##gff-version 3 ##date Wed Jul 24 05:40:42 CEST 2024 ## exported from the transgeneomics system molecule_59050552 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59050552 mpicbg region 9631 13068 . + . Name=dmel-5.43-3L;type=genome;start=3332144;end=3335581;strand=+ molecule_59050552 mpicbg region 13069 13141 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59050552 mpicbg region 13142 14130 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59050552 mpicbg region 14131 47911 . + . Name=dmel-5.43-3L;type=genome;start=3335582;end=3369362;strand=+ molecule_59050552 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59050552 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59050552 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59050552 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59050552 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59050552 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59050552 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59050552 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59050552 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59050552 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59050552 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59050552 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59050552 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59050552 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59050552 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59050552 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59050552 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59050552 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59050552 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59050552 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59050552 coding_transcript gene 10606 12465 . - . id=50449429;identifier=FBgn0035440;ensembl=FBgn0035440;Name=CG14969 molecule_59050552 coding_transcript gene 13066 14337 . - . ensembl=FBgn0052274;alias=CG32274;alias=dro1b;id=51454106;identifier=FBgn0052274;alias=Drosomycin-like C;alias=drosomycin-1b;alias=Drosomycin-like;alias=drosomycin-H;alias=drosomycin;alias=Drs-lC;Name=Drs-l;alias=Dro1;alias=Dro-H;alias=Dro-1;alias=Drs-I;alias=CG11520 molecule_59050552 coding_transcript mrna 13066 14337 . - . Name=FBtr0073081;id=51454124;parent=51454106 molecule_59050552 coding_transcript exon 13066 14337 . - . parent=51454124 molecule_59050552 coding_transcript cds 13066 14337 . - . parent=51454124 molecule_59050552 CLC misc_recomb 13142 13175 . - . Name=FRT molecule_59050552 CLC cds 13183 13254 . - . Name=BLRP molecule_59050552 CLC cds 13255 13275 . - . Name=TEV molecule_59050552 CLC cds 13276 13299 . - . Name=Precision cut site molecule_59050552 CLC cds 13300 13341 . - . Name=V5 molecule_59050552 CLC cds 13348 14064 . - . Name=SGFP molecule_59050552 CLC cds 14071 14130 . - . Name=2xTY1 molecule_59050552 coding_transcript gene 14581 14967 . - . alias=drosomycin;id=50878407;alias=CG11520;alias=Dro6;ensembl=FBgn0052268;alias=CG32268;alias=Drs-lI;alias=drosomycin-I;alias=CG10815;alias=drosomycin-6;Name=dro6;alias=Drosomycin-like I;alias=Dro-I;identifier=FBgn0052268 molecule_59050552 coding_transcript gene 15392 46682 . + . alias=betaHeavy-Spectrin;alias=betah-Spec;alias=b[Heavy]-spectrin;alias=beta[[(HEAVY)]]-spectrin;alias=Spectrin-beta[[H]];alias=beta[[heavy]]-Spectrin;alias=betaHeavy-spectrin;alias=beta[[heavy]]spectrin;alias=Karst;alias=betaheavy-spectrin;alias=beta-heavy-spectrin;alias=karst;alias=beta[[H]]spectrin;alias=betaH-Spec;alias=betaHeavy--spectrin;identifier=FBgn0004167;alias=spectrin;alias=beta-H spectrin;alias=beta[[H]] spectrin;alias=beta[[H]]-Spec;alias=betaH;alias=beta[[heavy]]-Spec;alias=beta-Heavy spectrin;alias=beta[[H]]-spectrin;alias=betaH-Spectrin;alias=betaH-spectrin;alias=CG12008;alias=Spectrin;alias=beta[[H]]-Spectrin;alias=beta[[H]]-SPEC;id=51347485;alias=Spec-beta[[H]];Name=kst;alias=beta[[Heavy]]spectrin;alias=betaHS;alias=beta[[H]]-Sp;alias=beta[[Heavy]]-Spectrin;alias=l(3)01318;ensembl=FBgn0004167;alias=Spectrin beta-heavy chain;alias=beta[[Heavy]]-spectrin;alias=beta[[H]]-Spectrin;alias=beta-Spectrin;alias=beta[[H]] ##FASTA >molecule_59050552 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACGGTGACCGAGATAAAGCCCT ACCTCAGGAACCACGTTGGACCCACTGTGTTGTATTCAAAGTCACAAACT CCCAGGACGTACTACAGCCAGCCATCCCGGCAGCGCGTTGCCGAGGAGCT