGCCAATTGGCAAGTTATTCCAAGGCGTAC TCCCAGTTCTCTAAGTCCGGATCTCTTTATCGAAATTGAAATCATCGCTG TTGGTTTTCGGCAACGGCAATTGCTGCTGCTCTTTCGGTAAAATCATCAT AAATCAGCGAACACTTTTCTCCGTTTGTCTGGGCTCCTTGTTAATTATTA TGCACTGAATCAGTGACCATGAAGCCAACCACCGAGTGAAGATCTGCCAC GACCAACCACCGACTGCCCGCAATGTAAACACTGTGAGAATACAGCAAAT GGGGAAATTTAAGAATACATAAAATAAGACAGATCTAGTGTTAATGGATT TGTTTCAAGTTTAATTTAAAGGGTGCTAAAGGCTCCCTGTCGAGTCATTG GACTTGCAAAAGTCCTGCTGCTTTCCGGACTCCACTCCAGAGTGGGTTAG TGACTACTGCCCGTTGTCCACTATTTGTCGTTTAACCCAATAAATGCCTT CGGTGGCGAGGATTTTACAAGTCAATTACGGGTATTACCCACCTGTGCCG GCAAACATTTCATTGAACTGCCTGTGGTGGAATGGGGATTGTTTGGCTTA GCTTATGGCTTAATTGGCCATCAAAGTGGCAGCTTAAACAGAGGCCGAAA CTGAAGCCAAGAAACTAAAAACTATAAACCAGTTGTCCCGTTGTCCTCTC TCTTTCGTGCTGGCCTATCGCCTTCTCTGTTGCACCTTATCGACTTATAA TGGGCGAACTTATCACGCATACGCCGTGTTGTGCGTCGATGGCTTATTAC GATTCGAATTGTCATCGAAAGTGAAGCGATCTTTCTCCCCTTCTCTATCT CCAACTGTCTCTCTCTCTTCGCTTGCACTTGCACTTTTCTCGCTTTTCTT TGGCGCGCACATTCGCATAAATTTTCCGCTGCAGCGGTTCGCATCATTAT AAAAGCCTCGCCTCGACAGCTGGCCGCTAACAATTCCAGCTGAGACTCTG GCGCGCCATGATGTCAGCGCTCACATCTCGATTCCGTAATCTTCAATATC AGGAGCACCACCTTGTCCATATGGGAGCAAACATTCTCAGCCGGCGGCAA TGGTGCCTGTGTCTGCTGATCATCGTAAGTAGTGCGCTCACGTCCAAGGA TTCGGATAATTCGATTCACGAGGAGTACCTTTTTTTTTGGTGGCCAGTGA TCCAAAGTGTAGTGATGTATTTGAAAATTCATAAATGTTGGACTCGAGAG AATCTCCAGAAGTAAAAAAACAGCCCATTTGAAAATGAGATTTTTTTTAT TTAATAATTCAGTGAAGAAGAGTGATAAATTTGTAAAAAATATAAATAAA TATGTAAAAAAATATATATAAATGTATCTTACGATAAAAAACGAAAATAA GTGAAAAAAATATGTAAAAATACTCAATTAAAACTTTTTAAAAACATTAA TATTTGAATCTTCAGTAATGAACTGCTGAAGCTTATCCCGCTAAAATTAC ATTTCGGAACATAACACCAAATTTTTAAACAAAGACCAAAAAGATTAGCC TTTTTGGGAAAATATGTCCCGAATGACTGAGAATTACGTTTTTGATACAT AATCGCCAAATTCTTTTCCCATTTCGATCGAAAAGGATCCATTTGGCGAT TCGCAATTGCGTGCTGCGGGTTTTTCATGCCGGTGTGTCATTGCCCTCTC CTCTGGAAAACGGTCCATTGAACTTGGCCAACTGAGCGCCGCCAACTCAA TCATACAGAAATTGACTATCAACCGCCTCCTCCTTCTCCTTTTCTTTCTC TTCTCCTCCTTGAAAGCGAAAGCGAATTGGCGGAGTTTAATTAGTTTAAT TGCGAAGTAGGCACAAGCCAATGAGTCTGAAACGAAGAGGCCAATTTAAG GCAGTTCGCCTAACTAGCACCCGTTGAAATGGCACACTCATCAGTTGGCC AAGGTTCCTTGTTTGTCCTATCGTTTTACTCATTTTATTTTAATGTACGG TTTTTATTGTAAGCCATGCGAATCTCCGATTATGTAATTTTCAAATAGCT GTGATTCTTTCTAATTTCTCTGAACAGATGTCGACGCTTTGCAGTGCCGT GACTGTGACCTCAGGCACGTCTGGGAACAGTCGCCGTCGATCGGGAGGTT CAGGAGCGGTGTCCTCTTTGGAGGTGACTGGGGAGAAGGCCTTTCCCGAT CAACTGGCTATGGCAGCTAGCCGTAGGGGCTCCGACGATCGTGGTTACTC CAGGCGGGGATCGGTTACACAAAGCAGATTAAAGGAGGCGCCCAGCAAAG GTAATAAACCGTCCCATTTTGTTTGGCAAGCCTAAAAGTATGCACTAATC CGCAATCGACATGCATTGTATACTTCCCAGATTACAGCTTTGGCCAGGTG GAATTAAATCTCGTTCGCCCAGAGCACGAATCGCATCCAAAGCAGACCGC AGAATCCGGATCCGGAGCGTATGTCAACCTAGAAGACTCTAAATCGGCAG CCGAGTATGTGGCCAATGCCATCAAGTTGGCCTACAAACAGCCACCGACT CAACTGCGAGGTCAAAGCCAAGTTCAGAACCCTAGCAACAACCACATCCA GGCGCAAAAGGAACAGCAACCTACCACCCAGAGAAGTTACCAGGAACAGA GAAGGGATAGGGAGATCCTGGAGATGCAATTGCAGAAGGAACTGCATCAG CAGGCCCTGCTCCTGTCCTCAGGACCCTCGTCGCCATCCTCGTCTGGATC GTCGTCCTCCTCTTCTCCGCCGTCGCCCGCCCTAGCGCCTGCGCCAGTCT ACGAAAAGGAACCCGTGACCCGGAGCTATGAACTCTACGAACACGCAACC GAGGACGAGTCCCATGTCCAGGCCCAAGAGCAAGACATCGAACGCCACTA TCGTCCCAAGTACAGCAATAACTACAACAACATCTACGCCCCCTATCAAC CGCCGCAAATTTACAGAAATCTCGAGGCCGAGGCCGAGGAAAAAGTCAGG GTCTCTGCCTCCACGGAAATTCCCAAATCGGAGATAATGAAACAGATTGA