##gff-version 3 ##date Tue Nov 28 10:23:21 CET 2023 ## exported from the transgeneomics system molecule_59050872 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59050872 mpicbg region 9631 13900 . + . Name=dmel-5.43-2L;type=genome;start=11948464;end=11952733;strand=- molecule_59050872 mpicbg region 13901 13973 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59050872 mpicbg region 13974 14962 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59050872 mpicbg region 14963 42573 . + . Name=dmel-5.43-2L;type=genome;start=11920853;end=11948463;strand=- molecule_59050872 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59050872 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59050872 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59050872 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59050872 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59050872 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59050872 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59050872 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59050872 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59050872 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59050872 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59050872 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59050872 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59050872 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59050872 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59050872 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59050872 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59050872 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59050872 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59050872 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59050872 coding_transcript gene 13730 15461 . - . alias=BcDNA:GH05159;identifier=FBgn0032385;id=51029119;ensembl=FBgn0032385;Name=CG16964 molecule_59050872 coding_transcript mrna 13730 15461 . - . id=51029125;parent=51029119;Name=FBtr0080282 molecule_59050872 coding_transcript exon 13730 15321 . - . parent=51029125 molecule_59050872 coding_transcript three_prime_utr 13730 13897 . - . parent=51029125 molecule_59050872 coding_transcript cds 13898 15316 . - . parent=51029125 molecule_59050872 CLC misc_recomb 13974 14007 . - . Name=FRT molecule_59050872 CLC cds 14015 14086 . - . Name=BLRP molecule_59050872 CLC cds 14087 14107 . - . Name=TEV molecule_59050872 CLC cds 14108 14131 . - . Name=Precision cut site molecule_59050872 CLC cds 14132 14173 . - . Name=V5 molecule_59050872 CLC cds 14180 14896 . - . Name=SGFP molecule_59050872 CLC cds 14903 14962 . - . Name=2xTY1 molecule_59050872 coding_transcript five_prime_utr 15317 15321 . - . parent=51029125 molecule_59050872 coding_transcript intron 15322 15391 . - . parent=51029125 molecule_59050872 coding_transcript exon 15392 15461 . - . parent=51029125 molecule_59050872 coding_transcript five_prime_utr 15392 15461 . - . parent=51029125 molecule_59050872 coding_transcript gene 16670 19285 . - . alias=droscrystallin;Name=Cry;ensembl=FBgn0005664;id=50888875;alias=c;identifier=FBgn0005664;alias=DmelCry;alias=Drosocrystallin;alias=drosocrystallin;alias=dcy;alias=crystallin;alias=Cyrstallin;alias=Crystallin;alias=CG16963 molecule_59050872 coding_transcript gene 24224 25457 . - . ensembl=FBgn0026390;alias=33c;identifier=FBgn0026390;alias=DOR33B.3;alias=Or33B.3;alias=AN2;alias=Or71;Name=Or33c;alias=Olfactory receptor 33B.3;alias=33B.3;alias=CG5006;id=51362962;alias=Odorant receptor 33c;alias=dor71;alias=DOR71 molecule_59050872 coding_transcript gene 25925 27245 . - . alias=Or72;alias=DOR72;alias=CG16961;alias=33b;alias=Olfactory receptor 33B.2;alias=Odorant receptor 33b;identifier=FBgn0026391;id=51362992;alias=AN1;alias=DOR33B.2;alias=Or33B.2;alias=33B.2;alias=dor72;Name=Or33b;ensembl=FBgn0026391 molecule_59050872 coding_transcript gene 27710 28921 . - . alias=DOR73;alias=Or33B.1;alias=CG16960;Name=Or33a;alias=Odorant receptor 33a;alias=33a;alias=Or73;alias=DOR33B.1;id=51362914;identifier=FBgn0026392;alias=dor73;ensembl=FBgn0026392;alias=Olfactory receptor 33B.1;alias=33B.1;alias=AN3 ##FASTA >molecule_59050872 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACACAGCAAGAAATTACAACAC ATTACAATGGATGGGGGCATTCGGCAAGTGTGAGAGCGTTCCCTTAAGTC GGCGCTACCCGTCTCTCTCTCTCGCTTCCCTTACAGCCGTCTCTTTCCAA CGCTAAACGCTTCAATGATTTTGTCATGCATAAATTTTGCAGGTTTGCTG AAATTTCTGCACTCCGCCGGGCGAGAATCAAATAAATTCCGGCACAAAAC TCTTTTTCCCTTCTGGCCAAGTTCCGCTCGAGCACATTTATGCGGAAGAA GAGGGGTCTTTTTAATGATGACGCTTCCTGTTGGCCGGCCGCACATATAT TTATGAGACACCTTGGCGTTGATAAGTCCCAGACGAAGCTTCAATTGAAA TTTGTACTTAATTAAGTCTGGTATGGCGAACCGGCGTTTCTTTGATCATC GACTAAGAAGGAATTCTGAGAATTCGTCAAGTAGCCTACACTTGGGAGCA