GGACTACAGTGCTCCCTACTCCCAGATGAGATTCAGCCCCGACAACCACT CCTCCAGACTCGTCCAGTCGCCCCAGGTGCGATACAGTACGGAGAGCCAG TCCTCGCGGCTGGTTGAGGCACCCAAACCAGAGGAGCAGAAGCAGGAGCC AAAGAAGGAGCAGCAAAACACCCACATCCAAATCCAGATAGCCAGTGACC AGGAGAAGTCTGCAGTGGTGGCCACCACTATTGCTCCGGACTGCGACAGG GGACAGCAGAGAGCAGAGCTGCGGCAGCAGAAGTCCCAGCGCCTGGTGGA AGCACCCAGTTCCGAGGTATCCGCCACCCAGGCTACTCCGTCCCAATCGA AGCCCCAGCCGGATGTGGACGTCTCGCTTAATGGAGCCGCTGGCCATCTG AAACCCAACGAGAGGGTCATCGCAGCAACAGCCGCGCCAACAGATGCCTC CGCCACCAGCGAGACCTTCCACAAGCGCCGCATCGTTGTCAATCATCCAT TCCAGACGGTACGCGAAGTGGTCGAGCACGAGCCCTTCACCAACTACCAT CAGATTCAGGTGAACGAGCCGGCTCCGCCCTCGCACTACCACCAGGCCTA CTACCAACCGGCGCTGCAGACCCACGGGAGTTTGGTCCATTTCCAGACCT CGTCCGCCCATGGCAATCTATACGGATAAGGAATTAGGATTAGGGAAGGA TCCGAAGTCGACCAACGAACGAACCCGGCCAATGCACTTCCTCTGCTAAT CGTTATCTTAGTGTTAGGCTAGATGCTAAACTTATCATGTACGCAAATCC GGTGGAAGGGCCCTTTCCATGATGACATGACCCTGATCTTCTTTCGCATT AATTTGTTATAAACGCGTAGGCTTAAGTGCAGTTTTACTTGCCAACAATA AAGTGCATATATAATGCTAAAAATGATTTTCTCGTCTTGATTTGCCATGT ATATATATATAATATATCACATATGTATATGGCTATACAATTGTTATATA AGTGTTTTGTTTTTGGTTAGGCTCAAGGCAATATATAGTTATATATGAGA AGCATAGAAGATAATAAAATTCGAAAATCCTTGAAATGCTTTGAGCTTTG CTTCTCTAGTTTCTTCAAATTTAAAAAACATTCTTCTTACGCTGATATCG AAGGTTCCTCTAATGAACGCTTTTGATTTTGTTACGCGCGTTTGGGCTTT TCAAGAGGCTCATCGTCACTGGAGTAGTCGGATGCGGGACTGTGAGCAAC CTTTTTCCCCCTAGGAGGTTCTTCATCACTGGACTCGTCCAACAGGTGTG TTCCAGCACCGATCAATACATTGGCGATCTTTTCTGTTCGGGCGGAGATT GCAACAGGATCCTCTGTTGAAGTGGACAGCACGGCAGCCGTGATAAGCGT CGACGTGGAGGGCGCGTCCAGTTCAGGTTCTAAAATGCCAAAAATCAGAA TATGGGCTTAACCAATGACGATCTTTCCTACCCTGCTCATTGAGCAAGCC ATGATTGGCCTCCCGCCGCTTGGTCACTACAACTGCCGTAATATAGAAGG TGAAAATGGGCAGCAGGACAACTACGCCAACGGCGATGAGAAAATTGGTC AGCTTCACCTCGCGTTGACAGCATTTCAGCGTTTTCGACCAATTCAGACG AGTCCGGTTCATCTAAGCAAAAGTAAAGGTGTAAAAATAGGCAAATGTAA ATATAAATTTTTAAACTTACATTGTCCTGCAGATCGAAGCACACACTTCC ACCGACTTTCTTTTCCATGCTAAGGTAGAAATCATTTAGACTCACGTAAT CATTTTTGCACTTGAAGCAAACTAAATCCGAACTAGCAGATTCTAAGCAA TTTTGCAACTTTGTTGAGTTATCGCTGTATACAATCCAAAAATTATCCCT GAAGCAATCTGGAAAGTAGGAATAGATCAGTGATTCCCAAATGAACAAAG TACTGATGCACACTTTCGCAGTTGGCCTTTTGCCACAGGCTAGTTAGGAT TCCTTGGGTGGTAGCCACTATATTGATCCTGTCCGAGTTCAGATAACGCT TGGAACAGTTGGCGTTCGCAATTAGGTTTCCGTAATCATTGGTGAGATTG CGGTAGAGATCGACGCAGCCCTCACACAAATTCACGGGCACTGATTTTGT GGTGGCGCAGTAGATGAACTTGCTCTGTGCATCGCCAAGATCGGCGAGCA ATTTCTCGCAGGAATGTTTCTTCCCGGCCAGCAGCATGTTAAACTGTCCA CTTAGAGTTAGGATAAGCCCCAAGAGTGCAATGTAACTCCGCATCTTTTG GTGTGCTTTGCTCTTCGCCTACTTGAACGAGATGAAGGAGGAAACCAGGA GGGCGAGAAGCCGGCGAATCCCCTGGTGCTTCTGTTTGTTGATACGGGTG CTCCCTTTTCGCACACCCAAGTTCTTCTATGAAATATATTCTTTCTGGAG AGGAGTGTCGGGTGAGTTGCTGTTGGCATTACTAACGAAACTCACATTCT TACCCTCTGCACACTAAACAATATCACAATTTAACAAATACTTTTATAAA ATCATATATTTTTGTATTGTATTTCGGCTGGAGACATCATCCATCAATAG TTCTGCATGCATTCAGTTACCTGCACACCAAATTGTTGTCCAATTGCAAT AGAAGCAATTATTTGGTGTAATTTATAAACAAAACAATAGCAATCATTTA GATGTCCAAAAATATCGGGCCTTTGACACTTCGACTTTTCTTAGTGAGGA ATCGCTATGAAAGCGTGGAACATCTGGCAACGCTAAGAGGTTGGCGCGAA TTTTCAAATTAACTTTTACAGTAATTGCCAGTTTTCTCACCGAAATTGTA ATTGTAAAATCAATTGTCATTGATTTATTTTAATTCCCTAACCAAATTCC TCTTTTCCCCATTATGAAGATCAGCTGCTGTAAGTATCATATCAAAAATA GATCACGAAGTTTACTTTAAAATTGCACGTTTCATTTAGGCAACTGCTGA TCAAACTCTGAGCATTGTTTATCATTTATTTGCGAAAAATCTGTAAACAA CCCTTCACAATGAGTATATTTCAATGAAAGGAAGTTAAGTGTGTTACATA AATAGATGCAAAAAAAGCGGGGCAGTAGTAATGCTAAAATACATCGTTTT GGATATGAATGACCCAAAACAACCCCAACTTGGGGTTTTTCCATTATCAA TCGAGTTCCGTATGATCAGTAAAATATATAAAAATTTTTATCCATAGATA AGAAAGGGTTGTCTATTTATTACTCCATGCACATGAATAGACTCTTCTTA CATGTACATCTTTTTTTACTTGTCGTCGTCATCCTTGTAGTCAATGTCAT GATCTTTATAGTCTCCATCGTGGTCTTTATAATCTGTCGACGAAGTTCCT ATACTTTCTAGAGAATAGGAACTTCCCGAGGATCCGCTGCCGCCGGCGTT GCTGCGCCACTCCATCTTCTGGCTATCCAGGATCTGGCGCAGGCTGCTGG CCATGCCCTGGAAGTACAGGTTCTCGGGGCCCTGGAACAGCACCTCCAGG GTGCTATCCAGGCCCAGCAGGGGGTTGGGGATGGGCTTGCCCTCGAGCTT GTACAGCTCATCCATGCCCAGGGTGATGCCGGCGGCGGTCACGAACTCCA GCAGCACCATGTGATCGCGCTTCTCGTTGGGGTCCTTGGACAGCACGCTC TGGGTGCTCAGGTAGTGGTTATCGGGCAGCAGCACTGGGCCGTCGCCGAT GGGGGTGTTCTGCTGGTAGTGATCGGCCAGCTGCACGGAGCCATCCTCCA CATTGTGGCGGATCTTGAAGTTGGCCTTGATGCCGTTCTTCTGCTTATCG GCGGTGATGTACACGTTGTGGCTGTTGAAGTTGTACTCCAGCTTGTGGCC CAGGATGTTGCCATCCTCCTTGAAATCGATGCCCTTCAGCTCGATGCGGT TCACCAGGGTATCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGGTG CCGTCATCCTTGAAGCTGATGGTGCGCTCCTGCACGTAGCCCTCGGGCAT GGCGCTCTTGAAGAAATCGTGCTGCTTCATGTGATCGGGGTAGCGGCTGA AGCACTGCACGCCGTAGGTCAGGGTGGTCACCAGGGTGGGCCAGGGCACG GGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGTTGGT GGCGTCGCCCTCGCCCTCGCCGCGCACGCTGAACTTGTGGCCGTTCACGT CGCCATCCAGCTCCACCAGGATGGGCACCACGCCGGTGAACAGCTCCTCG