AAAGTCCGTGATCAAGTACATGAAGGAACTAGAGGCCGAAGGTAAAATCA TAAGTACGCCCCAAGAGACGGCCACGCCTCCTCCACCACCACCGCCTCCG CCGATTACCAAGACCTACTACAAGTCGCAGACGCTCTCATCTGGTCTCCA TTCCGGTTCCATTCCCTCGTCGCACTCGCATTCACACTCGGAGGAAAAGC GTTACAGCAGCAGTACAGTGAGGCCCAAGTATACGGTCCCACCAACGACA AAACAACAACAGTTGCATCACCACCAGCAGCAGGTGCTCCACCCACAGCA CCACAGCCACCAAATAGCCGGAAAACTGAGGGGCTCTTCATTGGCAATAA CGAATTCAAAGCCCATTCAGCACTTTCAGTCCGAAACGGAAACGGCATAT CAGGCCCCCGATTTGCCCGTCGACGAACTGAGTCCGAATGTGGAGTTTAT TTACAAAATCAAGACCCGAGCTCCCCTGCAAACGGCCACAGTGAAGACGG TTTCGAAGCCCTACACTTTGCCTCTGAAAAGTGCCGAGCACTTTGACCAC AGTGCGGCCCTCAAGAACATCGAAGAATTCGATCTATCCCACGTAGTTCC CACTCCAGATCGAGTGGAACGGGAGCGGGAAAGGGAAAGGGAAAGGGAGC GTGATTCTCGGGAAGATCAGGAGAGGCTTACAAACTCTGGCAAGCAGCAC AAGTTGTATTTCAATTCGGAAATCTATCATGACATCAATGCCTTGCCCTA CAAAAGTAAAGAGGCAGCTCTGCAGGAATATCGCCACAAGCTCAAGGCTT CCGGGTCATCCGGGGAACTGCATCCGGACTACAAAGGCTACTCCTCATCC GGTTACTTTGCCGAGCCGGAAGCAGAGACTGAGAATGAATCAAAACTAAT CCTTAACGAAGAAGGCTATCCCTATCATTATGTGCTGAAGAAGGAAACCC TACTAGATGATCATGAGCCCTGGTTGTCCCACGCGCACGGCCACGCCCAC CAGCACACCCATGGCCACGCCCACTCGCACAGCAACAGCAACAAGCACCC GAGTCTTGAATACGACAGCTACAGTCCGAAGTTCAACAACAATCCCGAGG GCTACGGCTATCAGCACACGTACAAGGTCAGAGGTCAACCAGCAGGCGGT GCCGGGTCGGGGGGCGTGGCTGGCATAGGCAGTAACACGGGGACCGGAGC TGGAAAGCGCGGCAAGCGGGGGGGAGGCGGTCATCCCAGACAAGAGGCGA TTAAGAAGCAACTGCGCTCATCGGAGGTCAAGGACTTGGAAGCCAGTTTG GCTCTGAGGCCACCGCCCAAATAGTAAACCCCATCCCTCGATTAATCAAT CGAATAAGCCGCAAAACTCCACCACCACCCTCATAGCTTATTTTATGCCA GAATTTCGAGCATGCTTCATTGTATATGCTATTGTCTTTTTTTTGTAGAA TCTAAGTGTAAGTACGATTATTTATTGTATGGCCACCAACTGCTGAAGTG GTAGCCAACTAAAACAGACGATAACAAATTACGCCAATAAACAAATTAAT GAAATAACTTAAAATAAAAACTATCGCTTATCCATTGACATTTTTAAATA GCTCAAGACTTCATTCCATTATCATGATAGCCCCATGAACTAGATTTTCT ATATCTATCCAAAAATTCGAACTGCTTGGAAAAGTGCGAATGCCGCCTCT GTTGATCAGTTTTTTTTTTTTAGTTTCGATTTTTATTCGTCTCATTTCTT CGCTCTATGTGTGGGTGTGAGTGTTTGAGTGTGTGTGTGTGTGATGTAAT TAATAATTTTAGCGCACAATTATAAGGCAGCCGCCCACATCCACCCAATG AACGAACTGATTGAAACATCCAGAGATTCAGCCTCGGATTGGGTAAGTCA CAGTAAAAGTGCCTCCTCTTTTGCAATTTAACTCTTTCTCTTGGTGGAAG TACATCCACCGCATTTGCATTCTGGTTTTATATAGGAACACAAGTTGTAC GGGTAAGAATCTGTTGTAAATGGCAGAAAAGAGTGTCAAATGTGTTGTTA CGTGAGATTTGGACGATTAATCGCCAGCCCAGCGGCCACATTGTCTCTAT TTTTTTGTGGCTCAAATTCGGCACCCGCTCACGCACAGATTTTATTCAAG ATCATATAGTGGCTCAGTGCCGGCCGATGATGGTGGGTATAAAACGTATT TTCACTGGCCATAGCTAGTCATTGCTCACTCAGCATTCAAGCCCCCAAAT CAGCCGCATAGACGATGCTCAAAGCCGCAAAGGTGAGCCCGGCGAATTTC ATTCGAAGGTCCTGTATTAATAGGTTTTCTTGCCAGATCCCCTTGTTCTT CGCCCTTTTGGGTGCTGTGTGTATCCAGGCCGTCGTGGTTGGTCCCCAGC CATTGCATAATAACAACAGGAACGGCTACCGCTACAATGGCCCCGCCCAC AAGTATCTCCCATCGGAGGAGTCGCACTCGCACGGCAGCCCCTTGGATTC GAGTCACCAGCATGATCAGCAGGGCCCCAGTAATGCCTACAACTCACATC ATTACCCAGCACAGGAGCAACATGGCCAGGGAGCGCCGGAGCACGACCAT CAGCAGAAGGAGGTTGACTCCTGGCAAACGGCTCTTTCCCAGCAGCAACA CGAGAGCTTCGGAAACCAGCAAAATCATCAGAACGCCTACAATGAAGGAC CTGTGTACCAGCACTATCAGGGATTTAACCACCAACAACATTATGGATTA AGCCAACAGCAACAGCATGAAAGCTACGGGCAGGAACACTATCAACAGAG CCCCAACCAGCTGCAACACCATCAGTCCCAACACGCAAACGAATATGCCT ACGAACCAGCTCATTTCCAGCAGCAACAGCAGCATCACGAAATTCAGGGT CACAAGCAGCATCAGCAGAGGAAAGAGCACTGGAACTTCGTTCAAGAGCA GCAACCCCAAAATCACGAACCCTGGCAATCTTCGCATGGCTTCCAACAGC ACCAGCAGCAGCATTCCAATCGCTTTGAGTCACAGCTTCCGCTGCGGGAA