ATTATTCACTTAGGCTTAAAAACAATATTTTTTAAACGCGGGAAAATAGA ATTTACAAATATTTTCTCAAAATAAAAGGTGGGAAAACAATTGTAGAGGC AATAGTTTTTTATGAAAGAAGTTTATACCCCAAAACAAGAAACTGTAGAA ATTCTATAGCAAACCTATATATAAGATTAACAATTTAAATATTCGACTAA TTCGACTTTTTTAATTAATACTTAGATATGTATATGAAAATATGAAAATA ATTTGTTGAAATCATAAAATTGTATTAGTTTACCAATAAATCAAGCAAGC AACTTAAGATATTAATTTGGTTTTTCTTGAATGTGTTTTCCGTTGACTTT TAAATAAAAACCAAAATTGCAATGAGTCTAACGAGCTGCAACAAAGTTGC ATATTTTTCGTATTATAAATAATGATATTGTTAATGCAATCTGCATTCCA TTGGTTCATTATATTAGTTACGGAAGTGCATACATATAATCCAGCCAGCT GGTAGGGAAAACAAATTGATTGGCGGCAAATGGTTTAAATTTCTGCATAA TTCAATGCGCACGCGTTCTGGTTTTAGTTTCGGCAATTTTCTTCTCCTTT ATTTTCCCGCAAACACAGCTGCAGAAAATGGTCAAGAAAACTTGGTGGGA ACCATAAGAGAAGGGGGACGCAGGAGGAGGATGTAGTTGGGCCTGCTCCG ATTCGGAATCATTAAATAGACGACAGGCGAAATCGAAATTGCAGTGCCAA AGTTGCCGCCTGCTGTTGTGGCAGTTGGAGTTTTTTGAAATCTGAGATGG GAAGATAGTTCTTCTTATCTAGGTACTTACTTTTTGGTAGTACAGCTGCA AATTTTATATCATACACATCCCAAGCTTTTAAGAAAACATTACAGATTAA AAGTTACAGATTACAGATTACTGTTATGACGACAGCCATTACCCAAGAAA AAACCTAAGAAAATAGTTCAAGACAATGTAAAGCTCAACTCATTTAAATA TTAATACATTATTATTTGTTTTTGTACAAGCTTTTGTACAAGCTGTACCT AAAGTTAAGATTTGTACCTGAATCCTTCGCATCACTGGTGGTAAGTTGTT GTTGCTGGTGTCGCAGGGGGTTGTTGGGAAAATTTGAAAATTACCTTTAA TCAGAGCGAAAATGAGATGGCTAATTTGAGTGTGCCGGAATCGGAATTTG GCTGGAAAATGGAAAATGCCGACTGTGGGAATTGCCGTTCTTGTCATTTC GGTCAGTGGGAAAACTTTTTGGCGTGGGTGGGCGACAGAGACAGCAGCTG TGCGTCGGAATGCGTGCCGTCTCTTTCCCGCTTCGTTGATCCTAAACTCG ATGAGAACTGGACTTGGTTCACATAAACAAAAGAAGTCGCTGACCATGTT ATGCAAAATTGCCGCACGGCACAAAAAGATCTAAGATAAAGCAGTGGACT TAAATATCTAAAGATATATTTTAAACATAGGTGAATAGACTGCTAAGGTA AAGATATTCACCAATGATGTTTGAAATATGATTTATATTGTGGTTCCAAG ATGATATTTCGATTTTTAGATCCTAATTACTAGAAATATATGCAAACCTT TTCAGCAAACTGTTTCAACTTGTTTATTTTGACCAAAATATAGCATAGTC TGTTTATGCCTATCACAAGTTGGTAAATAACTTAAGCTATCTTATAAGCT TATTTTAAATGTTTTCCTAAGTGCTCAGATTTTTCTCGCCGTGCAGTCAG AAAGAGAGGCAGCTAGCACGCGTTGCGCTCGCCTGTTTTGATCTATGAGC TGCGATTACGAGGCGCAGCTAAAAGCTGCACAAATAAAGCGCGGCGATCT GCTCAAGTTGATCCCCAAGTGAGGCAGCTGCTGCGAATTTTTGCTCCGTT GCTGCCAGCAGTTGCAAATGATGATGAGGCAGCGGCATCAACAACAATAA CAGCCGCCACAGCGGCAGCAACGCGACTCGGGCCAGGAGGCCATGACAAG CGACAAGTTGTCGTTAGGCCCAAAATTAGATGCATTTTGTATGCCAGGCA TAGATCGCAGGCGAGAGCAATAGCTTACACTGCGAAAAATAAGCAATTCT TTCAATAATATAAAAGTAGTTTTAAATATCATCTGTCGTACGATCGCATT TGTACAAATGGTTTTGTATAAAACTCTGTTAGGGATATTGTCCATTTAAT TGCATCATCTGCAGCTCTTTTTTCCCTCAGTGTAGCCATTCACCTATGTG GGAAAGAGAAGGCCAGCCGGCGAGTTGACTGCAGTTATAGGCTTAGGGTA AACATTTGGCGACGCATCAATGCAGCTGGCCAAGAGCTACAAAAACAGCA ACTACAACAACAACAACAGCGAAACATCATACAGCAACAACAAGCAACAC AACAACAGCAGCAACAGCAACAACATTAAGCTGCAGCTTGTGGAGTGTGC AAATATTTTAGCAGCAATTTTCAGCTTAAATGCCTGCAAAACGAGGCGCA TCGTGTGCCCAACAGCTTTTGGCGGCTCAGAGGTTTTCTTTATACATATG TATGTATTTCCCGGTATGATAATTATGTCCTAAAGTTGAAAACAAAATCC GTTGCGAATAATATGAGAAAATGTAGTATTTAAATTTAATAACCAACTGT TTCTACATTTGATTTAAACAGTTAAATTGTTGTTAAATTTAAAGAATATA GAAATTTTATCAGAATATAATGCTGTAAAAATATTATATATTATATATAT TTTTATTTCAAAATTAACTTGCATCGTATCAAACAAACCTCTTAAATTAA AGCAAGCTTTTATTCCCTGTTAAAAGTTAGTACCCAGTATATGAATATGT AAGTACATTATGTGAATCACCTGGCAATTAGTAAGGAATCACACGCAAAA GGGGTTATATTCGAAATATAATAATAACTATTTTATCACAACAGAATCTT GTGAAGAACCTATATCTAGAAACTCCCAATTAATAGGAAGCATACGCTAA TTTCGATTACCGGGTAATTAAGTAATATCTAAAACGAGCCAGAGAAGCCC TTAGAACCAGATATTCAGATAGTAGTTCTCTCTGTTTTTCAGATACTCTC TCTCTCTATGGGATCTTCGGGGAATTTCCTAGTGCTAATTAGTAAGCGGC GTACACGTGATGGCAATGACTCTTGATATCGGTTCATAGATCTCACAATG CAAAACAGATACCCGGTTGTTTTCAGTTCCAAAGATCTCTGATATCTCTG ATAGCTCAGCTATCGTATTGCGTCAATGTGTGACGACCTCGAAGACGGAT CTACGTAGATATCCCTAAATCAGAATCCAATGTTCGGTTTTTGTTTTGGT ATTCCGCCGCTGGTTTGGTTTGTCCCTGAATTTGTGCAGCAACCCCGTTC CCGATTCGAGTTTCCGTTATGCCCCCCTTCCACAGTTCTTGTTGCGTGTT GATTGATTTTATGCGAATTTCTGATACAAATTTATTAACAATTCAAATTG CAAGTTGAAGTTAAAAACTCAAGGCAAAAAGAACGGAAAGAGTAGGTTTT AAATTCAGTGGCTGTCAAACTGTTTTGGTTCGAGCCTATGAGGCGCTTAG CTTAGAAACCAACCAAACTGGTGAGTTTTGCTGTGTGCCTAACTAGGCTG CGGTGAGTTTATTGATTTGAAATTATTTTTAGTTGTTGTCTGTAAACATT AATATTTTGAATATTTCTATCTTTAATAGTAAGTAAATAATTCAATCCTC ATTGTATGATATCATCGCTTATCTATTAATGAGATTATTGTCACCAACTA CTTGTCGTCGTCATCCTTGTAGTCAATGTCATGATCTTTATAGTCTCCAT CGTGGTCTTTATAATCTGTCGACGAAGTTCCTATACTTTCTAGAGAATAG GAACTTCCCGAGGATCCGCTGCCGCCGGCGTTGCTGCGCCACTCCATCTT CTGGCTATCCAGGATCTGGCGCAGGCTGCTGGCCATGCCCTGGAAGTACA GGTTCTCGGGGCCCTGGAACAGCACCTCCAGGGTGCTATCCAGGCCCAGC AGGGGGTTGGGGATGGGCTTGCCCTCGAGCTTGTACAGCTCATCCATGCC CAGGGTGATGCCGGCGGCGGTCACGAACTCCAGCAGCACCATGTGATCGC GCTTCTCGTTGGGGTCCTTGGACAGCACGCTCTGGGTGCTCAGGTAGTGG TTATCGGGCAGCAGCACTGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTA GTGATCGGCCAGCTGCACGGAGCCATCCTCCACATTGTGGCGGATCTTGA AGTTGGCCTTGATGCCGTTCTTCTGCTTATCGGCGGTGATGTACACGTTG TGGCTGTTGAAGTTGTACTCCAGCTTGTGGCCCAGGATGTTGCCATCCTC CTTGAAATCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTATCGCCCT CGAACTTCACCTCGGCGCGGGTCTTGTAGGTGCCGTCATCCTTGAAGCTG ATGGTGCGCTCCTGCACGTAGCCCTCGGGCATGGCGCTCTTGAAGAAATC GTGCTGCTTCATGTGATCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGG TCAGGGTGGTCACCAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTG CAGATGAACTTCAGGGTCAGCTTGCCGTTGGTGGCGTCGCCCTCGCCCTC GCCGCGCACGCTGAACTTGTGGCCGTTCACGTCGCCATCCAGCTCCACCA GGATGGGCACCACGCCGGTGAACAGCTCCTCGCCCTTGGACACCATGAAT TCATCAAGTGGATCTTGGTTTGTGTGAACCTCGTCCAGCGGGTCCTGATT GGTATGCACTTCCTTGTTTACATATTCAATCTTACGCTTTTGCAACTCAT CAATTTTCTTTGAATACTCATCTGCTGCTTGCTTGGCGCGAAGAGTAGCT TCATTTAAATCGTAAATGGAAAACGGATGATAGTTGTAGGTGAACATTTT CGTCTGCCCATCAACCAGTTGATCCTGATTTTGAACACACCTTGGGCTTA TAAAGTAGGGTAGCTTCATATTGGATACGCCGTCCACTTCCTCAGCTTTT TGCTCAAATTTTTCTTCGGAACTTGCGTGGGATTTAATCAATGTCGGGAA TCTGCGAAAATGGGTCAGTGGCCAGATGGGAAGTTTCTTTGCGCTGCCTC TCATCGTGGTCAACATTTTTGCTAAAATCGGAGACAGGAAGTAGTAGAGG TTTTTCGGAATGATGTCCAAAAGTCAAGAGGATTCACTTACTAGCTACGT TTTTTTCTCGTTTTTTGAGCTCTGAGCTCGAATTCGGTTTTTGTGTGCTG CTTTGTTTGTGTGCCACGGACTTGACATTCGCAGCGCAGGCAAACTGTTT CCCAGTTCTTCAGCACTTGTTTTTCTTTTCCCGCTTTTCCTTCTGCCCAT GTCAAGCCCATTGTCAAGCCGAAGGGCTTAAGGCAACCAGTCGGGCTGCG CTTTTGATGAACTTTTAAGTGATTTCCTGGCGAGGACTCACTTGCGTCAT GCACAACAGCTGCAAGTAGCTCACCATGTCACTTCACCAGGGGCTTTTTA TTTAATTTACCAAATTTTGACATTAACCGATGTCGCTGAGGCGCTAAAGT TGTGCAGCTTGTCATTATTTTAAAGCTTAACAAGTTGTATACAAGATTTA TTTCCTAAAATCAGTATTAAGTGTATTTACTTGTTTTGTTAAGAAACTGG TGAAAATAGTGAAATTTAATTATTTCTGCCTTCTAATCTACCTTCAAAAG GACTTAACAGCTGTCAAATAGAAGAAACGTTTATAATTCAACGAATCCAC TGGATTTCCCAATTTATAATAAATGATTGCATAATCAGATTTATGAACAC CTTAGACCTTAAATCAAAATGTTTACAAAGGAAAGCTTAAGAATTTACTA AGTATTTACCGCAATCTCCCAATCGATGTGGTTTTCATCCGACCACAATT TTCATTTACCTCCGACTGGTTTTCATTACCTCTTGCCACTTTATTATTGC CTTGGCATCTTAACAGCCACAGCAAAGCTAACCTTTCCTCCCTTCCCAAG TCAAACACTAAAGTGCAACTTTATTTTTAAGTGTACACGAGACAAACTTT ATGGAATGGAGCAGAAAACTTTCAGCATTCCCTCCACGCTGTTTATTATT AAAAAATTTGTAGCCATTCGCCTGGCTGTCCCAAGGAAACTTAGCTTCAG GGTTTATGGCCAAGTGGCGTGCACACGTGTCCATGAAGGTTGAATTGTGG GGCAGAAAAGTGAGAGAGGGGCGAAACTCGTGTGTGAAAGTGCAGCATCC ATGACCAAAGTGTCAGAGTCCATGAAAGGCGATTAGGGTCAACTGGCTTT GGTTAGTTGGCCAGAAGGAGTGCAAGAGCCAAAACGGAAAATCCTTTACC ACCACCTGTGGACGACGCTCAAATCTGGTGCTGGTAAGTTAGCCGAACTT AATTGGCAAGTTGACACGAATTAAGTTTTGCAAAAGAGCATGCCGACTTA GTTGAAGTCCAGCAGCCTTCTTTGAATAATCTGGTTTATTTTTTTTACAT TTTCACATTGATGCAGTTGACTAACTATAGAGTAACACAAAAACAATTAG ACTTACAACTAAAGTTAGCGGAATGGAAAGCGTTAGAGCTTGGGTTAGAT TCTTGGCAGAGTTTGCTGTATGCATTAGATGGGTCGAAAAGCTGAGAGAA TTACCAAAATCCCCGATTCTAGGCTAGGTGAACACAAGATTCGATCTAGA ACTTATGGTCTAAACATATTCGTTGTCCGGTTGGCAGATCGCTGAGGTCG CTGGTTGGAGTTTCGTATGAGTTCAGTTGAAGATTGGGTTGAATCATTTC CATGTTCCGGAGTGTCTACCAGTTCTTAGAGCGACGTTCGGCACTGTTGG AACGCAACTCCTCGCTTTCTCGCCGATTATCTGCACGGTCATCCAGCCTG TCCAGCTGCCAGAGATCGTTGTTCAGCAGGCGGCGTCCATTGGACCAACT CAAGGCGGCTCCAGCTCGTGCAGCATTGCCATTCAGCCGGGTGGTTATCA ATCCGTTGAGGTTTCCGGACTCCAAAAGCAGTGGCGAACTGATCAGCTGA GCCTGAACGGTGGCACTGGATGGCTGACTGAGGATCAGCGGTTGGGAGCT GCGATCGATAGTGATGCGGGCATTGGGCAACTGGCGCCAGGCCTCCAGAT CGCGTTCCCTGGTCAGCAGAGTGGTAGTCCTCGACGAGCTGGTGGTGGTG CTGACGGGCAGGCGGGTGGCGAGCAAAGTGGGTGGATGGGAGACCACGGT GGCCTGAATGCTGGGCAGGCTTTGGGCCAGGAGTAGGGTCTGCTGGTCGA GCAATCGCTGGTTCTGACTCTGACGACGCTCCGCTTGCTGGCGGCGATCC TCGCGGTCACGCTGCTCCCGATCACGCTGTTCCCGATCCCGGAGTTCACG ATCACGGAGTTCACGATCACGGAGTTCGCGCTCGCGCAGCTCCCGTTCCC GGAGTTCCTGTTCCCGCTGCTGGCGCTCGCGCTGTTCCCGCTCACGCTGC TCCCGCTCCCGCTGCTCACGATCACGCTCCTCGCGATCTCGTTGCTCCTG CAGGCGCTGCAGATCCCTCAATTGTTGTTCCTGCTGCAGACGCTGCTGCT CCTGCTGTTGCACCTGTTGTTGGAACTGTTCCATGAGCTGTTGGGCTTGG TTGCGTGCCTGGTTTTCCGATTCTCGACGATTCTGCGCCTCCAGCTGCAG TTGGCTAGCCTGTTGGGCCTCCACCAGAGATTGGGCTTCCGCAATGGCCT GGGCGGTGAGACGGGTCTGCAGTTCCTCGAGGCTGTTGAAACGGGACGAA GTGGAGGCGGAGAGCCTTTGCTGCTGCTGCTCATCCAGACGCTGCTTAGA CACAATGGCATTGAAGCCACTCACATCATCGGCCGTGTACTCCACAATGC GACGGGTGCCATCGGGTTCGATCAGGGAGTACTGACCCTTGACCAGGTCG CCATCGCGCTTCTCCTCCTGCCGCTTGTCATCGCCAGTCAGCGAGTCCCT CACATCGTAGGCAAAACTGTACTGGGGACGAGTGTCGTAATCCTCGTTGG AATTGGGTGCCAAGGTGGTGGCATCATCGTCATCGTTGTTATCATCTCGG TTCAAAGCGCCACGCAGCTGCTGTTGCTGCTGCTGCTGAAGGTTGGAGGA CTTGGCTAGCTGGTTAAGATCGATTGGACGCAGGTATGCCGAATTGGCCA CATTGCAGGTGAGGAGACTCAGGCAGAGCAACAAGTATGTCTGGAATTGG AAAGGATTCACACAGGATTCGAATTAAATAGTTATCCGGTATAAATCACC CGTTGGCCTCATCAATTTGTCATTCCACAATGGCTTTCCCTTTTTATTTG TTAGTTGCGAGGGTAATAAATTAAAAACGACAACAGGCGATTCTTGTTAC CGAACAAAAAGTTGTTGGGATTTGTTGGTTTGTCTGACTCTATTGGCTGT CAAGTTTACAAAAAGAATAAGCTCAGTTGTCTGGAACAATAGTATAAAAT ACACTGATAGCTGGTGGTAGATAAAATGAATCAACATTGAAATATCTAAT AATCTTGAATGATTTAAAGTTTAGTATCATTTACTCTGTAACTTAATAAC TTATTAAATGAATTGTGTATTTTAGAAAATATTTTAGGTAAATATTCATT TACTCAATTTTTTTGCCTATCTTTTCTCACAATGAACGAAAAATGATTGA GTTAAAAATGTTAGGAAAAATTATTATCCAAATATATGCAAAACATAATA TATTATCCTATCGTTTTTATACTTGGTTTTATCCCCAACCAAGCTCGGTT GATTTCCATTTGGCTTATGCCACATCTCTGGGCTTTTAAATTGGCCTAAA ACGCTGTGGCCCTTATCGTTTTGTATTTTTGATTATCCTGATTTATGGTC CCAACTTCCACTTTGCCGGATTTACATGGCGGCAGAACAGCAACGAATAT TTATGGCCGGCAGCGGTTGACGGAAAACTTACCCGTTTCATGGCTGCTGA CGTTAAGTATACGACTAGTTGGCTGCTGCTTATTTGTTTGGCTACTGCTG CTGTTTTCCGTTTGCTGCCGATGGCGAACTGATGCCACCACCAACGCCCA