CCCTTGGACACCATGAATTCATCAAGTGGATCTTGGTTTGTGTGAACCTC GTCCAGCGGGTCCTGATTGGTATGCACTTCGCATCCTTCGCACCAGCATT TTAGACTGGGGCTGCAGTGTCCACTGGTTCGCCCTTCCCTCTGGCAGATA TCTACGCACTTCTTCCTGTGCCACACAGCACAGGAACCCCTATATCTTCC GGAAAGGCAGTCGGCATGTGATTCTTCCGCTCCCAGGAAAATTATCATCA AGACAGCGGACAGGACAATTAGGAACTTGATTTCCATAGTTTCGGTAGGA GGTCTGGTAACTTAGTAATTGTTGAAATGCAATCCTCAAGAAATTGATCG CTCTCAGCTCAGAATAAGCGCTTAAATACGTTCCGATCTGTAAGTTTTAC ACTCAGTACGACGACGCTGTGGTGAAATTTATCTCGTGGAGATAAAAATA TTTACCCAGACTTTTCGGCTGCCTTTACAATTTCACCACGTGCCGAATAT AACAATGCATTGATCTGAACAATAAATATTGGTTCTTGACTTGATTTTAT TTTAAATAATTGTGAATGTTTAGGGAATTGAATTTTATGATTGATACATA ATCATTCTGGGTCTATAGAAGTTGTCCAATTTCGGTAGAAATTCAGCATC CTTCGCACCAGCATTGCAGCCTGGCACTGCAGTGACCACTCACTCGTCCT CGTCCCTCCTCTCGGCAAACCCGCCTGCATGTCTCGTTGTCCCAGACGGC ACAGGGACCTCTGTACCTTCCGGAAAGGCAGTCGGCATCGGCTTCCTTGG CGCCCAGGATGACCATCATCAGCAGAGCGAGGAAGGTGAACAGGAACTTG ATTTGCATCATTTTCAGTAGTTTTCGTGGTGATTGTTTTCTTTGATGTAC TAATCAATTCAGATTCGGATCGAATTTGTTTTCAAGTGCTTTCGACGAGC TTATATAGGGCTGGACTAGTCGATGTCGCTGCCAGCGTCGTTCGATTTTA TTTATTGATACTACCTTTTGTCTGGATAAATATACAATACACACAATATA ATTGTAAGAACGTCTCTCAATCTAGGTCCCATGAATGGTTCAAGGAAAAG CAAACAATAAATGGCGTAATGCACTTAATTATCACAACCAAAACAACAGG ATAGTGATATTTGCTACTTTGTGCTTATTGCCTAAAGCACATATATTTTC GAATGCAATTCTATAAAGTTTAAATTCCAACGGAGAGCGCAAAATTCGAT ATAAGCATCGATAACTGCACCTAGAAGTGTGACCATGTTTCGCGAACCTC AAATACCATGACTTAATTTTCAAATTCCACTGAGAACCGGATCGGCTATT TTGAATAGCCAGTTTTTCTCTGATCGGCGATTTGACAAGACGTGCGCGCG GACTGAAAATTGGATCCCAAAACCGCTAACTGAAAAATAAATAAAGCCGT GCAAAAGAAATAAAAAGTAAAGAAACAACAAGCGGGCCAATAAGTAAAAC GTAATCAGCGTTTCAATTCTCTCTTTTATTTGCGCTCTCGCTCTCTTAAG CCGCTCACATTGCACATTGTTGTTGTTATGCTCGTTGTAGTTTTTGTGCT AATTAGAAAATACCATTGTTGTTGCTTTTGCGCCGGTGTTTAAAACGCGG CTATTTCTAATTACTGCCCCAAAACAGAAATGAAAACAAAAAAAGAACAA TAGAAAAAACCCACTAATCTGGTTTTTGCGTGTGAAAGCAACTGGTGTGC ATTGGAATTTGTTATTAAGGTCGAAGAGCAGCAACAAGTGACAAAAATTC TTTGGCATAAATTAAAACAGAATCCCCAAAAAGCGCTGAAAAACGTTAAG ATTTCTTCGGTTTTAACACTTTTTCGGCTTGTTTTTGTAACCAAAACCAA AGAACGCCGCTTATGGTCGAACAACAAAAACAACTTTCCGGTTTTTCTCC CACTTCTGCTCCCCATCCTCCTCCATTCCTTCTCCTCCTCCTGTTCGCGT TCTCTTGTTTTTTATAACCATCTTCGTCTGCATCTTTCGATTTTCACTCT GTGCGTGTGTGTGCCTGTTTGTGTGCGTGAATAAGAAAAGTGGGAAGAGT GGCGAAAGGAAGAGAAAGATCGTAGTGAAAACAGTCGGCGAAAAAACAAA TAAATACGGGAATTTATGTTAATTGCAGCAGCTAAGAACGAGAACGGAAA GAAGTAGCTGCGAAGCAGGAGGCATCCAGATATCCAGAAATCTGGAGAAT AAATATAATTTCTTGTGCGCCAGGATACTAACGTAAATCATTCACGCTGG ATTTGGGATACTACGAGGCTGTCAAAGGTAAGCGAAGTACAAAAACCGGA ATGAAAGAGAGAAGATCGTTAAAAAAAATATGGGATGTTTTACGGTCCGA TGCTCCACTTTATAAGCCAATAAACCCGGCGCAAGGTGTTGCATAACATC GCTGCGGCTCCCAAAATGTAAACGGTAAAGGGCACTCCCGATCCCGGGCC GATCTTCCATTTAATACCACCTATCCACTTCCACTGTGGTCAAGTTGCGT GCGAACGGGTCGTAAAAACTGCCAGGCTGTCATATACAGACATACAGTCT AGTCTGGCTTGGAGGACCTCACTTAGCTGAAAATAGCTTAACAAGATATT AAGTATTCATAAAGTGTAACTACGAACGTGTGAGTTCCAATCTATAACTA TTTCTTGTTGTAAGATCAAGTGGTTCTCAAAGCTTCTTCAAGATTCTAAA GCTTATAAAGTCTTATTTTCAAATCTTAATTAATTGCAAATCCTTACTAC AAATGAGACTTCCTAGAGCGTCTCAGTTGTGGAGGCTTGCCTGTTGTTCT GCTGTGAATTAGCATAACGAGGGTACGGTGCATGGGGATTCCCTCCCCCT TTTCCCTCCGCCCGCTCTCGTTGGGCACAGGTGTCTCTAAACCAGGCTCT CTTTTTTTCTGGGCTGTGCTGGCCATTCGTAAACTAGGCTAAATAGGGTC TAAGCCCAAGCACGTTTTGGCCCCGCCCTCTTGCCGCTCCTCACCCGTTT TGGCCGTCTCGCTCTGGGCTTGGTTTATTTTTAAACCGCATTCCGCTCGT TTAGAGGCTGTCTCGCTCTGGCTGGTTGCCTGCTCGCTCGCTCATTAGGC ATGCTGCAGCACCGTTAAGCGTGAAAGTTTGAGAGCCACTGGCTGCGCAC CGTGATTTGCAAAGTGCAATGGCAATAAATGCATTCGCAAGACAATTGCC GCTTAAATTCAATTACACTCAACGGGTCAGCCAAGAGGCCAACGACTATC AACAAGGCCAAGGCATGGCGTCGTATGGAGTGGGGTGGTGGTGTGGGGGG TGTGTGCATCGCAGAGGCGGGGGGAAAAGCCAACGCCCCCAATGCAGCAG CCCATTTGCATACATTTGCGGCCAGCTCGATAATAACACATTAAATGTTG TCTTGTAATGATTAAATTAGTTCAATGGAATCTTAACAAAGTGGTGTTAT AATAACATAACATTTAACATGGCATTTAACCTCTTTACGAAGGCATTGCA ACAAAGAGTTTAATTATTAAAGTGTAGTTGTTTTTATATGTTATGCGTTA CAGCGATTTGTTGAACGTTAACTCTATTTGGAACCAAAGTAATTAAAATG AACAACTAAAGGCTCTAAACTTACCACCCCGAGTGTTTCTGTTTGTAAAC AGACGCCGATCTCTGCAGGAAAAGTGCAACAACAGCAAAAGACAGCAGTC GTACAGTGGCTGTCAAACTGGCAACGATATAAGTAGAATTCCTATTGGAG TGGAGACCCAGTTGGTCCATTTTTCAATTCTTTTTACATTCCCCTCGAAA AAAGACCCAAGCACAACCAAATGACTGCACATGGACTTGTTTATATCTTT GCTCTTTGTTGTTGTTTTTTCCAATTAGATGTCTGCACTGCAGCTGGGCG GTGTTGTTCTTGTTGCTGTGGCCGTGCTCTTATTGGAGTTTTTAAGGCGG CATTCTTTTGGATTTTGCGCAATTTGCGCGCTGTACTTTTCGTTTCAATC GATTCCATTTCAAGTGACTACTTTCCCCTTTTTGACCAGTGTAAACTGTG CATAATCCCCATTCAAAATCAGCCAAAAAGTCAATCAATCAATCACCGCT TTATTTCCGAACCACACCGCCTACCCATCAATCAAAGGCCATAAAGCAAA TTTAGAACGACTTTTTGTGATTTTACGAAATAGGTCTTATCGCTATGTCA GCATTATGAGGCGGGTACAGTCAAAATTGGTAAAAAGAAACTCTGTTTTA