GACCTTTGGCAACCCATTCGTGAGCTGGACCTAGAGAAGCTTCCTTCGGC TGAGGCGCACGCCAGTAGCCACAAGACAGTTGCAGCTCCTGGACGAGATG TAAAGCTCGTGCCCAGTTACACGCTCTCCAGCGACTTTGAGCACGACCGC TTCATCGGACTGGATAGTACGGACACTCGTCTGCTGACCCAATCTCTGCC AGATGCCTACCGGAAACAGCTGTTCTCCTCGCCACCAGAACCATCGTCTT TAGCCCAGGGACATAACCAGCAACACAAGCCCGGATCCGCAGCCTATGGT GGTTCCCACGGACCATCCCTTGGCGAATCCACATCCGATTTCCTGCAAAT GCAGTCCCACTCGTATCAGCTGCCTTCAACGTTTACTACTCACACGGAAT GGACCCAGGACAAGGAGCAGCATCAGCACAATCCCCAGCAGCAGGCCACC GGCAATCGTCAGTACTCGGCTAGTGCCTTCGCAGTGTCCCCTTCGTATCT GCACGCCTCCGAAGCCTCCCAGCCGCCCAAGAACAGCTTGCCACATCCTA GCCGTGACTTCCAGCCACCTTACTACTAAGGCCCTTGAACAGACTTAATA ACTGAATTAACTGGTAGTTCGATGCTCCACATCAACCATAAGATCGTACC AACTTCAACATTCGCTTTTCCCCGGAAAAGCATTTGGTCTGAAAAGCAAA ACTATCACAGCAAGAAGTGTGCAGATAAATACTTTTCCCTTTTTTTTTTA TATATATATATTTAATAAAGAGTGCATTGGTGAACCAACGCTTTTGTAGT TTACATGATAATAACTAAGGTCATTAACGAATGAAACGTGTATATGTGGC GCTCAAGTGATATCATCCCAAACGCGAAACAAAGACGACCTTCATAGCTG GCTAAAAGCGAGCGTGGCGGCTAATTTGATTACGATTTTAGCAGATAATT ACGAGAATTTTTGTAATTTTCTCATACTTATGCTGCTGTTTGTTTATGCC AATGTTGCCGTGGCAAATTAGAGACGATTCGGATTTGGATTCGGGTTTGG ATTTCTCGGTGTTCTCGAGCTGCTTCCGCCGTCCAAGTGAAGGTAAAACA AACAGAAACAGAAACCGCACCTCAAAAACACCCACACGCCTGCGCCTTTT GCAGAAATGAAATGATGCAGAAGCACCGCAACTTTCATTGCAGCAGGAAG CCAGCAGCTATCGGTAAATATTGCATTCATCAGTGCTCTGCTTTTGGCAC ACTATTTGTTATGTTCATGACTCGGTTTCCATCAAGTCGAGTCATCGAAA TTGAAATGTTGGCGTCGTGCGAAGGCGATCGATGAACAGAAACTGCCCAT TGCTGAGGGCAAACTGGTGTGTGCGATTGTGGCACGGCGTCACTTTCATT TTCAGTCTGCAAATTGTTGTACGGAAGTCGAAAGAAACGTATTGGAAACC CGAAGGCAGACCTTTATGCAGAATGCTGTAAGGCATTCAGATAGATTACT AACGCAATATTACAATCATTTAAAATCCAAGCCACCAATAAACTTCACTA TTAAATCTTAGGCCACACGTCAAGTGTCGCACATTCCTCACGGGGAAAAC GTCTACACAGAAAAAAACATTACGATCTCTTGTGGCTACTGAACGCAAGA AATTCATGTTGATTATGACCATGTTATAGCAATTTTTTCTGTGCAGCACG GCAGCTAATCTGGCAAGTTCCTGAAGTGGAAAATTTTGCATTCGAAGGGC GACGAAGACCAAAAGTCCCCGGCTCAGTTACACGGGTTGTTGATCCCACA AAAGACGGCGAAAGCAATTTTCGAACTTGCAACATTGCAAAATGGTTTCG TAAGCGCCAAAAGCCAAAAAGTTCATTTAATCAGAATTAGGTTTAATAAC AACAAGAGTTTTAATCAATTTGGGCGTTTCGATATCGGACAATTGGATAA TTGCTTCGGCAGCAGATACCAGGTTACGCAACTAGGAGGAAGAGTTGCAA GTGGAAGGTATCGCTTTCAGCGGAACCACAGGTATCGAATGACATCGGGG TGGCTTCTTATATATGCCCAAAGCGTCAGGGCCACTGCAAGCATTTGCAA CAGACAACCATATTGAGCAGCATGTTCAGGTTTTTTCACCTCGACATCCT GGTCAGCCTGATCAGCCTAATCAGCTGTTTTGCATTGATGAACGCCCAGC AGCAGCAGCAATTCCACCAGCAGGAGGTATCGGGGATACAACTCCACCCA CCATGGCTGTACTCGATGCCCTGGCGTCCTTTGATCCTGCCAACAGCCAG TCCTTCACTACCTTCTCTGACGGCGCTGGCTCAACTGAGTCCTGGCTACA CGGGCCCGCAGACCTTTCCTCCAGTTCCACAGGATCAACGCCAGCAGACG CAGCAATATCAGCAACATCAGCAACAGCAATTCCAGCAGGCATATCCGCA GCAATACCAGCAACAGCGATACCAGCAGGAATATCCGCAGCAATACCAGC AACCCTCCGTCCTGGTGGGCTTATTTACTCCTCAACTGCAGGCCCAGCCA CTGTCAGCTCCTCCTCCGCAGGCTGGACATTTTAGCCTGCCCTTCAGGCC CTCGCCCTTCGCCGGATACACGGATGACGGAGATGAACATATAGCCCAAG GGCAGGGCAACGGCATGCCAGAGCAAACGTCGCAGCGGACACTGGAGGAG CCGACCTTCCATGAGCATGTCTATAATAATAAGCCAGTGGCGGAGGGATC GCAGCACCCAAGGGGCTACGTCTATCTATCGCCTAGTAATGCCTATAATC TAGTAAGAACTTAGGTTACAGAGTGAACATAAATGTCTCGTTCTTTGTGT TAGTTCCTAAGCTATTGAATACCAAATATCAATCAGTACAATCAGAAACT ATAACGTGAAGAAAAGTCAGGCTCTTCATATGTGAGTTTGTGGAGTTGTA TGTGGATACCCAGCCCAAGTCAAAATCCGAGTCAAACCCACAGGTTCATT TCCCATGGCAAATTTAAGCGCAGCTTTGTCTCTGGGTAATGAAATGCTGG