CTGGCCATTTTATAACGACAGGGCATAAAAGGGCCATCGCCAGAACCAGA CCACACCTGATATGCCGGGCACCAGCTTTCAAATTTGTTTAGTTAAGGTT ACAAATGACCTTCCCGAGGCACTGATACACAGATACAGATGCAGATTAAT TGGAGCTGCACTGCAGCATTCACTTTTAAGCCATGCCAGTACGAAATTGT CACCCACTGGGCCAAAACCAATGTGGGGCGCTGGAAGTGGGCGGCAAATC GGTTGACGCTTATGAAAACGGCCAGCAAACATTGCGTACGGAAATTGAAA ATAGGCCTGTCTTTGTTGCGCTTCGGTCTCATGAATTCGAAATTTTGTAA TCCCTACTCCATCCGAACGAGATCCGATTGCAAAATGCTTAAAAAGTAAC CAGGCGTTGGTATAGGCGGCAAAAAAAAAGGGGGAAATTCGATAGCTGAC CACAAGTAAGTAAAAGAGGTTCCGGGCTGGAACGGTCACCCTAATGGACT TCCCCTGTAACCAGGCACACTTTATCGATTATCTCGGATTCATCATTATC CGACAGGTTTTTCATCATCATGTGTAGTAACGAGAGCTGTGGCTCATTTG TTGTCTTTTGCGTAGATAGTTCGTAGGAAGTGAATATATCTGGTCAACGG ATGTGGGTTTTTGGGAGGCTTCCTTGTTTCACGCAATGCAGGCGATTGAT TTATGATTCGATGTAGGGAATTACACAGCTCTGTAAGTTTTCCAATTTGG ATTTTATTAAGATTGGTAATTGCAAATTTCTATCGATTTACCCAAAAACT TCTTGCTACGCCCCATTTTTGAATCATTTTTCGATATTTCTTTATCTTTA AAATTAGTCTTGTAAATTTATATAGATTTAAATGTGCTTAATAATATCAC CTAGAAACAGGAAAAGCAAGCCAATGACCACAAATTGTAAATGATTGTAA CTTAAACAAAGAGTCAATGACTCAGTACTGATTATTCAATAGTTTGCTTT ACAACAGCAATAAAAATTGACAAATAGTGTGTCAGCAGCTATCAGTTAAA TCTATACCCAGCGATTAATGTGCTCGACCTTAAAGTAATCTTTTATGAGA TACTCATATATGAGTTGGACACATTAATGGGCGGCACGATAAGTCGGCTT TGGGATGCGTACTAACTTTATCAGCTGCAAAAACAAAAGTGGGGCCAAAA CATCAAGCCAGAACATCTGTGTCAGTGCGTTCGTAAACAAAAAGAAATCT TCAACGTGATCCAAACAAAGGGGCCCCAACAATAACAACAGGAGCCGTGG CAAAGGAAAACCCAAAGCAAAAAAGCACAGGCAACTGTCTGGAAAAAATT GTCATGCATGACTAAAATACAAGAGTAAGAGCACAAGTAGCACTGCACAG TGAAATGAAAGAAAGGAAATTAAATTGTCTAAAAAATATATACATATTAC TTACAATTTATGTTTTTAATAAGTTAACCTAAAGGTTCTAGAAATTTTAA TAACTTAATCACTTAATAATGAGTAGTGAGAGATTGTATATTTTTTCGCA CTGCAGAAACAGCGAAAAAAGCTAAAGACCTGATCCGCTCTGTTATTCAT GGCGTGGAGCATAGTTTTAGGCGCCGCCAGTTCGGTTGTCCAACATGTTG GACACTTTTTTCAAACAACCCAACAGCCCCAACACCCCAGTTTTCCCTAC CCCTGCCCCCATCTCCAGCTCTGTTTGTCTTTGATGCGCGTTTTCCGCTT GTTTTTCTCGCTGGACGGGGGGAAAATTGAATGCCCAACAGCCGACAGTC GGCCACGTTGTAATTGAGTTGGCCGTGTGGAATGGGAAAATAGTTTTGCC AATTCCGACACGAATCGCAATGCAGTTGTACATGGAAAATCCCTATCCCT GCGCCGAGTATGTCGGGTCAATTTGCCAGGGGGTAATTAATCATTTTTCA CTTTTTCATTCGATACAGAAAATGCGCTCAACAATTTCTCACCATTTGCA ACTGCCAAAAGGCAATTAGAGTCGACACATTTGCTGTATTAGCGTTCATT AAAAATCACATGCAATTGCCACCGTAATTTCAATTAAGTTTCTTGTGTAT CTGCTGGTTTGGTTTTGTTTGTTTCAATTAAATTATATTGCAATTAAATG CAAACGAAAATTATTTTATAAAGGAAATTGGAATTGAGAAGGGCATGAGA ATATATTTTATTGTGAATTATCCATATATATATTTAAATTGCATAGATAG CTGGAACCTGAATGCTGTTTTGTAATATCTTCATTAAAAGTAAAGAACTG CATATATTAACTGAAAGTAATCGCATTCTGTTGACTTTGGTGGAATGTGC AACACCCAGAAGCAAAGCAAAATGCAACGAAAAGTGTGATTGCCTTAGTT GGGCATCCCCATTTCGAATTCCGCTGGGCTTGGCAATCAAATTGCGTTTT TCGGCCAGAGGAGGCAATTCAATCTGCGGTGGGAGGACTCGTGACCAGAT CTCAGATCTACTTTTATGTACAAGAGGTGCATGGCTTTTTGGTCTGATGC CACCAATGCCACGACTCTGATTGAGTGGAAGCCTCAACGGGGACTTTTTA GACAGACAGCCGGGGTTCGGTTGAGTGTTTCAATTTATTTTTCATATTTT TGTTTAACCGCTTTTTGTTTTACTTTCCTATTTTAGGCAGGCGAAATTCC CCCGGTTCGCGCACAAAATGCCAAAAGTTAAAATAAACAGCAGAGCCAGG AGTGCGGCGAAAGGAGCCAGTCGCCATTCGCCATCAGCCAGGAGCAAGGA CAACATGCAGGAAGGCAGGAAACACTTGAAAAAGTATGCCAACAATATTT CTGCCATCTCTCGCCGCTCGGTGTCTGTGTGCTTTTGTGCTATTGAAAAG GAAATGAATGGCAGGCAGAAAAAGTTAAATCACCTCCAGCAATTGGGCCT GCTGTGGCTCCCAACTCAATGGATGGGTCTAAATGGGTGACTCGAATGGT TGGGCTCCTAGATTGTGCGGACTGTATTTTGAGTGCTGCTCCCTGGGGTG GCGTATGCGCAATATTCGCGCATCGGCCTCTAAGCTGCGGCTTGAGCCCC CGCATTTGTCGCATTTTCTACTGTCCTCTGTGTGATTCTATTTTATTTCA TTTCATTTCATTTTTTCGCATTCTTTCTCGATTCGGTTTTGTTTTTCGAT TTTCTATTTGCCGTGGGAAATTGCTTTCAATAATGACGCAAAGTGTTGCT GGGGGGATATTTTAATGGTTGCTTGGGCGCTATGCGTTCGACAGATAGCG CCATCTGTTGGCGACAAATTTTACCGACACAACCCCTTATCACACCTCTC ACACTGCACTGAGAGAAATGTGTTTGTTTCAGTTGATGCCTATGAAGTCA TTATTATTTTCTTATTTATATTAATATAAAACTTTTTTATTACCAATAAC TAGGAAAGCGATGCATTTATATATATAACAAAATAAATAATGCTTGTAAA ACTTTAAGCTCAGTGTACCATTGACATCACTTCAGGCAATTTGTTCGCAC ACTCATCGTTGCGTTGGCATCAATAAATTGACGCGGTAGCGTTGCGTTCA CTCCTTCTTGCCACGAGTCCTTGGACAAGTGTGCGCCAACGTTTGTCCGG CGCCGCTTTCCTGAACACTTATGCAGTCCGTTGTCCATCGCACTTTTCCG GCATGCAACGCCAAGGGCTTTTCCTCATTTGCATTTCGAGCAAAAGGCTC GCCGTCCACTGAAATATTTTTAAATATATTTTTCATTTCCACGGCGGCAT GTTCACGTTGCAAGGGGTTTCCAGTTTCGCGATGCTATCACGATTCATCT TCACAGCATCCACGGCGATTCACTTAACCTTATTCTCGGATGCTTTATCT AAAAATATGTATATAAAATAAGTCAAGTACGATACAAAACTTTCCATTGC GTATTGACCAAAGAAATTGCGTCTGCAAATTTAACAGATCACGTATAAAA CATATAAATCGTAAAGAATTTAAGATATATTATTAAAGTTGTACTTATTA TTATATATACTTTAAGAAATTTTAAGGTTTAGTTTGAGTATTTTTCAAAC CCATTCGCGATGAGTTCTAGAGTATGCCCAATAATTTGCCATCAAGAAAC AGCGAAACTTAATGCAGTGGAAACATTTCAGAATTCAATTATTCCCGCTT GGTAAGAGTTTTAATTAAAAATCAGTCATATATTGTACGTGTGAGCTCCG GGTGCTTAAAAATTGAACATCGATTCGCCGAGGCTTTCAAGTTTGATTAA ATTCATCGGATAAAAAAAGGCAAAGCAACCGAAAATGTGTTTGCATCACG TACCCACTTGTGGGTGCCCCAAAATGGCCCTAAATGAAAAATTCTGGGTC TCTCGTCAAAAGTTAATAAACAGAAAAAAAATATATATACGATACGACAA ACCAAATGGGAGATATTTGCCATTTACCCAACCGAAAGGCTGTGAATTCA AAATGATAATAAAACAATTTCAAGGGCAATTTGCAGACTATGAAAAAATA CAACTTACATGCACATCTTTTTTACTATTCATTGATTGGCGTACCATTTT TTATTTTAATTACAGCAAGACAAACCAGACTGATTCTATTGAGATTTATA