GCTGTAAATTGTATTGTTGCCTTTGTATTCATTTTGTTTTTAAACAATCA AATACTCAAATTATACTGATTCACTTGCAATGCATAAAACAGTTTTAATA TGCATGCATTAGGCAATCCCATCTGTAGTTTTTTGAACTGCGGTCACTTT CGAGTGGTTATGAAATCAAAGGGACTGAATCATAGAGATAAAACAATTGC TCGACTGCAAGTGATTGGGAGGAGTTGTAATTGTAATTACCCCTAAATTA AATGAAAGGCCGCCGGAGTTAATGGCAATTGACTTGCTGAACTCGATTCC TCAGAGGAGCGATTGCCTTCTGCGATCCGTTTCGGTTGACAATGTCAAAT GCATGCATTCAATATTATTTAACCTATTTGCGCTTATCTCTGGGTGCAAG TCCAACATCAATGATTGTAAGTAATCTATTTGGAAAACATTTAAAATAGC TAATGTCACTTGCCAAATTGATAAGCAATGAGGCACCCCTTTGGCAAAAG ATCCCATCTGACACGATCGGTGTGAATGATGTTATTATGATGTACATATG TATGATTCCAAGTTCTTTTCTAAAATACTTTTCTTTGAATCTATTCCTTA TTTAAGAAGACATCCTTATATGCATACTTTTTCTAAATAAATAGATTTGT TGGTCGAGGTATAAGAACTGAATCTACGAGTTACGTTATAGGAATTTGTT AGTACTTCTGTACTTCTGTTAGTAACTACTTTAAATTGGGTATTATTTGT TGTTTATTTCTGAGAAATAACTAATAGTCGCTTTTTTCTTCTGTGTATGC AAATTACTTGGGAAGTAATTAGAAAATAACCGTAAGTCGTGTGCGAAAAT AAACCGCTATGTACAAGAGAATTTCTCGCTCTCTTTGGCTGCCCATTTCA CTTGTCTATCAATTGTGCGGTTTTCTTAGTTTTGGAGGTTTGGGAAAACT TGGCCAGCTTCAAGACTTCCAACCAGTTTTAATGTTTTCCTGAGCGCGCG CCAAAAACCAAAAACTGAAAACCAGCAACAACGTGAAATGCACATTCAAG GCTATAAGCCAGTAACAACAACTAAAAGTAAACTTGCTCAGGAACTGGTT TTCTTCTGGTCTTGTTTTTTTTTTATATTTATTTTACTTCGTATTTTGTA CTCGCACTCGCGGTTTGCTTTCTTTTTCTCATTTCGGTCTTGTAAGTCGC AGTCTGTCGACCGAGTTGGCCAAAAATCTGCCCAGACCAAAGTGCTTATC ACCAGGGTCCCTCGCACAACAATAAATAACGCAGGAAATGTGCCCACACA AAACGCTTCAGAGGCAAATTATTTATTTTCTTGGGAACGTCGAGGCTTGG CGGAATTTCGTTAGTCGTTACTATGTGGCTAGGCGATTACCGAGATCGGT TCCCAGCCAAAGTTCAAAGTGCAGGATCGTTAATTCTTGCCTCATATGAG TATATATGCATTGCAGATTGTTTGGTAAATTTTTTAAATATTACAGTACC TGCTGAATAAAAGTAATAGCTAGGCTTTACTAATCTGTGAACTTACTGGC ATTTTGAAACGAGCATTGGCATTTCAAGAATTCAATTTCAAGGTGGCAGC ATTTAAGTATCTTAATGATTTTAGAGCTCCTTCGCTTCAGATATCAGATA TCAATATAATTGACAGATCATCATTTATGCTCAGGGTTATGATTGTCGGG TTTCATTGTGTTTTACTCCGATGCCAGAGCGAATTGGTGCCACCTGGGTG CCATTATTTCGCATCGTGGAGGCGATAGGAGGGGATCGCACTGGCAACCT TGAAACCTGCTCTTGCCTTCCTTTCTGCCAGGTGAAATTTCGCGGCAAAG AGGTGGCTCTCTTTCACTCGGCTGGCAGCTGAAAAGGCCCCGAAGATTTG GTCTTTGTTTTGGCCTGGCTTTCGAGTTTGCGGACCTGGGCCATAAACAA TTGCCAGCAGGTTGTTCGCATTTAAGCTTATTTATTATGAAGCCGTCTAG CTTTTTGTTTTTTTTTTTTGTTTTTTTGGAGTTTTTGGCGAGTCTGTGGA ATTTGGCTAATCCAGTCAAGTGTTTGGCGCAGCGAGTGGCTTCGGTTTCG GCGCTCGAGCTCAATGGAACCCGACTTATCCAGCGGAAGTGGTCGGAATT CCGGTTAGCCAATAGTTTTTCAGTTTTTTTTTGCTTGGCTCGACCAGTAG CGTAGGAATAGAAATCTTATCAGCAGAAAACAAAAAAGAAAGAAACATTA AATATAGCCTTGGACTGGGCGCTTAAATCTGAGCAATTTGCCAATCAAGC GAGAGAGTCCGAAATCGGAGGAACTTCCACCCGAAAACGTAAAGACAATG CCAAATTTAATTGAGTGAGATTCGCGATTCTCTTCGCATTGAATTCTTCT TGTTTTTACGGCCACGGGTCCAATCAAAATATTTAGCTTATTAGTTGCGA GAAAGATCAACAAACAGCCGAGCAAAGTCAAACAAACAAACAAAAAGTTT CATTCATCAAAGGAGCAGCGTGAGAGCTGCAAAGACCCTTGGAGTCTTTA GATCTTTTAATGCTTATGGAGACAGTGCTTCAAGTGAATATATATCGTTT GTATAGTTGCATCACATCAAAGACTTCCTAAAGGTGTTTGTTTCGTTTGT CTAAATCTGCAAAGTTTAAGCTATTGTGACTTCTGCCTACAAATGACTTC ATCCTGTCTTCTTTATTGTGTGATATCATCGCCAACAGCAGAACCCCAGT TAGCTTTACAGTTGCGAACCGCACTGTGGCTGCATATGAATTTTGCCTTT TGGGCCGAGGGCCTGTGGCAATTAATTACATTTTGCGCACTTTGTTTCCG CTGACTGGAAGAGGTAGAATTTCGTACTCTGTGCTGTAATTATTTCTTCT CCTTTGTCTGGGTTTTCATTACGCTTTTTTTTTTCTTTTCTTTTGGTATA AGGGGTATGCGGGGCATATAAGGTGAGGAGCCAATGAGCTTGTGAAAACT ATCAAGGGATGTCATCGCGTCGTTACCAACGATAAATAGATGAAGCCATA AAAGCGCCGCTGGTTCTTGGCCTGTTGGCTTTTTGTGTTTGTGGTGCAAC GGTTGTCGATGTTTTTGGCCATTTCTTCAAGCCAACCAGAAGGTGTTGAT GACTGATGGTTGATGGTTGATGGGTGATGGTCATTCCCCGAGTATTCCCC ACTTTACCATGCTCTCGGTGGTGGGGCATTGATTTCGCATTTTAGTGCCC ATGCAGCTGGGTTCCCGAAGAACAATGCGCATGTGTGCTCGTACTCGTAC TCGTAAATTGTTTCTGGGCTCCCCTGTCTTTCCACCGAAAAGCAACCTCG CTACTCTGGTTTGCATACCTCGCTGCGTACAATCGATCGGAATCAAAAAG CGTAACAGAGCCAAAGCAGAAATGCCAAATATTTAAGCGGCCCAAAAGCA CAGCTGTGAAGGCTGTCAAAAGACACTGGACAAAATATTGTGGTAATTTA AAAAAAAAAATAAAAAACAAAACCAATAAAGTAATTCAAGATCTTTCAAT AAATATAAGTAGTAAGTTCTGTAGTCATAAGATCAGATTTATTAAACGTG TAAGCTTAAGATAAGAATAAAACGATCTCATAGAAATATGTACGTTAGTT AATATCTTTATTAATGTTATATTGAAGGAAATCCCATTACTTGATCATAG TAATTGTTTTTTGGCATATAAAAGGCATTGATTGATTGTGGAATCTTAAT AAACATATCCCCGTTTTTTTGCACTGTACGTCCTGAGCCCTCCTCTTCTT GGGCTTTTGAGCCCGGTTCGAGGCGGTACTCGCGTCTTACCTTGCTAGAG GCTTTGGGTTTTGGCTTTGACTTGGCTTGGCCCGGCTGTTCTTCTTTCAC TTCGGCATTCCTTGGCGTACTTTATAAATGGTTCTTTCTCCTCGGATTTT CGTGAGTGCGTGAGTTGTGCTGTTATTTATGTTATGAGCTTTATGCGTTC CAGTTCTTTCACATGAATTTGTCCGGCTAAGCGATCAGTTAAAGCCAACC AGTTAAGCCATTTTGAGCTAAAGACTTCGGATGATGATGATGACACAAAT GAAATGCCTTGAGTAAATTACTGAAGTGGCTAACTGAAATGCCAACTGCT AATGGGGCCTCGAAGGCGAACGGAAAAAGGTGACTTGTCTAAATATAATT TGTCCGTGCAATTTATGACTTTCTTCGGCGATTCACTAAGTTTATGGCCC ACGCGGTGGACTTTTTCAATAGAAGCTATCTGTAAGGTGATAGTGCCGAT