GGATGACTCCCCCACTCCGGGAGACCGCTGTCTTTGAAGGCGGCCGACTT TTGCCATGGGCGGGCTGTGCTGTTGTATGTCTGGCAATTTGTTGCCACTT TCAAATGCCTCAATTACAATCGTCTCGCACAAGTCGCAAATCGGTGAAAT TATAACTCGATCGACGTGGCAGGTGTGACCTTGGCAAGCGGATTGCGCAA CTGTCTGAAGGGCGGAGTCTTAGCGGCTGGCGGGCAATTACATCAACTAA AATCTCAGCCGTGGCACACGACTGTTGACCAAAGAAGCGGGCCTAGAGGA GTACCGGCAGCAACTAACCACGCCTACCAGACCAGTCGAAAGCCCGGAAG GATACCTTGTATACAATGTGTTCACTACCATTACCATTACATTCAAATGA GTCCTCTAATAGGAGGATTCTCTCAATTTTTTCATGGTAATATTTGTATG TACACCAATTCCGAAATTGGAATCAGCTTGTTCTGTCATAGATTTGCATG TCCAAATGCCAAGTTCTTAGTTACTAATCTCGACATGTATGGGCTTAAAT TCCACTGTGATGAAGAACTGCCCTTGAAGGCCGTCTGACGACAACACAAG CAAGACCGGCAAGGTGCACATCATTTATCTTCCATGGTCGTGGGCTGCAT GCAGATATATCGCAAAGGTTTCGGGCCAAGTCCATTAGTAGCCATGGGTT ACCGGTGCCGTAGAGAGGGGTCGGGGTCAAAGGGGCACTAACATACCTCA AACTATTGCCAAATCATCATCATCTGCGGCAGAGACCCAAATTAAGATCC CGAACGGTAGCAAAACAAATCGCTTTTCGAATTTCGAAAAAAAAATCGCG CACCTGGGAAAACAGCAACAATTACGAGGCGAAGTAGGGTGCACAAGAGA GACCCAAGAAGAGGAAGAAGGGATACCAGAGGAGAAAGATACGGGTTGTT GTAAATTAAATGCAATTTACGCACAAACTAAGCTGTTTTTGGGGAAATGT AAGTGAGCCAGCTGAGGAGGAGGAAGTGAGAAGAAACATGAACACAACAG GGCCAAAATGGCAAGATGGCAAGGGGCGTGGTAAGCAGACATGTGATTTT TAAAAGTGTCACTTGAACTTGAGTGGTAACACTCGCACAGTGGGTAAAAA TGCTATTGAAAATTGAAGTCCAAACAGGCTTATAATATAAGGATATATAA TATTATAATATAATACTGATCTTTATATCGAATATATTGTACATACGTAT GTACAAAAACTGTAAGTATCAATCAAAAACTCACTCACTTTGTTTTGCCC AGGATCCACAGACGATGCCCACTTCTTTCCACAAACCGTGGACCCTTTTC CATCACTAGGTGGTAACTTGCACTCTCCTTTTACGCCTTTCGTTTCATCT GCCTGCTTCATGAAACGCGGGGCGCGGGGGAAACCGAAGCCGACGCGAGA ACCGTTATAATCCACAAGCCTTGAGCAAGTTGCAAATGCGTAGTTATCTA TATTTCAGATGAACCAAAGCGATCGCTAGAGAGCCGTTATATTCCGCAAG TCGCAACAAAATTATGAATTCGTAAATATCACTATTTCAGCCACAACTTG TACAAACGTGTTCCTTGTTTAGTTTAAGTAAATGCTTTTATCCCTGGCAC ACATTTCCCGGAGCCCATACAATATATGTAAGTTGCACACGCTGATCGCA AATCAAACTAACCAAAGCGACAGCTTCGCGCGAGAGAGAGAGCAAGGATG TCGTTACAGTTTGAGAACATTGAGAACAGTGAATGTGCAACCGTAACAGT TTTATGACTTGGAAATCTAAATCGTTTTTTAATTCGAATAATGCTGTAAT ATAGTTTTAAATATTAATGTTTTAAATTCTTTATTTTTCGAATCTAAAAG ACAATTAAATGTATAGCGTTATCAAGAAAATCTATTTTGTATACATTTGT TCAAGTCGTATGTATTTTTAAGGAGCTAGGTCACACCATTGAATATTTAT GCACACGTGAATTTAACCCACTGTGCGCAAACGAAACTAAGAGTGAGGGA ATGAAGAAAGGCTGCAGCGCAGTCGGAGTCGGCGTCACACACGAAATACC GTTGTTTTTCGCGTGCGTGAGCGTGAGAGCGACAAAAAGAGAATGCCAAG AGAGCAGCATGGCAAGAGGCAAAGGCAAAAACCGAGTTTCTTGCAGTTTG AAGTGGCTTCTTTAAAATGTATAAAAGGGTCGGCACTCACAGAGTTCGTC AACATAACGCCAACGGCAGCGATTAGAGTCGCGTCTCGTCTCGTTCTATA CTCCGGATCCAACGTGAGGAACAAGGATAACCGATAACACGATCGAAGGA TAACCGTTAAATTCACTTTTTTTTCCGTGATTTTTGCTGTGACTTGAGCA TGAAACTACCGTTAGCTTGCGCTGTGCTAAGCTGCTGCTTCTTTTTGTTG GCAGCCGCCTCATCTTCTCCAGCTGCCGATGCTTCTTCTTCAAAGCCCGC TTCATCTTCGGCTGAGACCTCATCCTCCGCTAAGCCAAAAAGAGATGCTG GCCTAAGTTTCGGAGGAATATCCAGCTATCACGGCCCTTCTCACAAATAT CTGCCGCCCGCCTATGAGAGTCACCTTAACCTCGGCAGTTTCCATGGAAG CTCGGCTGGTTATTCCGATTACCCCAGTCACTTCAAGGGCGAGAGCAGTT ACGGACACCACTTCGCACACGGACACTCCGGAAGCCACGGCTACGCCAGT TCCAGTGGCCATGGAAGGCCCCATCATTACAGCGGTAGTGGAGTTCCTAA AATCGAAACCTACATCGTTCAAACAAGTGGCGGCTCGAGTTCCGGTCACA ACTACCATGGTCAGGGACATGGACATGGAATCGGTCACGGGATCAGTCAT GGAATCAGTCACGGCCTGAGTCACGGGCATGGATCTGGATTGGCCTTTAA GTACGCACCATCTACCAGTGGAGCCTATCTGAATCTCGTTGGGAATGAAC ACAAGACCAGCACATATGTGGTGGCCACTCCCGAGTACTCCGGACACAGC