CAAAGATTACAGCAACAAAATATACAAACAGAAATCAGAATTGAAATTGT GTATACGTAAACAATTTATTTAACTTTAATGTGCCATTGTTGTTCGTTGG AAAAATCAGAATTTCCGTGTGGCAAACTGTTTATTTGCGTATCGCGACGG GGCCAATTAATGAAATTTCATTTTCCCGCGTTGATTGCCCCACTTTTGGC CAATTTCAGGGGGGCCAGAATCAATAACAATACGCTTGCCGGGTCGTGAA ATCCATTTAATTAAACAGACTCTCTATATACCCTTTGCCCGCACCACAAC TGCAAAAAGGGAATAGGCCATCTTCAGGGTGGCGAAAAAGGCATTCAAAT TCAGCTCGATAAGACCTCCTGCCTTGATGATCCACCCCCGGTTTCCCAGT GTTAATTGTGTAAAGATGAGCAAATCGAATCGATGATCCCGCGATTGATC GTACCATCTGCTGGAGAAGATCGCATATGGCAGCCGTTCCAACTCCTCGG CTACTTCGCTGGCAAAATAGCAGCTGGGAAAGAGCTGCACGCAGACCACT CCAAAGAACACCAAGTAGTAGACCAGCGAGATTGTGTCGCCCACAAAGAA GAGCATGTAGGAGACAATGATGCACAGAGTGGCTCCACATCCGCCCAGCT GCACCAGTTGCACTTCGCTGATGGTCCGGCTCACCAGGTTGTGGAATCTG CACATTGAGTGCATCGTTTTTGGAACCAGTTAAAGTGAATAAACTTCTTG TCAAAAGTTAGTTAATCAAAGCTTACCGCACCAAGAGTTTATGCTGCTCA ATGTAATCCAGCAAACGCTGATGATTCACCACCGTCTCGTCATCGAAGTA TCCCAGTTGACCCATTCGTATGGACCACAAATGGACATGTCCGGCCAGAA GGCATAGGGTCAGTGGGGTATAGGTATCGTTGCCCAGCCCCTGGAAGCCT TCAACTAACATGCTGAATACCTGATAGCCCAAGGCTACTGCGCCGAGAAA GCGATTGCTCTCCAAGTCGAATGGGAAATAGGCTGGATAGAGAAGTTCCC AATTTCCGCTAATAACCTGAACGAAGACGCCGAACAGGAAAAGCGCATAG ATCATGCCAAAGCTAATATAGAGACATCTTGTAAAGCGCCTAGCATGGCA ATGTACGTGATCCCGATAGTAACGATGCTCCTGTTCGCTGGCAATAAATG TGTCTAATTGCTCGATCAGTGATTCGATTTCCACAATCTGCGGCAAGTGA TACAAGTGGGCCACATGCTTCAGACTGCAGGCCACACAAGTCAGAGACAT GGTCAGGTTCTTAAAGAACTCAGCGGTAGATGGAAGTAGCAGAAGATGCA GCAGCAGATGCAGTGGAAACCACAAGGTGACCAGGATGTGCAGCAACACC ACGTACAGCTGGACAGGACGTGAGGAATCCTTGAAGAAAGTCGGTACCAG CAATCGCATGCAGATCCAGAATGGACGATAAAAACTAAGACTGTCGATAA TGACCATTGTTCACCTAATGCACATTTCCCAGCAAGGCTGGAGCTTTTAT GCAGATGTCATGAGAGGAAACACTGCGAGAAATTATACCACTATGAACAA GAAGATGCTCATATATTCATATATATATATATAGATTTATTGCATTTATA TATATAATGGAGCCGTCTGCTTTTTACAATATTATTTAATTAAAAAAGTG TATGCAAATAAATCGATTGTGTACAAGAAACTTTAGTTATTGGACACAAA TTTTCATAATTTTAAACCAACGTAAAAACTTATTTAAATGTTGAACATAA TTTATTACTTGTTCGAGTGTAAATTCAGGTGCATAATCCGCGCTAAATGG CATTTAAACGCAGCCAATGCAATTTTCATGAGCCGCGCGTTAATGGCCGC CATTAGTGGTAATTAAAATTAAGCGAATATGCAAATTTATGGGCCAAATG CCTGGTTGGTTAGCCGCCCACTTATTAACGCAGCGACATGGCCAAAGTGA AGAAGGAGTAGGCCAATCGCACGGTGGCAAAGAAGGCGTTCATTCCGATG CCAATCATCCCACCGGCCTTGATCTGCACTTCCGCCAGGGTGAGTTGCAT GAAGATCAGTAGGATGCGGCTGTAGCTCCGATTCATACTCATCCAGTTAC TTGAGTAAATCGCATAGGTCAGCTGGTTCATCTCCACGGATATCAGGGTG CCGTAATAGCAGCACGGGAATAATTCCAACACCATCGATAGGAAGTACAC TCCGTAGTAGGTTATAGCGAAATTATTATCCGCAAAGAAGAGAATGTTGA CTAGTGTTATGGAAATATTAACACCACTTGAAATAAACTGGCCGAGCTGC GAAATATTCATGGTGCTGCGCAGTAATTCCACTATTCTGGAAATAAATAA TAAAGATTCTAAATTACTAATATGATAATTGTTTGCAAGGAAGTATTTAA TATCATATGTAAATTAAGGAAAATCGATTTCCGTGACACCCGACAAACAG AATGGTTTTCCTACAACACGTTCATTTAATGATAATAACTAAAAACCATT CTATATATGTACATTACTTCATTAGTTTTCGGTGATCCTCGATGCTTTCG ATTAATTGCTTTCCGGTTAAGTATATTGTTTCCTCTGGACCTTGGCCAAT TCTACTCAAGCGCATCGCCAAAAGTCTTACATGACCGGCAACCACGCAAA ATGTCATCGGTGGATAGGAATCATTGGCCAAATTCTGAAGTATGGCCAAA CTTACTCCGGCAATTTGGTATGTTACACTTAGCCAAAATATTAGTTCCGT GGCCTGCACATCGTATGGAAACCAGGCGGGATATAATAGCTTATGTCCAC CGCCGAAAAGAACTGATGCAATAGCCGAGATATTCGACAGTCCATAGGCC ACAATGAAACTTTTCCAAATGAAATTCGCCTCACGTCTCGTATTTTGATT GAAAAACTCGCATTCCTCTCGACTTAAAGCTCGCTGATCCAGCTCTTTAA ATAATATTTCGATTTCTTTAATTTCAGATAGCTTGAAGCGAAAACAAATA AATTTAAAGCTGGCGAAAAAGCATGCTGCCGTAATTGGTAGACCCTTGCA GACATCCCCCAAAGATCTTTCCATAAACAGTCCCAGAATCAGGTGAATTG GATACCAAATGGTTACGAAAATTGTAATCACCAAATCCAACAAGCGATTC AGAAAGAAATTGCTTTCCAGGCCCAAAAGATGCCAATATAACCAATAGGT TCTGTAGATATCTTCACTTCGAATGACTCGCGGTTTTAAGTCCATGTTTG AAACAATTGAAAAGGTCCTGCGGCATTTCCTCTTTTATACTAGTCGTTCT AAATGGCTAAATTATAGTCCCACATCGTTACGCCCATCAATTTACTGCGA GTTTGATAACCCTATAATTTGCTATGACCAATTCACACCTTTTCTTTGGT AAGAACTGCGTGGGAAGTTAACAATTTGGGACCGACAGCGTAAATACAAA TTTTTGCTTTGGTTAATCATATTTTATTAATCTAGGACCTGTGCAAAAGA GTTAAATTTCTTTTTAGATATCTGGGTGTTGTCTGTGAACAATAAATGCA CATGTTATAAATTATAAATTTACTGATGTGTTAGTTGCTGTCTAGCAGGT GAGCTAATATTTTGGATTCATGTCACATGGGTTAGTGAAAATGAAGTAAT TGTTTATCAAAAATGCTACTATCTTAAATAATAAATTATTGAGCTATACT TCTATTTTCCTATACTCGAAATGACAAGGCTAAAGTGTAAAAGGAATATG CCATCCGAACTGTGGCAAAAAATGCACTCATATCGATGCCAACAATACCA CCTGCTTTTATATTCACTGGAACCAGTGTTAGTTGCATCAGAATTATCAA GGATCGATTGTATCTTTTATCCATTTTAAGCCAGTTGCTGGAGAAGATGG CATATGGTAGCTTATCAAACTCCATTGTCATCAGAATTCCATAGTAACAA CTTGGAAATAGTTCTATTAACATTGCAGCAAAGAACACCGCATAATAAAG CATTGCAAAGTTGTTTTCCGCAAAGAACAGGATGTTGATGAGTGTTATGG AAATGTTGATTCCACTAGAAAGGAACTGGCCCAGTTGGCTAAGATGTAAA GTGCTGCGAAGTAGGCGTATTATCCTGGAAAAGTTACATTTGATTAATTA TCAGTTCTCTGAGCTATCAAACATGCGGTTCTTAAATCTTTATTCTTACT TCATTAGTTTCCTGTGATCCTGGATACCTTCGATGAGTTTTCTGGTATTT TCCGAACTTGATAATTTTACATCGTGACCAATTCGACTTAAACGCATTAT CAATAGTCTCACATGTCCAGAGACCACACAAAATGTAATCGGCGGATATG AATCGTTGGCCAGATTTTCCAGAATCAACAGACTAGAGCCAATCGCCTGA TAGGAAAAACTAATCCAATAGATTGCGGCGGTTGCTTGAAAATCGTAGGG AAACCAACCCAGATACATTAAATTTCGACCAGTACTAAATAAACCAGCTA CAGTTGCAGTGATTATGGCCGATATAGCAGCTACCAAGTAACTTTTCGAA AGCATTCGAGCCACACGACTTGGATTTTGATTAAAGTAGTTGCGTTCTTC