AGTACAGATAGAGCCCCACGGTAGTTATCAACTGTCGAACTTGCGATAAA AACTGATTAAATGCACTTTGCTTATATGCAGGAATCGATGAAAACAGCTC CATGATGTCAGAGCTCGGAATGAGTCAGACTTTTAAGTCTGTGAGAAAAT AGAGACTAGTTTTACAGGCTAGCTGAGCTATAAACAACTAAATCATAAGG CTAATGCTATTGATTTAATAAATATATATAAGAAACAATCTTGGAGTAAA AGTCTTATGTTGGCCCAATCGAAGACTTTTTTTTTAGAGTTTTCCAACCA TCGAAGCTCTACTATAACTAAAAAATTCCGAGAATAGTGACTGTGTCTTG TCATATTAATTAGCTGGGAACGCAGATCAGCTCGGAGTCCGATGATCGAG CGGTATTATAGTCGTGACTGGTGGGTTACAGAATGTTTTACATTTGCATG CAGCAAAAAGCAGGCCGCGTAACCTTGAGATCGCTTATATAACACTATAT TTTAAACCAAGTCGACGAAAAATGGCTAAAAGGTTATGTTCCCGCGTCGA CTGAAAATAAAATTACACGCTTAAATAAGAAAATATTTACTTTAACGCTG ACATCAGACAATCCAAAAGTTATGAACGGAAAGCGGCGAAAAAAAATGGG GGGAAGTTGAACGGCTACGTGGAGCTTTCCAAACAAGATATTCTCCAGAA GTCTGCTCTTCTTTGGGGTTCTGTTTGTTGTAATTTTTACCGGTTTCCGA CCGAAAAAAAAAATATGTGTCTGCTGCGACTGTTTAGCATTGTAGCGTGA AGTCTTATGATCTTTATTTCCCATTTTTCCATATTCCATATTTGCGATTT TGATTATGACGCGCCGGGCAACAACCAGCAAAGTCTTCATCAGCGAGTTG CCAATGAGAATTTGCATATGCCGCAAGGCAGAAACGAGTTTCGCATTCCT TCACTTGGCCACCCGGCAGATTCGGATCCGCAGAGAATTCCCCAGGGCAC TTGGATTAAATTAGAGGAATGTGCAAAGTAGATTTGCGTCTGGGGATTAC CATGAAATATGGTAGCCAAATTGTTATGATAAGCTATCTACAAGTTTGGG AAATGTTGGTTGGGAGAGAGCTTTTTCAATGGCCAAAAGTAGCATTCAGA TTACTATAAAATCCTATTATCCGATCAGGAAAATTTTACTTTCATGTCTG CAGTGCACAAGGCTTTGAGATTATATTTTACCTATCTCTATATTTTAGGG ATTAAAATAAAATCTCAATTGCAAGAAAATTGTAAGAGACGGAGTTAAAT TTTTCTGCTCAATAAGCTTTGCGATTTTATTGAAGAAAGCCAAACTTATT TCATAGAGTTAGTGGGAGAAGAGGGGACTTTGAGACCCTTTGGGAAGAAC CCTCGATCTCTCTTAATAAGCCATCCCAAGCTATTGCTATTTTTATGCGA AGACCTCTCTTCTCGAGGGCTCTTCAGAAAGCACTCGAGAGTAAAATTAT GCATGAAATGTTTGCACACAAAACCGCAAAAACGTATAAAAAAGTATTCT CCAATGTGCTTATAACGTCATCGAATTTGAATTTTTGTCGTGTAATTGTA AACTTGACTTTTTGCTGCCCGATTTCGGTCTGTGGTTTTGCGCAACGTGC TTTTTGAAGTCGGAATGCAGTTTTATTTTTGGGCTGTCTGAAATAACAAA CCCATATCTGACTGAGTTCGTGGCTCGTAAAAAACACATCAAAATCGTTT GATACTCATTTAAAAGTCATATATTATGAACGATCATACACTATCAGCGA TGTTAAACAACTGTGATGGCCCAGAACTTTCAAATTTATATTCCCATCCC CCCTTAATGTAACAAATTTATATTTCTTTTTCGATGACGATTTTATTTTT ATGGCCCGACACTTGAGTAAACATTTGTTGTCTCTCGATTCTCAGGCTTA GCCAATTAAAAATTCAATGGGTAAAACTCCCCGCCAAGGGCTTCTCACAT GATTTCAATTTCAATTAGGTTCTTTGAAATAGATGTTTAAGATATGAGTT ATGACTAGATTGTTTTCGTGACATTTTCGGGTCTCCGGCTGTCAAAAATG AAATTGAATTGTTTTCCCTCATGTCAGATGATCATATGATTGCCGTTTGC CGTTTGGTCGTACACTTTAATTAAAAGTAAAACGTTGCGAGGGTTGTTGC CGATAGGAGCGACCTTACCCCACTGAACTCTGAGGGAAAATAACCCGACC GAAACTGAATCGATAAGGCGAAATACTTTTGGAAACTTCCTGCGAAACGC GCCGGAAATAGCTTAAATCCCCAGCTAAGTGTTAGATTGTTGTGCAAATA TTGGACTTAGTCGTGAGTGGTACGTGTTTGTCATGAGTGCTGGCTTATAT ACTTATGTACTATATATACAATATATACTATACAACCAGATATCACTTCG ATGACTCAAACTTCGTTGAGCTTAAAATTTTGGGTTCACACGTGTGGCGG CTTTTATTGAGTCTCCCCCATATGCAAATCATCTGCGATTAAGTCATATT TTTGGCGCTATTCGAATGGGAAGTGGGTAGATGAAACTAATTAATCAGAA ACCAGCTTTTTTTGGGAAAGAAAACAAACAGAAATACAATTGGTAGAACA GCTTAGCCTCGACTTTTGAATAGTTTGAAAGTTTCTGCTGGCTTTCGACA ATTTTCTTTGTGTCATTCAAGTGAAAGTTTCCAGTTTTCCCATAAGAGAT TAACGAACTTCGGTTTGATTGTTCAGTGTAATTATCGAGTTACATGGTCT GTTTCCGCTTATACGTTTGTAGTTTGTATCTCAAAATCTTAGAATACTGT TGTAGATAATCAATCAAAGCGATTTAGTCACACTTAACGCCCCTGGATCT GCGAAATCCATAATTGCCTGGCACTTCCCACCAATCAAAGGAAATCAATC AAAGTTCATAGCTTCTTGGAAACCTGTTCCTTAGCTCCTCTCAACTGTTA CAGAAACCATCTGGTTTAATGGGCCTATATCCGCCATATCGAATCTTAAT TACACCACAATTAAATGAAGACGCGTGCCTAGTTCCTCCTTGGTCGCAAA ATTAATGGATCTTTCGTTGATTCGCATCTCCAATCGATTAAAATTTATTA TGTATTTGGAACCGCCCTGCGTATTTCATTTTTAATTGATTTTCATTGTG CTCAAAGGATGAATTTAGAGAAATTTGTTTCGAGGAATTTGTGCTATATC TATGGAATCTCTATAAATCCCACCCGTTGTCATCTTCATTTGCTTCTTTT GTCCCCGGAGATTTCTATTCGTTAAAAAGTGATGTCATCGCTTGACTATT TAATTTTTGGATTCTAATCATGGCTCGATGGATTTTCCCAGCACGGAGAA AAGCGCTGAAAAACCGTTGAAAAGCGTCAATTGAAAACGGTTTTCATTGC CAAAGTCTCACTGAAAAATCAGTTAAAACCGCTGAAGCGGCGCCCCAAAT AAACGAATCTAGCATTTGCATAATCAAATCCCAAATAAAAAGAACTCACG AAGGCAGGGAGAAAACCAATTCGAATTCGGTAGCCGGTGGCGCATGCGCA GAACCCTGAAGAATATAACGAATTTTTGGGGCTTTGAATCAAACTCAGAT TCGAGGTACGATGATGTCATCAAAACAACATGGGTTGCGGGTGTATTTTG TGTGTCTATCGCATCGTATGTGGTACAGCCCCTCCGGGGGGCGTGACCAA ATGCCAAAAAGCAATAATAAAGGCAATGGCCACGAGGAGCTGGGGGCTTT TGAGTGTGGCTCAACATTGACTAATTTTCGCAAATAACTTTTGGGGCACA TCACATAGACACATAGATATGGACGGCAACACACGTCCGATCGTACCAGG CAAGTTAAAAAAAAAAAAAAAAAACATGAGCGGAGTGAAGCTCTCTATAA ACAATTTCGATTTCAACAAAAGCAAAAGGCAACCAAGAGCCATGAAAGCA ATCGACGAGCTATGTAATATTTCTTTGGCATTTGTATCGCTATGAGACAA TAATCAGCCAAAATGTTTGGTAATCATTCGAAGCTCCACCCAATAATTTG GCTTTTAATGGAGTTGGGGTAATATTTGAATTTATTGATGAGAAAAGAGT GAAGATAGATATATTTCTGTTCATCTATCTATCTCATATTAAGTTAAGAG TATCATAAGTCTCTGTTCAACTTTAGCAGAATAAAAACGTAACTCTATAG ATCATTTCCAGTTTAGATCTATTGTTTAAATTAAATCCAAGTCTGTGGCT CTTTCGTCTCCAGCTTAGCTGTTTTCTCTTTGAAATTGTTTGTTATTTTC