CACGGAGCGAGGGGCAGCACCCACGGAATTGGCTACGGATCGGCACCAGC CCACAGACCCAGCTACGGTGGCCACCTGCAAAGTCACGGCTATGGCAACA ACTTTGGCCATGGCCCCAGCCATCACATCGCCCATGAACCAGTCAGTCAC GGACCTATCCAAAGTTTGGATCACGGTCTGGAGCATGCCTTGGAGCACGG TCTGAGCCACGCCCTGGGATTGGGTCACTCTTCGGGAGGACAGTTCCCAC AGCACGCGCTGCCCCAGCCGGCGGAGGAGCATTCTGGGTACTCCTACGAT GCTCCCGCCACGCCTTTTGGAAAGGGAGTGCCGTTGAGCAGTTACGGCGT ACCACTCATACCCGGCTACGATCACCAGGAGTCACTGCCGGAGCCAGTGC AAGTGCAGGTGCTGGAGCAGGAGCACAAGGGCGATCGGGAGCAGGAGAGG GAAACACCGGTTTATGCTCTGGGCCACAAGGGCCTGGGTCACTTCAGCTA CACGGCCAGCAAGCCACAGGCTCTCCACACCGACGTTCTCAGCTCTGCCC ACCACTCCGTCCAGTCCGGAGCACCCAGCCACGACCTAGACGTCTCCAAG GCGCCTTTTAGGCCCAGTGCCTTTCTAGGGGCCAAGCACGAGTCCGGATC GAATTCCATTTCCGGCTACGACTACGCCACGCCCAGCTCCACATTCCTGC AGGCTCCTTCTTCGCCAGGCTATGACTACCAGGCTCCGGCGCAACTATAC GGACCACCCGGCCACTCCGGGGACTCGGCCACGCCTATTTTCGAACCGGA GGCGACCTACCTGCCTCCTGCCAGCAGCTACGGCCCAACGGCCGCGTCCT CCCATGGTTACCACGAAGTGCATACCAATCAGGACCCGCTGGACGAGGTT CACACAAACCAAGATCCACTTGATGAATTCATGGTGTCCAAGGGCGAGGA GCTGTTCACCGGCGTGGTGCCCATCCTGGTGGAGCTGGATGGCGACGTGA ACGGCCACAAGTTCAGCGTGCGCGGCGAGGGCGAGGGCGACGCCACCAAC GGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCC CTGGCCCACCCTGGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCC GCTACCCCGATCACATGAAGCAGCACGATTTCTTCAAGAGCGCCATGCCC GAGGGCTACGTGCAGGAGCGCACCATCAGCTTCAAGGATGACGGCACCTA CAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGATACCCTGGTGAACCGCA TCGAGCTGAAGGGCATCGATTTCAAGGAGGATGGCAACATCCTGGGCCAC AAGCTGGAGTACAACTTCAACAGCCACAACGTGTACATCACCGCCGATAA GCAGAAGAACGGCATCAAGGCCAACTTCAAGATCCGCCACAATGTGGAGG ATGGCTCCGTGCAGCTGGCCGATCACTACCAGCAGAACACCCCCATCGGC GACGGCCCAGTGCTGCTGCCCGATAACCACTACCTGAGCACCCAGAGCGT GCTGTCCAAGGACCCCAACGAGAAGCGCGATCACATGGTGCTGCTGGAGT TCGTGACCGCCGCCGGCATCACCCTGGGCATGGATGAGCTGTACAAGCTC GAGGGCAAGCCCATCCCCAACCCCCTGCTGGGCCTGGATAGCACCCTGGA GGTGCTGTTCCAGGGCCCCGAGAACCTGTACTTCCAGGGCATGGCCAGCA GCCTGCGCCAGATCCTGGATAGCCAGAAGATGGAGTGGCGCAGCAACGCC GGCGGCAGCGGATCCTCGGGAAGTTCCTATTCTCTAGAAAGTATAGGAAC TTCGTCGACAGATTATAAAGACCACGATGGAGACTATAAAGATCATGACA TTGACTACAAGGATGACGACGACAAGTAAATTATTAAACTAGTTTTAAGC TCTAGCGTCCAATGTATTTTTTTATCCCTATCTATTTGGTACTGCAAGCC AAGATGGAACAATAAAAATCAAGAAATCAAGAGTCACAGTGTTGAAACAA TTTGAAAAGGAAGGAAGAAAGAGTATTTGCAAGTGAGATAGTTATGTGGA AAGAAAGTTCTAAGCAGTACAAACTGATGGGTTTTACAATAAAATGAAGC CACTTAATAGGCCAAATGAAAATGATTTCTTTTTAAAAGCGAAATGGAAC TTTCTCAACTTCTCTTCGTGTGCGGAGGCTCCTCCCTACCAACTGGATAG ATTCCAGGCTATTGGAATGCCGCACACGTCGCAGATTTTGGCAGTTTCTC TCCGATTTGTGGTTACAAATTGGTTCGATTTCGGATTTCGCTTAAAAATT GTGATTCGCATTTGATGCGTGAAACTATATCAAACTAAAGAGTGGACGGC TGTCGTGGGAGGCGTGGAGCAGCGTAGGGAGTGGAGCTTCCAAAACGACG CTGGCATGGCAATGAGTCGAATGGGCTTGGGCTGCCCAGGCTAACTGAAT TAGACCTGCTGAATTAGAATACAAGTTAAAAGGAGGCGTCTTGAGTTCAC AACGTGTTCACAACGTGTTCACAAATGCGATCAAGTGGATGCCATCCGCT GGTTCCGCTTGCCTATCCCCCAGTTGCACCATTCACCGCCGCGTGATGGA TGGTCAACGCACTGGCCGCCGCCTCTCACTCTGCTTCCATGTTAATCATA ACTTCAACTTCATCCCATTTTCCATTCCAATCTCTGTTGCGCAATCTTTG CGGTTCGACCAGTTCGGGCATTTGATCCTTAAGTCGCTGACCTACATCAA AGTACACAAGACACAGCGAAAGTGAAAGGATGACAGCTTGATGGGCTCTG ATCGCCTCGTCTCAAATCGGATCGGATTAGTGATCATGATCATGATCATA ATCTCCTCATCTGGAAGGCTCTTGGATAACTTGACCCACGCTGAGAAGTG AACTTGAGCGCCTGATTGAGAATCACATTCGCTGCGGAAGTGGTCAGAGT