TTCACTTTCAACTCGACTATCGAGATCCTGGAGCAATCCTTCGATGGTCT TTATTTCTTTAAGTTTCCAACGAAAACAGAAAAACTTATAGCTGCAGAAA AGGCATTCCGATGTGAAATGCAGACTCCTGAAGACTTGAATCTGGGGCTT TTTATACATTCCCAGTATAAGATGCACGGGAAATAAAATCGTAATGAAAG ACGTGATTGTAAAATCCACTAGCCGTCGAAAAGGATAATCGCCCTCGACT CCCAGAAGTCGCCAGTAAAGCCAATAGGTTTTGTAAAGATTTTCACTTCG GACTTTCCTTCTTGAATCCATATTTGAAACAATTGGACAAGTTATGTACC GCCTTTCCTTTTATACTGGTCCCTTTTAATAATTAAATTTAAGTCGGGTA GACGTAATTGTTGTCCCCGCAATTATATTTAATTGATTCCAGCAATTATC ACCTATTTGTGTAAAGCAAGTGTGAGCCGTGGCGTAATAACATTAATAAA TACAAGTTCTTCACTTAGATATTTACGGATTAGGTAAATAATTGACCAGA TGTTAATTTTTAAAAAATAATACCAAGCTTAATTTTACAAAATTTTCATT TTGCCTAAATATTACAATCCACAATAAAGTTAATAGTGTTTAATAGTAAA ATCATTTTTTTCAGTAGGAAAAAAGTGACCAAAAATAATATTGCCTATAA CCTTTTTAGTACTTTTAGTTGAAGAACCCCATTTTCTATCATTCTACACA CAAATCCTGTGCGGTAACTAAGCGTACAAAATGGACATTAAAAATGTAGT TAAAAGTCGTGCAAATGTTGTCCCATGATCTCTTATGCAACTGCACTGAC TTAGTTGCCATTATTTGGCATTAAAACTCTTATCGACAGCTGCTGGGAGT AATAAAAAGGGATAGATTCTTTCGTAGCTGTTAAAAAAGTTGTAACTTTT ACCTTTCAAATGTTTTATAACCGCCATCGATAAGTTTTGAATACAAACAG TTCGCTTACATTGTTCATTGCTACTCTAAAACACAGTAAAAAGGGGAGTT TTTTGCAATTTAGTTTTTTCTGTTACCATTCCCCAATACTTTTTATGGTT TCATGTAGCTTTTGGGTAATGCTCTTTCGGCCAATGAAATATGTCAAGGC TAAAAACAAAAAAATTAAACTTTATGTTGAAGCATACATTGCATATACGT AATAACCAAATTAACAGCATTGGCCAAAAATAAGGTAGGTTGCATTTCTT TACTTTAACTAGCAAACGTTATTTTTATAAATTATTTAAAATTTGTTTAA AAAAAATTTTGTAGTATATTTTATAACATATAAAATGTAGCATACTTCAA AAAATAAAAAAAATATGCTCACTTTGACTGTGAAAGGTATAATTAAGAGG CAGCTGCAACTTTCTTATTTTGGCAAACTTTTTGTTTGTGGTCCATGACA AAGGAAAGTTGCCAAAGTTATTTGATTTGGAATTTTTTTTTGGAAAAGTT TCTCTCTTCTATATGATTTTTTGGCTCCAACTGCCCTGCGAGTGTGTGTT TATGTGGCACTAAATTAATGAAAATCACAACTGTGTGCAAAATGTAATTT AATCTTATTTTTCCCCACAGTTGGGCCCGAGGGCAACTGGCGCGTGGCAT GCGATAAACTTCCCGGATAGTGTGAGTTGGTGGAAATATTCTTGTTTTAT CAGGCGAAACTGACAGTTTTCAAATTTATCAAGTGGCCGAAGGTTTCGGA AAAGGAGGAAGACCCATCTGGTTGTTCAGTGTGTTCGATTTGTGATAGGC AAGGTCACACGGTCTTGAAGTTGTCGTTTTGTCTGTTCATTAATTTATTA GATTTTTCATTGCCCCACGTTAGCTACAAACCATCAAAGGATTCGTTTTA TTAGTCTTCCAGAACTAATTCTGCAACTGGGATATAAACACGAGCGAAAT TCGGGTAAACAATTAAATGTTCATCTAGACAACTTAAGGCAGAAAATCCA TTTAAAAGTCGAAGGTCCATAAAAGACATCGCATTTATCGCTGGATAAGC AGGCAGTAATGTGGTTTAGCTGCATATCTATGCCATTAAATGTGAATCCG TTGCCCCTAAAACTGCAAAATATCAAAGCAATAAAATGCAGAAAATAGCC CGAATTTTGAGATCTCTTTGCTTGTAACCACCAAAAAAAAAAAAGAAGGA ACGAAAGAAAAAGTCGGCATCGTCAGCAAACCAAAATATACCAAAAATGT TCACTTTGCAAAAATCGTAATATTCGTTTTATTCGTTCGCTTCGTTTCTC TATTCATAAAGTCAATATTTGCGGATGGTTATTTAGCAGATAAAGCACCT TGAAATCTGTTCATTCGTGCACTGGCTAATATCTAATTCTGCGAATTGAG TTTGCAGTTCTTTCCATTAAATGTGTATACTTTCGGTTTGCTAATTAGCA TCTGAAAGATACCCACGCATTATATAATCTATAATGAATATCCCACAGCC TGATATAATATCGCCCATGACATTGACCACATTCAGAATTTGTTTACTCT AGACGAGAAGGCATTGTGTCAAGTATTTATTGCTTTATTGCTTTATCGCT ATGTTATGTTTCGTTCAACTAATTTCAAACGATTTTTCACAGCAGAAAAA TTTACCAGAACTGCGCCAAAAATGGTGTGTGTTTCTCTTGCTATATGGTT TTATATATATTCTGTGTTTTTTTTTCCACCACTAAGAGGTCATGGGGGTG AAGTGGTTTGGGTTTGGGTATTTTGAGGGCTCCAAAATCGAGTGTCGGCG GAACAGCTGCGTTTGCCGTTTGTTTACTTGCTCTACTCGGGGTCTCTGAA TGGACTCCGGTCTGCTCTGTGTGCTTTTGTCAGGGGCGTGACCCCAAGGG GGCGTTCAATTATTTGTGCAGCCAACAATCAAGTCATGCAGAAGTGTGTA CATTGGCCAAAGCAAGTAGACTGGGGACATTTTTAAAGATAGATTGTCAT AAAGAGGATATTTTTAGAAATACTATGTTACACATAATTTGTAGCATTTG AAACAATAGATTTAAAGTTCGCTTAATTAAGACTTATTTAGTTTTGTGGT TTGGTATAGTTGTTCATGCTTACTAAATATTTTTTTTTTGATAATATATT TGTAAGACATTATTATTTTTTCTCGTATTTTTTTATCTAAAAAATCCCCT TTAGCTGCATCCATGTTTTCTAAATGCTTACTTCCTCAGTAATAGTGTCT GTGTATCTGCACTTGCGGTCACTGCTAATCGTCTAATTTTATCATGTGGT TTTCCCCATTTAAGTGCCGCCAAGTGTTGAACGATTTGTGTAGTTTTTCC TAACCAGCGCACCGATAGCCCGCCCCGTTCCCTGTGGCAGTGGTTTCCTT CGTTTTTTTCTCATGGCTATTTGTGGAATTTTCGGTATAGTTGTGCTGGG CTGGTATTCTTTGCTTATCATTAGACTAAGTGCTTGCACATTTGACCTTG CCACGCCGACTCATTAGCAGGTTAATGTGTGACAATGCCCAGTTGCACTT GAAAGACTTTTGTTGTCTGCCAAAGAGATGCATATTAATTGGACGCATAC GTGGAATGGGGAAAACAAAAAAGTTGGATGGGAAGATAGACATGATACAG CGGTCACGCGCATTCCATATTTGTTATGTTCTCATATTGCGCATACGCCA GGGTGGTCTAGGCAGACAACACGCGAGGGCAATCAATCATGTGCCGAAAT TACGCAGCCGGCTCCCAATCTGGCCAAGTTCAGCCTGGCTTAATCTGCTA ACCGTGTTTCCGGTTACCATTTTGCATAGAACGCGCGTTTCGCTTGCCAA ACAAAAGTTTTGCATAGTCAGCTTATGTTTGGCAATGGAACAACAATATT TGAGTCCAAGGATGGTTGCGCAAAGTTTGCCGACCCATGGAGCCACCAAT TTAAGGATTTTAAATTAAACTTAAACTTCTTATTATGCGGTAAAGTTTCG TGTAGAGGAACAGTTACAGATTATTAAATGTTACACAAAGTGTAAATAAA ATATTATACGCCAACTTAGACTTAGTGGGAAAATGTAGGAAATATTTATT TTACCATGAAATTGAGCTTAATTCGCATAAAATCTTGAATATTGCCATAT TCCTCTGCAGACTGAATTATATTGATTGTTCCACTTGGATTATTTGATTA TACCTTCTTCAACACGTCTCGTTCAGCTGTTGCCTGGGTAAGTGCATTTC GATTTCGCTCTGTCAAATTATGAGCTGCCTGGGTGGCATCTATTTCTGGC TCACTACGACTGCTTTAAGCGGCTTTTGGGAGCAGCTCCATTTCCTTTTA GCCAGCAGCGCAGTTATTACACGCCCACAAATGCTGACATTTCAATTGTT CGGCCGGGCTTAGAGCCATGCTGTCAGTGCCAAATATTGTTGGGGTCGAG TATTGCGTTTTGGCCATTAGTTGGCAGTCCAGTGTGGCAAGGAACTGGAG AGCATGGGAACCTCGAACTATAACCTTAATTCCTCAGCCTTTGCCTTCGA TATCCGTGACGACGCTGGTCGTCATCGTAGCCGTAGCTGAGCCCATAAAA TATGAACCAATTGACGTGAAATTGATTGTTCTCCTCCAAGCTGTGCTCCA