TCTCGTTGATTTTAAAAAATTGTTTAGCATGCCAGGCACAAACAAAAGAA TTTATATCACTGTGGGTTTCTACTTGTTGTGTTGTGTCAATCTGTATTCT TCTTTTCGACTGAGGCCAAAACTGAATTTTAATTTCCAGCCACTGATGAG GTAATTTTATGCGTAGAAATTTTTGACAACAAAGACCACCAATTCCCTAA TTTGCCGAGCTATAGGTCTCATTATTTTCGGTTCAAAGCGGAGATGGCTG AAAAACTACGCTTTTATCAGACATATGCCATCACTCACGCAAAAGTAATT AAAATCGGTAACTACCTCGGATGTTATCTGAGTAGAAAAAGGTTGCCAAA AAAAGATGCCTAACTTCTTTTTGATATACTTTAAAGTATCATTTAATTCG GGATTTGCTAAATGATATGTGTGACTTAGCGTATGGGCCATAAAAATTAA GCATACAAAATGCTAAATGTTTATTGATTTATGCAAATTCTTACACAACT CCGAGGTTGTTGCACGCCTTGTTCATTAGCTAACCGTGTATGTGGAACAC ACAAGATCTAGAGAACACCGAAGAAGTTGAAAATCTATAAAAATCGTTTT CAAAGTGTTTGCGATGAGTGAAGTGTGGTGGTTTATAAATAGAAAGAGGC GCGGAATCCGAGTGTTCCTGCTCCCAGCTGCCGCGCATGTGCTGTGCTAC CATGTTGTATCACAATTGAAGTAAACAGGATGCCCGGAATTCGAGCCTCG GTTCGCATTTGCCCCTGACTTTGCCTCTGCCGTCCTTTTCCGGCGACTTT AGTTGTATAAATAGTTTATGGCCAAAGACAGCTGTATGTGAGTTGGGGGA TGCGTTCTATTTTGGGGATCAAGGAGGCACAGTTTTAATTGCTTTTCCTG CTAAGCCTAAAGTTATGCCGCACTCTGCATTTTCTAGGTTTTGTTTGCCA CTCGATAATGATAAGCGTCGAACGTTATCGCGGTATGGTAAAGTTTATTG TCACACTGGTGTTGTTGGTTTTTTATTGTTTAGTTTTCACCTCTTTTTAA TTGATTTTTCTATTTGCGAAAGCGAAGTGTTCTGTTTGCCAATTAGCCGC GAATGCCTTCCAGGTGACCTCAACGCCATTGGCGGCACATATGTATAGTA AATGATCTATTAGCGGAGTTATGACACCCGACCCGAGTAGACAGCAGATT ATAACTCTTTGGCATGATGTCATTGGGAATGATCGAATTTGGCAGCTATT CTAAATGGCCCATTCATTAGTCTGCGGAATCTGATAGGGCGCCATAAATA ACTTGATATTGGAAGTGCATTCCCCTCTATATATATGTATTTATTCCGAA AAACATATGTCCGAGGTATGCGGGATTTATGGACCGATAAGATAAGCCGA CAGGGTCTATTGGCTGTTTGTCAAGGCAAGGATTTTCAGATACCTTAACC GTTTTCTCATACTGCTATCAGCTCGTGCGATAAAGGGAATTCACCATAGG CCAGTTGAAGCATTTTTGTTGCCACTCTTGGCATTTGGCTTTTAATTCAT CTGATAAACAGAGCCAAGAGGGGGAGGAAGCTTTCCCCCACTCTACATTT TTGGGGCGTGCAAAATGTTGGGCACACATTGTTTTTAGTGACCAAACGGC GCGGGCTCTGCGAACATCTGACCGTAGGAACGAAACTTAGTGTCGAAATA CAAAATAGAAATAAAAAACGAAAGATTAGCTTTAAGGAACGGCACTCGGT GCTGAAAGCCCGGATATCTTGAGAAACACCCTAGAAATCACTGATCAAAG GCCATGGAGTACAATAGTGTTCTGCGCTCGAATTTCTCGCGCAACGAGTA TCGCCGATATATATCCTACGAACGCCAATCGTTGGGTAGGTTTCTGAACT TGAACTTTTCCCCTGGAAGCTCGCGATCATTATACAATCCCGAAACGAAA GTAACCTGCTCTTATCTATCTCAGTTGGGTGGAACTTCATATTTGGTTGA TAAGAGCGCAAATATTTGGCAAATGAGTCAACGGCCTAGAAAAATGGTTT CGCTTTCTGCAGTTTCCGCTCCAATTTTGTTCACTTTTTAACATATTCTC TTGTCCAGTATTACGTAAAACGAACCGTTGATAAAAAAAAAGTAACAAAG TCGTGAAGCATTTTCCATAGGTATGAAGTAATTTTGGCAGTCGACAGATA AGCTCGCAGAACCACTATCGCTGGGCAGCGACTGTTTTGATTTCGATACG CTAGCTGGGGGTATATCTACTGGGTTGGAAAGTTGGTCACAGCTTGGTTT GTTTATAGTTGGTAGAGTTGAAATTATCTTACACTTGTTAGCAAAAGAAA TTTAAAGATACCTTACTCTTTCATGAGGTAAAGTTACTTGAAATAAAGCA ACAGATTGCTAATTTCTACATCTTAAAAATCTTTCACTATATTTTAAAAT TCACTATCAAGCTTACTCAAAAAGGTGTTCACAATTTTGTTCAGCTAAGA TCTAAATGTGAAACGCCAATCGACACATGGCTTATCTTAACGGGTCTAGA AAACAAAAGTACGTGATGAGGCGTTCGAATAAAAAGTGATTGTTGGTTCT TCGTTTGAAATACCCGTTGGTAATCTTTGACATTATGGGAACCCACTGAT GGAATGATTTAAAATTAGGAATTACGTTTGACATAATCGAAAGACTACAA ATAAACTGCCTTGGAATGTGGTTCTAACTTTAGCCAGGGATTTTTTTATA GAGGCAATTATGTTGGCGATAACTCGTTATCTCTAAATCAATAGGTTCGT ACGTCACGGTCGTGCTTTCCCTATCTCTGCCACATACCTTTCGTATTTTT CCTCTATTTTCCCTATGCCCATTATTGATTTTGGTCTGTTGTCAGGTGGT TTGCCCATTTCTCTTTCCTGGAAAAAAATACAAAAAAAATGAAAAAAAAT CAAAACAAACACTAAGCCTAAACGTTTCGCGTTGCATTTATATGACTTCG AACTAATCCGAGATTTTTGTTCCTCCTCCCTTCCCCCCACTTAGCATCAC AATATGAGCCGGGAGGCTACTCCGCGCTGCAGACACCGACGCCTTCCAAT CGCAACTCCGCCAACATGACCCAGCGGGACGGCATCATCAAGTTCGAGAA CGAGCGGATCAAAACGCTGCAGGAGGAGCGCTTGCACATCCAGAAGAAGA CATTCACAAAATGGATGAACTCGTTTCTGATCAAGGTGTGTAAACTACTT GAGTCACTCATCACTCCCAATACTTGTAATTTAATTACTATAAAGTACAA ATGAAAGAAATGCTTTGTTTTGCTAAGCACATAAAGTTTTCATTGTTTAA ATACTATAATTTCTCGATCAAAGTGATGTATTCAAATGAAAGCGCCATAT GTATATGACATTCGAAATTATACATTCACTTGAAATTTTGATTGGAAGAA ACTTTTATGGCCCCACCAATTTATGAATGCAACTCACATTTGGGCTTATC GTCTTCTTTGTAGGCCAAAATGGAGGTCGAAGACCTATTCACAGACCTGG CCGATGGCATCAAGCTGCTGAAGCTGCTGGAGATCATATCGTCGGAGAAA CTGGGCAAGCCGAACAGCGGACGCATGCGCGTCCATAAAATCGAAAATGT CAACAAGAGTCTGGCATTCTTGCACACCAAGGTGAGATATGCCACATAAA TGGCGGCGAGTGAAGGGAGTGAAGGCGTTGCAGTTGCTGGAAGACCAAAG ACCGAAGACTGAAGACTGGAGAGTGTAAAGCTCTCTACGCATTTGTAGAA AGTGCAAGTCGCGCCTGCGCAGCTGCGCGTGGCCATTGCGTGCTTTGTTT GCCATATGAGGTGCACGGATCTGGCTGTTGGAGTCGGGATTTCGGATCTC GGGGAAGCGGGAAGTGTGAGGCGACGTCAAGACATGGCGAAAAAGTATAT ATTTAATTACCTAGCCTGGGCACCGCGTTTTCTTGGCAATATCTGAAATA TTTGCATACTTTCTAATGCATTTTTTCCTTGACTTCACTTCACTTTGTTG CGCTTGGCACATTTTCCACTGCCGCGCTCATACTATACATGTGTACTTTC TTTGCACCTCTCGTGCGCATTTGATTTTAATTGAGCAAAGTGGGAGCTTA GCGTGCGACATAGTTTCGAATCTTCTGGCTAGTCAGGTGCCTCTGGTCTA ATCTAATTAGAAGCAATTAAAACGCATCAAATTGTCCCACTGTCCAACTA ATTCACTTTGTTTCTTAAGCGGCGAAGCAGTGAAAGTTTTCGGTTTTACT