TCGCCCAGCGAGACGTGGCTTAGGAAGAAAAGGAAACAGATCTGCATAGT TTTCCATGGTTTTCCAACCTGACTCGAACTCATTGTACTGAGCCATTCAG ACCCCCTGGGGTGGGAAATAGTTATTTCTGTGAATGGGAGCGGCCAAGCT AATCAGACATTAGAGATCAGAGACGATATAGTTCGAGATATAGAACATAT TCCACAGGCGGCTGTATATGGAAGGCCTTTGTGGAGGGTTCCGGTTCCCT GCTGGGGTCACACCACTAAAGTCAGAGAGTCACTCGGACTGGGGCTGAGG TAATCCCCCAAAAATATATTTTCGGGCAGGGTCAGGTGTTATGTAAGCCC CCGCGGGCAATCTTCTTTCTTTCTTTCTTGGAAGCCTAACTGTGTCGACA AGTTCAGTCAGCCACAACAATTGAAAGGCCGGCCGCAGCAATAAATTAGA TAGTTTCGTATGACAGTTAACAAAGGGCTGCAAATGTGACAGATGTGAAC AATGCAGAGGGGGGGGGGGGGGGTTGAGTTGATAAGCTGCATTGGACAGC AATCGGTGGGCTGATGATAGATCTATTAACTGGGGAATCGAGAGCAGTCA AAGGCGTGGGTCAAATTTGCTCGCACATTAGCAGCGAAATGAGCCGTGAA AAAGGTGTTAAATAATTTCATTTCATCGTTATGGCTGTAACCAGTTGTTA ATCCCCTACACTTTTATGTTTTCCCCGTCGCGATTCGGTTATTTATGGGC TTAACGCCTGATTTTTGTTAATTCCCAACCCACTCCGTGCGCTTTCTGGG CAGTGGTGGCAGGAGGGGCGACCGGCGATACCAACATTTCATTTCACATT TTTTATTAAAGTGCAAGAGCAGCAGCGACATTCACTTTTCATTCATTTCT TTGTTGTGTTGTTACTTTTTGACCGACGTCTCCGGTTCATGTTTTGCATG CGGTAATCATTTTTGCATGTTATCATTCATTAATTAATGGCGTTTTCTGC CAAAGCCAAGTCTGTAGATTCAATTTTTCAGTTTTCGACTCTTTCCGTAC AATAGATACATATGTACATCTACATATAATGCAGTATAGATATCTAAGTA AATATTGCTAATTATTATGACCTAATTGTTCAGTTTTCATATTTACAATT ACATTCGTTTTTTCATTCGAACTAAGCTGTTCCTACTTAGTATGCTGATT AAGCACCTAGATGGTCAATACCACACTGCTGGTACTTCTTACTCAATGCA TATTCAATTGAATAACTCGCTTTCGTTTTCGTCCTCTGCAAATATGGCAG TCATCTTGCCGGTGTTCGAAAATTGTGAATTCTCCAGGTATCCTGCGCTG TCGAGGGCGTCAACTCCTTTCAGCCATTGGAGCTCCTCGTCCTGGGACTC GTCTATTGCGCTTCTCTGGCTTCGATTCTTCGCAGCAAGGGCCGGACTAA ACTGCGGTTTTTGGCGGACAATCGGATCGTTGTGGTGGCCACTGGCCAAG CCATGGCGTATCAACTGATTGCGCCGCATATAATCTGCTCCGCAGACGGA GCATATATAGGCCTTACAGATACTATGGACGAAGAGATGAACATCCCTGT TTTCGGGCCGTCCGAAGAGCTTTCCACAGATCGGACAGCCGTAGCTCTTC GCGGAGCCATGGGACGCCAAGTGCTTTCTATAATTTACAGGATGGCTGAA GCGGGCACTGCAGGTGTCGCAAACGAGGTTCCGCTCATTCTGGTGGACCG TCTTCACATGCTGATCACACTCCCGCCTCTGCTGGAAACGCTTCTTGCAG CCCGGTTCTGGACAGGAGTGCAGGTACACCTTCCGATGAACGTTCTTCAG GTGACACTCCCTATTGCTGCGCTGCACAAAGCGCGCCGGACACTCGGGAC ACGGATAGTTCCGCACGTCGTTGTGGGCATTCATGTGATCCACAAGGGCG TTGTGCTTTTGGAAGACCCTTCCACACGCGTCGCAGGCATGCTCCGACGC GGGCGTTTGCTGTCCACCCTGGTATCGGTGTGTGGGCCGATGGGCGGCCA ACTCCTCCCTGGTGAGGAATAGCGCTGGACAGCGTCTGCAGACGAAGGAC GGAGATCCTGCGGGCGAAAAAGCAAGGCTGGTAAGGTGTCGCCAAGCACA AGTTTGGATCGACTGGTGTGGTAGGGACTTGTGATATAAACGCAGTTATA GATCTAATGGGCTTTTACTGATCAAAAATGCCTTTGAAGTGATGAGTTTT AATTTACCGCCTTGCTGGTGCTGGCTTCTCTCATTGAGTTCCTCGAACTG TAGCTCTTCTGTGTTTAAGGACAGCTCCTCATCCTCATATGTATGTGGTA GTAGAGCCAAGATCTCGGCCTCTTTATATTGTACTTCAGTCATTTGAGAA TAATCAAATTAAAACACATTAGTTTATGTTGTTTTGATTTTTACATACTC TTCACCCGAATGTACTAACGCCTAGCAGCGGCAGCACGAAAATGGCTAAC GCTAGTGTGCAAGCACTGTTAGGAATGCCTATCGATACCTATCGCATTTG AGTTTGAGTCAAAATCATTTTTAAAAATTGTGCAATAAAACGACCGTTAC TTTCTGTATATTAATCAATTGTTATGCAATTTATTTATACGCTATGTAAA TATAATTTGTTCACAACTGTTATATAATTATTTAGCATTTTCTTTCTTTA ATGTTTTCTTTGCTTTGTTTTGATTTTAAAGCGGCTGCTCAACAATTTTC CGACTTCGATTCGCGCCCATTGATCGATCTCAATCCACATTCGGCACTCT AAAAATCACACATTTGGATGATTTCTAAGTGGGTCGCCTGTTTTGCTCGT ATCTGGGATCTGGGGGTCTTTCTTTTGTGATTGTAGTACAACTACTTGGC GCGATTTGGTGAATCTTGCCCCGTTTTGCCCCATTTGTTGGCTTTTAGAA ATGTTAACAAATTTACAGACTTATATTGTTATTACAATAATTGTGTATTT ATATATATGTATATTAGTGGATTTATTTATATATGTATAGATGCATTATA