CTCTGTGTTCCCTCTCTTTGCTCACGCTCTTTTACCCTGTTGCCGTCTCC TTCTCTGGCTCCCTCAGTGTCTTGGGGTTTTCTGTTTGCGCTTTATTAAC TACAACTGCCATAAAATGCAGGCGAAGCGAGCTTCTGCACTACCATTTCT CGTTCACACCTTCAATTCCCAGCGAGTGCACTGAAATAAAAAAATATCTA CTTTTACTGTGGTCACTTAAAATAATAAATCAAAAAGTGTAAGAAATTAA TGGCTTTTTAGAAAGAAAAAGTTAAACTCATTCTTGAAATTCGTTATATT AATTAAATGAGACAAGTATTTAGATAAAATAAGATATGTAATATTCAGTA CGTAAACCAGAAATATGCTAGTATAGATTCTTGTGTTTATTTCTTAATAT CCTATTTCAATAAATCAAGTATATTTTCTCTGTGTGTACTTTTATCCTAC TCCTTCTGCCCTGCCTTCTGCACATCCTGCCCCACCGCTTATCGCTCATT TTACACGCTGCCAGCTTTGCGAGGCGTTGCCGCAAAATTCCTTACAGTTG GCATATTTTACGTGCCGGGCCAAGGGCTTAGAATACGCTGGAGAATGGGC CATGGCAAGGATTAGAAGTTGGCCGGATCCGGGATCCATGCCCGACCTTC TTGGCACTTCCAGTCAAATCGAAGTATTCGAATAGGATTTTCTGGCGTGC TCTTAATTAATGTGATGACTTGCGGTCAGACAAAAGGTCCAGAGCATCAT CAATACATGACATTGGGCACTATAAGGCACTATACATCATGAAGTAGTAG TCTGATGGGATTGGCAATGAATGCAGGTGTAAGTTATGGAGAAAGTTCGG AATGCGGACAATTAGTGAGGGTTTCTGGAGTCTCCTTCATGCCAATTCAT TATCCAGAGAATTGTTTAATGATAGTTTACAGTGGGTAAGAGGTAACACA TTGAAGTTTTATAATAACAGTCAGGCAAATACTTTGATCTGAAACGATAT ATTAAATCGGTTTTGATAACAAATATCACTTTAAATACCCAAATTTGTAG CCTGAAGTAGTGTTATGAATGTTTAAATGTTTAAAATGTTGTAACCGTTG TTAAATCTGAATAAATACTCCACTTGCTCACCATTAGCTACTGATGGGCC TGCCCCCCCCCACACATAATATAATCCTTGAACGTGGGCCATATGTCAGT CATTCCTCACCTGTCCGTGGCGCAACAGAAATGGCCATTTATTTGATGTC GCTACTTACCTTTACACACACGCTTCATTTCCATTTGTAAGCAATTTTTC AGACCCAATCCTCGTGTGGAAATACGCTTACCAACCAGAGTTTTCCACCA AGCAGGCCTCTCTCTTTCGGGCTTCGACCATTTGTATGCGAGTTGCAGCA TCTTTGGCTCGGATGTGGCGCTGGGTGGATCGGTGGGCTGGTGGAAAATG GGGAAAAAGCCGCTTCGGCTCATGCAATCGGCTCGCTTCGAACCCAAAAC ACAACAATGAAAATGCCGCATCGAACAAGTTCGGAGCACATGGCGCGAAC CGCAACCGAGGACGCAACTTGCAAGAAATGTTTTCAAAAGCGTTGGCGGA AATTCAGTTGTTTGGAAGCCATTGCAGCTAACGGTACTCTCGTCGGATTT CCCATTCGCTTCGATTTTCCTTACTTGTACACTAGGCCGTTCAAGAAACG TGTGAAAAACAATAGAACAAGTGCCTGTGTGTGTGTGTGTGTGTGCGAGT GTGAGTTTGCTTGTGACAAAAGTGAGGGATAATCCTCGATAAATCTAGCG CAAGCACAAATTACAAAAAAAAAAAGAAAAGTGCAAGAAAAATAAATAGG AAATGTAACAAAACGAAAAACTTGGACAGTGAAACTAAAAAGCTATACTT ATTCACTTATTCAAATCGAAGTATTTTCAATGTCAGACCAAAAACAACAG CAGTAACGACTTAAAGAAATGGCTACCTTTTGTTTTCCTCCACTGCTGAA ATTTGTACGGCTTCAAAAATAACCATAAGTTGTCCTTGGCCAACGGGCGG CTATTTTTAAGCGTTTTGCTGTTGTTGTTGCCAGCGAAAGACATAAAAAG TGAAATCCAAGTGCAGCGAGATTCGCATCGGATAAAAATATATGTTTATA TGTATATGTATTTAATTAAATTAAACAAGAGATACGCGGCGGCAAAGCTG CCAGAATCTCGGTACTCCGATTGACAGGGGAGAAAAAAAAGAACAAGTGT CCTGGACTCTGATGGATGGCCCCGTGTGACTTGTGTTTGCTCTTGAATTT GTTTCTTATTGTTGGTATATTTTTCTGTTTTTCAATTGTTTTCTTTTTTT TTAATGTCGCAAGTTAATTTGATGCGTTGGCAGGCTGTCAACGTGGCTGG CATTGTGTTGACGGATTTGTTTTTGATCAGACAGGCGCCACACGGCGTAT ACGCAATTTACAGCGAAATTTCCTACGGTTAATAATTGATGTGAGAATTG GATTTCCAACCAAATGTGCCCCGGGAATAATTGTCAAGTAATTTATTTAT AACAGCTTACCCAACGAGAGAAGCCGTGGCATTCGTTGAATTAATCAATA ATGTAGAAGGGGTGTGCATAGAACATCTTAAACAGCTCACTTGTCGATAA ACAATTCATATAAGCCATCAACGATGCCACGCCATTTCAGCGGAAATTCA TTTGAAAAGTGGAAGGGAGCCCACTTGCTCAGACAATCAATGCAGTGCGC CTTGCGAGGCCGGAAATTTAATTTCCAGGTAAAAGTAAGGGCAAAGGAAC CGCACGACCTGAATGCACATGTGGTTAATTGCTTGTCCTCAAACGCACAC ATTGTACCGAGCAGGAGCAGCAGCCATTACGTATACGCCATGGGCTCCCG ACCTCCGACCTCAAAACTGGCTTCATTCGCCCACATACGACGCATGGGGC ACGTTCTTAATAATTTTCAAGTCGAACCTTTGCCGGGGCACGTACCTCGG CGTAATTAATTTATGCAATAATTTTTCATTGCCGACATAACTTGACAATT TTTCGTCGGGCTATGCCCGAAAAACGCAATGGGAAAATGTTTTAATTTTA GAATTTGTTTTCCTCTTCGGCTGAAGCCATAAACAAAAGTTGCCACCCAA TCGTGAAGGTCTGGCTCTTATTGCCACTAAATTTTCCGTTGGACAATTGA AAGAGTTTCTGGTGGCAGGGACGTCCGAAGTTATGATAAATGACAAAAGA CAAGGCACATAAAAGCCTGGGCCAGTCCAACTTTTGAGACGTCACGAAAG GGAAATGGCCATGAATGCCGGTCATTAGGTTAACTGACCGGGCAGGAAGT TGGCCAACGCTTACACCACTATTTCCTCTCAACTTCAGCTCCCCCCACAA AAAAAAAACCCCTCCATTTCCGTCATTGTGTTCGGCACTTTCTTTTTTGG ACACTTCACTTTCGATGATTGGCGACGCCACTCGAAGGAAACCCAGCACA AGTGGCAACAGTAACGCTCAGAGGGGCGGATAGCGAAAAGGGGCAAAAAA ATCCAATCCAGGGCAAAAATCCAAGAAGCGGGGCAATCCGGGAACTCGCA CTTGACAATCGCCATCAAGGACGCGGAAATGCCACGTTCCTTTTGTACTT CGGCGCTCAGACACGACATGCGATTGAAAGGAGAGGTAGGGGGGCAGCTA ATCGAAAAGGTTATTGACTAATCCAATGGAATATTTGACAAACCTTTGAT CTAGACATAAACAAATATTTTATTGTAGCATTTTGTATTCATTTTATGTG TTGAACAAGGCAGTGAAAGTGAATTTGGAACTGTGGAATTAATTTGATTA TCAAATGATTAAGTTTTATTTGTATTGTTGCTACGTAAACTCTGTCCTAT TTTTACTTAAGGAAATGTTAATAAACAAATTGCGACAGGAAAACAAATTT TAAAGAACTTTTGTTTTGTTTGTTTCCTTCCACTACCTACGTCATTGATT GCCGCCTGCTTTGAATTTTTATTGGACCAGCTCGCTTGTGTTCCCATTTT CTCCCAAAACTGAAGGGCGTCCCCCACCTGCGGGAGTTGGGGTTATTGGT TTTGGGAAACTTGCGGCACTTAATGTCAAGTGCACGTGCTGTACAAAAGC TACTTTTCCTGACCGCTGTCAAGCACTGTCCCCGCCGCTTGTCCCTCCCT ATTTTTTCCATATCCAAAACAAAAACCGGCAACGTGACGTATGAGTGATA CAGGCATATATTAACTGCTTCCCAGTGTGCGAGTGGTGTGTGCTTGTGTG TGTGTTTTTGGGGTGCTTATTTAATATTGCGCAGTCCCGGCATGTGTCAA AGTAAAAGTTTACGACTGTCGAAAAATGATTCGCGATTCGGCAGCTGCTC GCGTTCATAACTAACAATATACTAACTGCAATCAATCAAAATCAAAGTCG GATTTTACAGTCGTAACCAACTGGGTAGGCATATAAATCACAGCACTTTT CAAATGCCCTAAGTTTGGCGGACAGAACGCAATACCAAAACTGTGTGCAA GCAGTGGAGCCAACAAATAATTACAATTTAAGCGGAATCCGAGAAGGCAA AAAGCACACAGAGCGGAACCCGTCGAGAAGCTGAGTAAGTAAAGTGGAAT