TTTCACCATTTCATTTCATTCCATTTCGTATTTCATTTGTTTTTCGGGCT TGTCTTTTGTGTGTGACACGGGTATTGAGTGCATTTTAATTGGTGTTTAG GCTTGAAAGAAGCCCGAGCGAAAGATTTACGCACAAGCGAGCATTCGATG GAGGATCCCTTGGGGACTCATTGAAGCGTTTAGCGGAGCACGACTCTTGG AATTTCCAGTCGCCATTAGGAGAACCAAAAGGCGTAGCTCCCTACTAAAC ATTAATGTACCAGAATAACTCGGAACGAGTCTATTAAAGCAAACGGTTTG TCGGGGAATAGGAATAAAGTTAGCTTACTGCCTTCTTATGAACTATTAAA AACGATAATCTGCCATACATAAATTATAAATGTATATATAATTTATGATT TTGACAATACTATTTAAATTCCTATAAATATGCACAAAATCGATCATAAA TCTATGATTAACCCACCTCCAGATTCCCCTTTATCTGCTATGAATTTAAA AAGAAGCCGTAATTGGTTCTTAAAATTCTAATTCGTAAACTAGTTTTTAG TAAATGCTAAATGGTCTGCAGACGAGAGCTCTCCATCTCAATTTTCCACC TGGACATAAATCAGCAGCCAACCGCTGGCCACTTTGTAGCTATGATAATG CGATTTAGATCGGTATCAGCTAGTAACTTATGCTTTCCTCGCTGGGATTA TCGTGCGCGTTACCTGTCCGCGCCCTGACCCACTATAAATGCAAATGGCA GGCGAGCGACCCACATGAACCCACCGGGGGTCAAGCACCTCCACCTGATA AAGCGTGTCTTGCTGGACAGGCGCAGACCCAGTTCGAATGTATCGGCATC TGTGGGATGTGGAACTCTTGGTAACCCAATACGCAGCTTACCCACTCCAT TCACCAAACGGGAACTGAAAGAAATGCAGAAGAGATAGTGTGGAGTGGAG AATGGAAATAATGCATGATGGTTTCTTTCGTCTTAGGTCCGTCTGGAGTC CATTGGTGCTGAGGACATCGTCGATGGCAACCCCCGTCTCATTCTCGGTC TTATCTGGACCATCATTCTGCGGTTTCAGATTCAGGAAATTGAAATCGAT GTGGTAAGTTGTCCCTTCGCAAGTCACATAGCAAAAGTGCTTAATTTATA ATTCCAATTCGTTTCACTTAGGATGAGGAGAACGAGTCCAGCGAGAAGCG TTCCGCCAAAGATGCACTGCTCCTGTGGTGCCAGCGCAAGACGCATGGCT ATCCGGGCGTCAACATCACCGACTTCACCAACTCCTGGCGCTCCGGCTTG GGCTTCAATGCGCTCATCCACTCGCACCGTCCCGATCTGTTTGAGTACAG TACGATTGTCAATTCGAAGAACTCCAACCTGGACAACCTTAACCATGCCT TTGACACGGCCGCCAACGAATTGGGCATTCCCAGGTCAGAATTTTGTAAA TTATAAAAAATATGTCAATAAAATTAATTGTAATTTGTTCGCCCCCCTTT TAGCCTGCTCGATGCGGAAGACATTGACTCGGCCCGTCCCGATGAGAAGT CGATCTTGACCTATGTGGCCTCCTACTATCACACCTTTGCACGCATGAAG AACGAGCAGAAGAGCGGCAAGCGCATAGCAAATGTAAGTAAACCAGGGTC GGACCCGGCTTCAGCTATGAACCTGCCTATAAAGGTAGATGCGGATGCCA TTGGCAGAGGCCCATCGTCTCTAGAAGTCGCTGCAGCGTAACGGTGTCCC ACAGTTAACGCTCTACTTCACAATGGATTGGCCACCGATTGGATTCGGAT TCCGATTCGGAATCAGATTCGGGTGGGGTCCAGACCTACACCTAGAAAGT CGCTCAACCAGCTCTCTTTTTCTACCCCTCCGCAGATTGTTGGGCAGCTA ATGGACGCAGATCGCAAGAAGATGCAGTACGAGGGTCTGACCACAAACCT GCTGAGCTGGATCCGCCAGAAGACGCTGGAGCTGGAGCAACGCGACCTGC CCAACTCGCTGGAGGGCATCCAGCGAGAACTGCTGGCCTTCAAGGAGTAC CGCACCATTGAGAAGCCACCCAAGTGAGTAGAGGTTCATGACCAGCCGGA AACGATACATTGTATTTCAGTCGGATCACTGCTCGGATACGCAGAGTACA CCTACACCCGTAGTACATCTATTAATGATGGTCCTCCCCTCCAACAGATA CAAGGAGCGCAGTGAGATCGAGGCCCTGTACTTCACTATCAACACTCTGC TGAAGGCTTTGAATCAGCCACCGTATAATCCGCAGGACGGCCAGCTCGTG AATGACATCGAGAAAGCCTGGCAGATCCTGGAGTATGCCGAACATCATCG CGAGGTGGCTTTGCGTGACGAACTCCTTCGCCAGGAGAAACTGGAGCAGC TGAACTACAAGTTCGAGAAGAAGTCGGTTCTGCGTGAGGGTTATCTCAAG GAGATGATCCAAGTGCTGTCCGATCCACGATACCTGCGCCAAGTGGATGC CACGCTGAAGAAGCATGAAGCTATCTCTGCAGATATCCTGGCGCGTGTGG AACGATTCAATGACTTGACCGCCATGGCCGAGGAGTTGGACAGGGAAAAC TACCATGGCAAAGAACGAGTGCGTCGCCGAGAGCAGGAGGTAATGGCAAA GTGGCGCCAGTTGCTGGAACTGCTGGAAAACCAACGCCTCAACCTCTCCC AGATGAGCAACCTGATGAACCTGCTCCGCGAAATTGCCAGCACCACAGAA GCAGTGCGAGAACTGCAGCAACAGTTCGCCTCCGAGGATGTGGGTCCCCA TCTCTTGGGAGTGGAAGAACTACTGCAGGCGCATTCGCTGCAGGAACTCC AGGTTAACACCTATGGAGAGACTCTCAAGCGCTTCAATCGCCAAGCCTTG CCCTACAAGAGCTCCGAGCACAAGGACGCAGCTCTGCTGGCTCAACGCCT TGCGGATTTGGAAGAGGCGTACTCGGAACTGTTGCGACGCTCGGCGGCGA GAAGAGCCCGCCTGGAGGAGGCTCGAAACTTCCACCACTTCATGGAGGAT TACGACAACGAGGAGTCCTGGCTGGTCGACAAGCAGCGTATCTGCAAAAC TGGCATCACCGCCAAGGATCTGCGAGCAGTTCTTTCCCTACAGCAAAAAC ACAAGGCTTTGGAGGATGAAATCAAGTCACGAAAACCGAAATCAGGTCAG ATGTCGACGGCAGGCAAGAGGCTGATTGGCGAGCAGCACCCAAGGTCCTC GGAAATCCAGAGCAGGATTGATTCCCTGGCGGAACACTGGCAGGCCTTAG AGGCACTAGTGGAGCTGCGCCGTCGCCAGTTGGAAGATGCTGCAGAGGCC TACCAATTTTACACCGATGCCAATGAAGCCGAATCATGGCTGAACGAGAA GATAGCTTTGGTCAACTCCCGGGACTATGGTAACGATGAGCCTTCTGCTC AGGCCTTGCTTCAGCGTCACCGCGATCTCCAGGGTGAACTTAATGCCTAT TCCGGAGATATCCTTAATCTAAACCAGCAGGCGGATAAGCTAATCAAGGC GGGCATTTGCACCCTAGAACTTTCCGCCGCAGAGCCAGAACTGCCCGAAG TGGAACAGGAGGAGTGGGTGAACGAGACTCGCCTGGTGCCCAAGGAAGTT TGGGAGGACGAGTGGGTGGAGAAGCTGGAGCACAAGAAGGTGACGGAGAC AAAGATGTTGCCACATGTCAAATCTCTGTTTCCCTTCGAAGGACAGGGAA TGAAAATGGACAAGGGCGAGGTGATGCTATTGAAGTCCAAGACCAACGAC GACTGGTGGTGTGTGCGCAAGGATAATGGAGTGGAGGGATTCGTGCCCGC CAACTATGTTCGTGAGGTTGAGCCGCGCCCAGTGGCCTGTATTGTACCGA AAGCTGAAAAGGTCAAGTCCCTCCAGAAGGTCAAGAAAACCATACTGGTC CGACAGGTGGTACCCGTGAAGAGAATTAAACCTGTGAGCGTAGCTCCCAA GCCTCTGGTCCAGAGGAGAACCTCTACCCAAAGCATCAACGAGAACGCAG ATAGCGTGGAGAAACGGCAGCAGAGAATAAACCAGACATACGACGAGCTA CAGGAAATGGCCCAGAAACGACATGCCCTCCTGGAGGATTCCATTCACCT GTTTGGCTTTTATCGGGAGTGCGACGACTTTGAGAAGTGGATGAAGGAGA AGGAACGCATGATCAAGTCGGACGAGGGCGAGGGTGTGGACAATGCCAAG CGTAAGTTCGAGAAGTTCATCACAGATCTCTCGGCAGCATCGAAAAGGGT