TAATATGCACTGAAAAGTGTCAACAGGATTGGGAGCTCTTCACGCGATTC GCTGTGGAATTTGTGGGCGGGAAATGGGAAACGGAAATGGCAGTTAAAAG AGGAAAACCGGAAGGAAATATCATCTTGCCTTAACCTTAGGTAAAAACCG ATTTCTCTAAAATTTTTCTTACTTTCTCGTTTACTATTCACGTTTATAAT CGTATCTGCTCGCTATCCGTCTACTCCCTACTCCCTTTAATATCATTTAA TAGATGGATTTTGCGGTTTTTGTCAGTTAAAGTACGAAAAAGTGCGCTAG TTTTCCCCTCCTTCACTGGCTAAAACGTGAAAAGTCTTTGCTTGGTTTTT ACTGTGTGTTACACACGTTTCGTGTTTAATTGCATTTGATTTAATGTTAT TTAATAATTTTCGTTTGCTTTAGAATTTAAATGCTATAAGTAAATACCTG CCTGCCTGCCGCCTGCGTGCCTTCCTGCAATTATTTGTTTGGTATTCTCC CACTGATTCCTAATAATTCGTCTGGTTTTCGGTTTTAAAATCTATTTTGG CCTTATCGCTTAGAATCAACTACACTACACTACAGTGAAACAGTTTTGCT TTTCGGATTAAAAACAAAAAAAAAAAATTGTTTAAGTGTAATGGCTAACA TCGAGCACACACACACACACACCAACATTCACGCTGCAACTACTACTTAG TGAATAGAATTGGGTAGGTCGTAAGTATATTTATATACAGAACAGGAGAA CAGGACTTGCAACAGTTTTCTTAAAGTGTTCTTACATATCTTCAACTAAC TTTTTCCGTCGAGTGTTAACTTTCGCTAATACATATATTACTTGTGCAAA CTACAATGGGTGGTGGTGGGTGGAACGTATGGAGCGAGAGCTAGATAGAC AGAGAGCTAGAGAGCGAACGAGACGGAGGATCGGAGAGTGTTTTTCGTGG CCTTTTGTGTGTGCGTGCTGCAATTTTTCAACATGGTTGAATTGGTATTT CGCCTTGTTTTATTTGCATCTGCACAGCAGAGAGAGTAAATGTGAGTTTT AACTTGTTGCTTGCTTTATTTTCCCTAATTTGCTGTTTGTTTTTGTTTGC TTGTGTGCCCAGCCTTGGTCGAAATAATAGTGTGGCCTTGCTGCACTGAG CAGCACCGGAAATATAAGCTAATTTCCAATAGGGTCGATCAAATGAAGTA CACTATTTCTACGTTTTTCATTTAAAATTGAGTTTGAAATACGCCTTTTT GAGTACATATGTATGTATAAAATTGAAGATACAAATATCTCACGACCATA CAACCCTTCGAATACATTCGTAAAACATAACTAAAGTTATACATTTTATA ATTACAATAAAATTTTATTCAATTTTCCAATCTCTAATGGCACTACAATT ATTTCTTCCACAACTGATCCGTGTCTTCTATTTTGTGTGGTATAACTATG TTAGTTTTGTATAAAATGTTTGTGTGTTTTCCGCTGTGCCAACAACTTTG GTGAGTTGTTCCTTTATTTTGTGTTTTAGTTTGTCTGTGTTTTGGGTATT TGCAATTCGTTTAATGTATATATGTATGTATATATATATTTGCATGTTAT ATAGTTGTATATAAAAAGAGCATTTCGTTAATTTAACGCCTAATAAGGGT TTCCTCCTTTTGGTTTCTCCTTTTAAATGCAGTTATTGACCTGAACATTG TTTGTGGTTGTTGTAGATTAATTTATATTCCTTATGCTTTCTCTATAATA AACATGTAGGTATTTTATGTATTTTTATGTGTAAATGTTTTTTTGTTCAT TATTTTGCTTTACTGAATCCCTTTTAAAATAGTCGAACAACTTGGTATGG CTTCTTTTCGTTTTTTCGTTATCGTTTTCCTTTATATTGCTTGAGTTAAG AATTTTTCCTTTCTTGTTGGCTTTTGCTTGTTTTAATTGTGTAACTTTTT AATGAATATTATGTTTTCTTTTGTGAAATTTGTTTCGTTAACGTTTTTTC TTGTTCTTTTCATTTGTGCAGTGTTGCTTCTGGTTCTTCATTCTTGGTTT TTTGTTTTTTAGATTTCTGACGTCACAAAAATTTTACGTATATGTTGCTG TGGTTGTTGTTGTTGGTTCTCGCAACGGATTCTCAAACAAAAAAAAAAAA CAGCATAAATCGCTTATACAAAAAAAAGGTGAATAAATTAAAAATAACAC ACACACTCCATTTAAAAATTAAAGGTCCTCAAACAGCGAAAAGCCGAGAC AAAGACGGACTTAGATTCCCGGGAATATTTGAACGAAAACTCGTTTGGAA ATGTTCAGGAGCACCTAGTCATCTTTCGCCGACTGTGTCTTCGCTTTTCC ACCGTTTTGGTTATTATTTTTGGGGTCGAGGCTTACAAATTGCCGTAAAT AAATAGTTTTGCGCTTAGAACTAAATTCCACTTAACTTAGGCTTTTTAAA ATATACACGTATGAATAGTGGTCACAAAAAAGTATTCGTTACGGTTAATC GTAGTTTTCTACTATTTATATAACAATAGGCAACAACACAGGGCAGAGAA CTGTTGTAGGTTGGGTGTACATGGCTGTATGCACAGCAGCGGTCAAGGCA ATAGCACAATAAGACAGACTCGAAGAGAAGCGTGGTTCAGAATTCCAAGC AATTATCATTAGATAAGGGTTTGTAAATATTGCTTGTGATAAATGGCATT TAGGGAATGCCAAATGGCATATGGCCATATGAAATGTTGCACTATAAAAC AATTTTAAAATTCAAAAATAAAGAAGTGACTACAATGCGCTTTTGTTTCG ACCGCTACCTTCGACACTGCAGCCCCTTTCAAGCAGCTTTTACAACTTGA ATCAATCAGAAGAGGTCGGTTTTTTTACAATACAATCTGGGTGTACATAT ATACTTGTATATATACATGTGTGTGTGAGTCGTTTTCGCACGCAAGTGAA AGGGAGAGGACGCTGGTAGACATGGACAGAGATAGAGATAGACATAGAGT AAGACGCGACTTAGGCTAAACATAAAAACAAGCTGGGATCTCCGGATACC