GGAAGCACTGATGACCTTACCCTACGCGTCGTTTCTCAATCTCAAATCCA CATTCCCTACGAAAAACCCCCAGATCAAATGGGAAATCTGAAACAGAACA AAAAGCCAGTTCAGGCCAGGCCAAGCCAAGCCAAACCAATGCAAAGTCAT GCATAATGCAAATGCGAGTCAAGGATAGTTTTTGGCACTTTCCAGCACAC AAAATGGTGGCGTCGGCCTGACTTTCTCCTTGTCTCGTCCTGCACTTGGC ACAGTTTTAATGCACTTGCAATGGATCTAATAAAAAGTTGAAAGGAGTCG TTCATACGCCTCAAATAGTCAGTTGAATTTGAAGTTTGTACTTGTCTAAG CGATGGGAATGTAGAAGAAATAACATCACCTTACTTATTTAAACATGGAA ACAATATTATGTTTTGACTTAAGTATTATGAGTATTTCATTTGGGCATTG TTCCATATCAAAAACATTGAAATTTCTACTCAAGAGCACACCTTCCACAA ATCACAGCCATAATTAACAGACAATATTTACAATGTTTACCCAAAACATT GAATCCACATAATGTATTCGAAGAAACAACTCAGTAGACTTGGAAAATCA ATTAAATTTGTGATTTTTTTGGTACACCCAAACAACGTAAATTTTAAACG TAATAAACTTGGTGGAAAGCAATACACTCAGAAAGAATACACAAATAAAA TATTGTGAAACGCAGTGGTTTTTCTTATTTGTATACATCATTCAATTGGA AAACAAGTTTAGCGAACAAAAAGATCATAATATAATTTTAGCTCAGCTGC TAATTGGCGTTTAAGTTGTGTACTAATAAAAGTACATAAAACAAGTGTTA ACTTTTTAGCGTTTCTTAAAGTGTTTTTCATTCTCAATTTACTTTTGATT TGTTTCTGGCGCGGTATGCAAAACAGCAAAAACTGACCAAGAAGCAGGGA AAAGCATTTCTTTACAGCAAATACCCTGTACTTCTAGGGGATTTTTGTTA CATACTTAAAATAACTGTTATCTAACCTGTTAGATTATCGAGTTTTTGAT AGAGTAACGGGTATAAAAATACCCATATGTTAAATGGCTAGTTTTTAAAA GGTTAATTTAGTTATGATTTATTTATTTATAGTATGTATTATACAATAAA TGATTAGAAAGCGTTACAGAATATTTAAAGGGTATTCTTAAGTTGAGCCT TCCTGTTTACTTACTGTTTTACTGTGTTTCAATGGCTGTTTTTGTTTATT TTTGCGCAATGCCCCAATTAAGAATTTTGCGCATCTCCGTAAGACTCACC CTGCACTTCGTTTCGCCTAGTTCGCTAGTTAATTATCAACAAAAACGTAT TAGGCAAAGGCTGAATCATTTTTCAAATCTGGACAAATAACAAATGAATG GATTTCGCTGGCCCGCTGGCCCTTTGCATCTGTTAATCACCTGCTGCCAG AAACTGAGCCTCAGGTGCGCAGACTGCTGGGTATGGGTGTATTTTCCTTT CGCAGGCCCTTTGAACTTTTGTGCTCTCAGCGAAAAGCGCAGAAAAGTTT CTACATTCTGCCCTTGTGCCGAGAATTTTCCATTTTCCTCGACTATTTTC ATTATGCATGTGAGTGGCGGAGGCCTCCGTCTGATTTATTATATGACCTG GCACAGCCGGAGAAACTTTTGATTTCTCATTGTGATTATTTTATGATAGT TTAAGCGCAGACTTTGCAGAACCCGAAAACTTTTGCGCACACAATAGCCC GCATCTTCGAAATGAAATGAAATCGGGATGTCGAACGATGAATGTTGAGT TCTGAATGCGAATGCGAATGGCAGTGAGTGCCAAGCAAATGCATTGAAAT TTGTAAAGCTGTCAGTATGGGAATGAGAGTGTGGCATATGTGTTATATAT ATATAACATATATATTCACGCTCAATACCAGCTGAATGGAGAGTTCTTAA AAGCGATTTTTATCGTCTTTTTTTTTTAACCCCAATTTCCATTGATAAAT CGTTTCCGATTTCCCAGAAAGGGTTGTATAAATATTTCCACTTCCCTTCA ATGCTGAAATTTTCGATTTTCAAGAATATTATTTATCTAGAGCAGCAACA AATTGAATACATTTTCATAGACTGTATGCATGGAGTGGCACTTGCAGCAT GAGAATATTACGTATACGCAACGATGTCGTCAATTTACCCAAATATTTCT GCTGATGCCGCTGTTCTGTTCTATGCTTGGTAATGAGAACACGTGGTGCC TCGCATTCGCAATTACACATTTAAGCTGTGTGTCATGCATATTGAGGGGC TCATTAAAACCTAGTGCGGACAGGAAGTGAATCGCAGAGATGGAAAAAGG ATGCTTCTGCTAGCCTTATGAATCTATTTATATTTTCAACTAATGACTTT CGCTTCAGAGTTGAGAATATATGACTTCCCACCTTTATTTCTTGGCGTGC AGGTGATTAAATTGTCGCCTTTGGGGCTGGCATCGTTATTTCAAGGCATC CAAGGACGAGTCAAGCTCTTCAGAACGAGATTCACAACAATGGCGCGATG CATACATTTCAGGGCATATTTCATGAGCTGTTAATTTCGCGCGGCGGAAA AGTCATGTGTGAATGCGGGAAAAGCGCCTTTTAATTGAAAATTCACAAGA AGCGGGGGTGGCGAGAGCGCGGGGCAAATTGAAATGGGAAAAAGAACGAG GGGAATGTGGCGCTTAAATATTTTGTTTTCATTCTTCCGTTTCGGTAAAG CGGCCAACAATGGAGGCGCCGCTTAAGTGGGCGTAGATTGTCCATGTAAA TGCCAGCGGCAAAGTAATAGAGAGAGATGGAGCAAAAAAATAGAAAGAGT CAGCGCTGGCTGGCTAGAAAAGGAGGTTAACAAGTTGAAGCTGTTTGCCA ACGTCCCATCCCGCTTGCTCTGGAAATTATGCGAAAAGTATTTTTCGCAC CAGTGAAATTTTTTAACACCATGCGCTATGCAGTGCTGTTAAAAAAAAGA AGCTAAAATGTGCACTTTAACAGCTAGTAATTTTTAAAAAATTATTAAAA TTATAAAATTATACATCTCGTTGATAACTACCTTGACGTTTACCTAGCAG CTAGCTGAATTTTTTGTATTGATAAGTTGGGTTTCCGTTCAGATTGCACT CAAAACTAAAACTAAGCCAAATGGGCAGCACTATTTGGAAAAGGGGTCTT TAAAATGGAGTGGATGGGGCAGGAGAGATGTCCCTCATCATCAAGTGGTC CAAAAGTGAGCTTAGCATGCCCGTCGCCGCCACTCGAGGATGCAACATGG CAAGGCGAAAATAGACGAGTTGCCATCGCCTTCCTCACATTTGCCCACGT TAAACATATCTCCTGAGTGGAAACTGTTTCCACATTCACTTTTCCCAAGC CACCCACCCTACACCATTCCGAATCCGCTACAGAACACTCGTGTCAAAAG GCCTGCTGGGCCTGCCATAAATGGGCCACTTGCATTGCTGGCGACCAAAA AGGCGAATGATGAGTTCAGGAAGGAGGGACCTGTAATGTGGGGGAATAGT CTTTCAATCTGGTCTCCTTGAAGCCATGGCGCCACAAGGAAAATATCACC CGGTAGCTGGTTAGGTAACGTGTTATTCCACATGGAAAACTTTAAAACAA GAATGTAGCCAGGCAATTAGGATAATAATTAAGTGCACATGTGGGATTTT CATGAAATTGTTTGTGCACCTGTTTTTCAAATATTTTTGCGCGGTTCAGT AAACGCCAATTGAAGAGCAATTAAATTAAGGAATGTCTAAGGTCAGTTGT TTGCACTTACGTAAATGTTTTCAAATCCATTGTTGGATATATTATAATTA GATATTAAATTTCCATTTATGTATCATTTTAACATTTTCTATTTATGGTT AATTATGTATGTACTTAATTCATAAATTTGCACATGGTTTATAGAGTGGC TAAACAGTAATTATTAATTCATGATCTCGGCTCTTATTTATTTATATAAT CATATTTATATCAACAACAATATTTAGCTTTGTTATGCAAATGTCATTGA GGTAAATGCATGGCATTTAAACAAATACCATGCACTTATTTTTAGTCCCA TGAACTTGGTAAACATTGCATTTGTTCGAAACAGTTATTTAATAGCACAC CGAACTTCGTGTCGTCCTTAAAAAAGTCTCAGAAATAAACACATGTCACG TATTTTACTTTTGCAGTTCTTGTTTTCCTCAACCTTTTACTTTTCTGTAT ATTCTTTGCCATTGCCCTCGGCGGAATCAGATGTCAGCGTGGCTCGAGGA TTTTCCGGCCGTGGATGTGTATTCCGATGTAGATTGGTATGGGCATGAGT ATAAGGATGGGGATGAGGCTGTCGTCGGACACCTTGTGGCTGTGGCCTCG ACGCTAAGGTCTTGGATATGTCATTAATTGCCTGGCCGCCATTTTGGCTG GGCGGCTATTCGCTCCTGCCGGTTAGCAATAACCCGTAAAAGTAACCCAT GCCTAACCATATCCGTGTCGCCTGCAGGCTAGACTCTACGTAGTTAAACA AATCAACGGTTTCATGGCCACTAATGCAATCAGGCCGCAATAATTTTAAC GCTCAGCGTACTAGCAATTTGTCATTTTCCAATCCGAGCTGCAGGCATGG CGATGAGGGGTGAGTTAGCTAGG