AATGATTCCTACAATGGCGCCGCTCCTTTTGCTCAACTGGGGGTTCACCT TCTCGTAATCGCTGTAGAATCCGCCACGTTAGCTTTCCATTTACCTCTCA ACGCGTCCGCCGCCGGGAGCTGCCGTTTCTGGTGTCCTGGCGCGGATTGG ACAATTCTTATGACGTCTCTAAAAATCATACCTTAAAGGTCTTCTCGCGT CGCTCCCGCTGTTGCTGTTGTTGCTGCTGCTGTTGCTGCTGATCCCGCGC ATGGTGATCCCGCTGGTGCTGGTGACTGCTGCTCCTGTGACCAGTAGTTC CATTGGCTGGCTGCAGCATGGAGCTCATGGAGCCGGCGCTGCAGAGCGCT GAGGAGTTGACCTCTTCGCAGGCATAGCTGGCAATGCGGTGATCGCTCCG CGACCGCTCGCGATCGTGGCTGCGGTGGTGATCCTGACTGACAATCGGTG CACCTGCTCCTCCGTTTCTCTTGCTCGGAGCCGCCTGCTGCTGCGATCTT CGGTTGCCCAAACGCTTCAGTTCATAGTCCCTGGCATCGGCCACATCGAA AGTGGCTGCTCTTTGCTGACCTTGCTTGCCGTGCTTAGAGGCAGAGCTAG TAGCTACCGCTCCTCCACCCGTCGGACCGCCAGTTCCTCCTGCAACCGCA TGCATTTCATAGGCCTGGGGGTAGAACTCATCATACTCGTGCTCCTCACA CAGATTGGCGTTGCAGGGCGCCTGCTGCTCCCGCTCTAGGTTGCGCTCCC TCTCCCGCTGGCGATGCTTCTTGGGTGGCAGGGGAACAGGCGCCTGGTTC TGCGATTGCGTCTGGTTTTGGGTGTGGGTCTGAGTTTGTGTAGCCGCCGC CGCGTGCAGCGATGTGGACGATGCGCCTCGGCGCACCACATCCACACCGC CGCCGCAGCAGGCGCACTCCTACAACTCCGTCACCGAGTACAGATCGCTC TGGTTGCTGATGGCGGCTCCTCCGCCAGTAACTCCTCCGCTGCCAGTAGA TACGCGTTCTCCCCGTTTCAGGGATCTGTAAAACAGCGCCTGCTGTTGCT GCTGCTGCTGTTCCAGCATTAGCTGTTGCTGCTGCTTCGATGAGAAGTTG TTGTTGTGCTGCCTTTGATAAAAGGCCTGCTGCTGCTGCTGCTGATGGTA GCTGCTGTCATAGGAGTGTTGCTTCTTCATGTTGCTGCTGGTTATCAGAT GGCTGGGATACTGTTGCTGCTGTTCTATGTAGCTGCGTGCATTGTCCAAG GTCTCAGCCCTCCGCGGACGCTCCCGCTCCCGTTCTCGCTCCCTGTCGCG CTCCTGCTGCTGCTGCTGCTGTTGTTGTTGTTGTCTCAAGCTGGCTGACT TGGGCGGCAAGGTTTGCATATGATTGGCATTGCTGCTGTCGATGGCTCCA CCGCGATTGCTGTTTTTGTGCCGGTTCTTGGGCGGGAGCGTTGGTGGCTG CTGCGGCGAGGAGATGGCAGCCGGCTGCAATTTCTGGGTTTGAGGACGCT GCAGCGAGCGGTACTGCCCCAAGCTGGCGGCGCAAAGCGGCTGAGCGGAG ATCTTTGACTGTTGTTGATTGGTGGGAATCTCGGGCAACGGTTGGTTCAC AATGGAGGCGGGATTTAGCGAACGCTGCTGCGCACGCGGTGCCGCTGTGG GCAGCACCTCACTGCTCTCGATGCTGTAGACAGCCGAAGCGGGTAGAATG TGGGTGGTCGGTGGATGCAACTCCCTTTGATGCTGCTGCTGCTGCTGTTG CTGCAGCTCCCGCTCGCGCTGCTGCTGGAGGGTGAGCAGCTGCTGTTGCT GCTGCTGTTGCTGCTGCTGCTGCAGGGCCAACAGTTGCTGCTGTTGTTGC TGCTCCTTGGCATACGAGCTGCCCACGCCCGTGGTGCCGGGAATTTCCGT AAACGTATTGACTATCTTTGGTTTGGGTGGAGGCGGAGGCGCCGGTTGCG GCGGAGCGGGAGGCACCATCTGCTGTTGTTGGAGTTGCAGCTGTTGCTGC TGAAGCTGCTGCTGCAGTTGCTGTTGCTGCTGTTGTTGTTGCTGCTGCAG CTGTTGTTGCTGCTGCTGCTGCTGCTGCTGGAGGAGGAACTCCTGAGGAA TGCAGTCCGGCTGCTGGCAATAATCCTTCGAAACGGTGGCTATCGACGGC GTCTTGGCGCTCCTCAAGTTTGGCGAATGGACAGCTGGGGCGGCGGCGGG CGAGGGCGTGGCATTGACGGCAGACACACCCTTGAGCGAGCCACCATAGC GACCAACATGCCGCAAGGTGGCACACTTGTTGGCACCTCCGGCGACGGAC ATAATATTTAAATTATTATTCTGACCCCTCACCGCTTTGGGGCCAATGCT TATGTACTTGGGGTCGAAACGATTGAAGCTGTTGTTGGTCACATCCCTAG GATCGCGATCGTCCACCATGTCGCCGTCCAGTCCGTTGCCCGTGGAGCGG CAAATGCCCGCATTGGAGGTTTGAACGGAGAGCACGGACCGAATGGAGCT GCCCGTCGAGCGGGGCAGGGTGGCCGACGCAAAGATGTTCTTCAGCGTGC TCTGGCTTTGGTTCTGATTGATGAGGTTGCTCTGCTGCTGGTGCTGCTGG AGCTGCAAGTTCTGCTGCTGCTGCTGTGCTGTGTTGCTGCTACTGCCTGC ATGGGAACTGCAGGCAAGCGAATCTCAGTAGAAGTCGTTGGACTCGAGCG TTTTACACTGCTTGCTGAGCGTCGCGTACTTTCCATTGTTGGGTCCTGGC AAATACGTCGCCGATTGCTGGTGGTGCGATGGAAGGCGTCCTAGCGTGTG GTGTCCTGACCTGAAAGTCGAAGTGTTTATTTTAGTGCTCGGCCAATTTC AGTTGAGAAGGAGAGGTGGGTGATTTAGTTGAATTTAGTTAGCCTTTCAT TATGAACGTAATGTTTGCTTTAACGGAGATGCTGGTCTACAACTGTTGGA ATATTTAAGGAAGTCCTACGATTTCAATCAAAGATGACTGTACTGCACTA AGTCGCCTTAAAAAGGAACCTCTAGGTTAAAGAAAATCTGTTTCTAACTT TTTTGGCAACT