TGAGGAGATCGATGGCGCTGTGGACACCTTCCGCCGACAGGGTCACTCGC AGCTAGACAAGATCATCGCCCGCCAACGCCAGATCCACCAGATTTGGCAG CGTCTCAATAATGCCAAGGCCCAGCGTGAAAAGAGTTTAGAAGGAGCCTC TAGTGTGGAACTCTTTAACCGCACCTGCGACGAAGCCAAGGTTTGGATGA GCGAGAAGATGTTGCAGCTGGACACCGCTGTTATCACTCCCGATCTCCGC ACTGTTCAAGCCTTGCAAAGGCGCCATCAGAACCTGGAAAGGGAGTTGGC TCCCGTGGAGGACAAGGTTAATCGGGTGACCTACTTGGGCAACTCGGTAA AGAACGCCTATCCTGCTGAGAAAGACAATGTGAATGCCCGCCAACAGGAG GTGCAGGATATGTGGCAGCAGGTGCAACAGCGTGGTAGTGATCTTCGCAA CCGCATCGAAAGCGAGGTGGGTCAGCAGGTCTTTAACAACAGTGCCAAGG TCCTTCTAGCCTGGATAGACTCCGTCAAGGATCAACTGAATGCCGATGAG TCCGCTCGTGATGTGGAAACTGCAAACAACCTGCTGAAGAAGCACAACGA TCTGGGCGATGATATCCGTGCCCATGACACCGAATTCGTGGAGGTAATTC AATTGGGCAAACAGTTGTCCGATGGCAAACCCAACATGGCAGAGACGGTG GCTGTGATCGAACGCCTGAAGGCCGAACAAGATGCCATTCATCGCGGCTG GGCCGAGAAGCAGAAGTGGCTGCTGCAGTGTGTCGATCTGCAAATGTTCA ACCGTGAGGCAGATAAGATCGATGCCACCACCAAGAGCCACGAGGCCTTC CTCGAGTATAATAACCTGGGGGTAAGTAGTTTTAGGTTGTGGCTAATTTT TTCTGGAAACTCATACATTTTTCTTTTCAGGCCTCTTTGGATGAAGTGGA GGCCATTCTTAAGCGTCATCTGGACTTTGAGAAGAGCCTAATGGCTCAGG ACAAGATCCTTAAAGGCTTCTCAGATAATGCAGACAAGCTGATTTCTAAC GATCATTACGATTCCAAATAGTAAGTTGTAGAAACCTAAAAACATGGTCA AACCCTAACCAATCCATTAACTTTCAGTATCGGAGATCGCCGAAATCAGG TGCTGGGTAAGCGCAAGGCGGTTAAGGATCGGGCTTTTGAGCGTAAACGC CTTCTCCAAGCTTCAAAGGATTTCCACAAGTTTGCCGCCGAGGCTGATGA CCTCAAAGTGTGGCTCCAAGATAAGACGAGGATTGCAGGCGATGAGAACT ACCGCGACCTAAGCAATCTCCCTCGCAAGTTGCAGAAGCATCAGGCTTTT GAGCGGGAACTCCGCGCCAACGAGGGTCAGCTGAGGAATGTGACTAAGGA CGGACAGGCCCTGGTCCAAGCTGGAAATCGAGTACCTGAGGTGGAATCCC GGGTTGCCGATCTTAACAAGCGGTGGAAGGATCTACTCACCCTGTCCGAG GATAAGGGTCGCAAGTTGGAACAGGCCGCATCTCAGCGAGAGCATAACCG TTCCCTCGAGGATGCCAAGAAGAAGGTTGATGAACTGGACTCTGCTCTGC GAAGTGGAGATGTAGGCAACGATTTGCGCAGCTGCAAGGACCTGATCAAC AAGCAGCAAATCCTCGAGTCGGAAATCACCATCTGGGATCAGAAGGTAGC GGAACTGGTTTCAACTGGCGACGACATGGCACACGGGGGTCACTTCAATG CCCAGAATATCGAGGCCGGAACCAAGGAGCTGCAGCAGCGATTCAAGGAT CTGCGTGATCCTACCCAGCGTAGGAGAGCAAAGTTGGAAGAGAGCCTGAA TTACCACAAGTTTGTTTTCGAACTGGATTCGGAGTTCCAATGGATCAACG AACACCTGCCGGCAGCAAAGTCCAATGAATTGGGTCAGAATCTGCACCAA GCCCAATCCCTGCACAAAAAGCACAAGAAGTTGGAGGCGGAGATCAAGGG CCATCAGCCAATGATCAATAAGGCTCTGGTTGCGGGTCAATCTCTGATCT CGCAACAGCATCCGGAGCGAGAGCAAGTCGAGAGCCTGTGCCAGCAATTG GAGCAGGCATGGCAGGATCTGGAGCGCCATTGTGGCGAACGGTCCCGTAA ACTCGACATGTCCCTCAAGGCTCAGCAGTATCTGTTCGACGCTGGCGAGA TCGAGTCCTGGCTAGGTGAGCGTAACAACGTCTTGCGGTCCACGGAATAT GGCCGTGATCGCGATTCCGCGGCCAAGTTGCTCACCAAGCACAAGACCAT CGAGCTGGAGCTGGACACATACTCAGGAATTGTAACCGAAATGGGACACA GCTGCGCTGCAATGGTGGCAGCCAATCATCCGGACAGCAAGGTGCTGGCC GCCAAGCAGCAGCTCATTGAGAAGATGTTGAAATCCCTGCACAAACTGGC CTCCCAGCGACAGGGTCGCCTGATGGAGAGCCTCTACAAGCACGAATACT TCCTGGAATCCGACGAAGTAGAGCAATGGATCCGGGAGCAGGAGCAGGCC GCCTCCTCGGAGGACTACGGTCAGGACTTTGAGCACTTGCAGCTGTTACA GAACAAATTCGATGACCTTAAACACCGCGTGGAAGTCGGAGCAGATCGAG TGGATCAGTGTGAGCTGTTGGCCAAGAAGTTAATCGATTCAGAGAGCCCC TATGCCAATGAGGTTGAGAAGCGACAGGAACAACTCAGGTGAGTAGTGTT TAATTTTTACAATAGGGATTATAATAATATTTCTCTATCTCTTGCATATA GAACTTCCTGGGAGAACCTTCTCCAGCTCCTTAACCAGCGTGAGCAGAAG CTTCATGCCGCTGGCGAAATTCACCGCTTCCATCGGGACGTTGCAGAAGC CCTGTTCCGCATCCAAGACAAGAATGCTGCGCTATCCCAAGAACTAGGCA GAGATTTGAACTCCGCTCTAGCACTGCTACGCAAGCATGAGGGCTTTGAA AACGACCTTGTGGCTCTTGAGGCACAGCTACAAGTTCTAGTGGAGGATTC TGTCCGCTTGCAAGCCAAGTACCCATCTAATGCTTCTGCAATTGCCCAAC AGCAAGATAAGGTGGTGGCCGCCTGGAATGACCTTAAGGAGCGGTCCACC GCTCGCGGAGATCGACTGGCTGCCAGCTCAGACCTGCAGACCTTCCTTAC AGATGTCAGGGATATAGTTTCTTGGTCTTCAAACCTGCGAGCTGCCCTTC AAGCAGAAGAACATGTGAGCGATGCAGCTGGAGCAACAGCCCTGAAGATT CAACACGATGCCATATATGGAGAGATTGAGGCCAGAGAGGATAAGTTCCG GTACCTTAACGAATTGAGCGACTCCATGGTTCAAACAGGCCACTATGCCG CCGCTGATGTAGAGGAGAAGTGTGCCGCCATGTTGGATGAGCGCCAGAAA CTCCATGCTGCTTGGAACAAAAAGAAGATAATGCTGGAGCAAAAGATCGA TCTCTTCTGCTTCCTGCGCGATGCCAAGCAGATTGACAACCTTTCTAGCT CCCAACAGGCGGCTCTGAGTAGCTCAGACTTCGGCCAGACAGTAGAGGAT GTGCAGAACAAGATCCGGAAGCACGACGAGTTTGAGAGATTGATTCAAAC ACAGGAGGAGAAGGTGTCTCTACTTCAGGAGCACGGTCGCAAGCTAATCG AACAGCGTCACTACGACAGCGCCAATATACAAACGATCCTTCAGGGAGTC CTAGCCCGCCGCCAAAAGGTCAAGGATCTGTGTGCCGTGCGTCGCTACAA ACTGGAAGATGCTCTACTCTATGCCAAATTCGTACGAGATTGCGCCGAAG CTAAGTACTGGATCAATGAGAAGCAAAAGAAACTCGAAGCCGATGCCGCC AGCTATGCGGAGGTGACCAATCTGGACGAGAAAATCAAGAAGCTACAGAA GCACCAGGCCTTCCAGGCCGAGGTGGCTGCCAACCAGGGTCGCATCCAAG AAATTCAAGATACAGGAGTGATTCTTTTGAGCAAACAGCACGAGTCCTCA CCGGAAATCAAGAGAGCCATCGAAATAGTCCTTGAAGCCTGGCAGGGATT GCTGGCGGAGCTGGAGCAGCGTGGTCGAGGTCTGGAAGAGGCCCAGGACA GCCTTGAGTTTAACAGCCAGCTGGACAAGATCGAGGCTTGGATCCGCGAC AAGGAGATGATGGTGCAGGCCAGTGACACTGGACGGGACTTGGAACATTG CAATGCCCTGATGAGGAAACTAGACGACGTTGACTCAGATATGAGGGTAG ACGATCAGCGCGTCAAGCACATCAATCAGCTGGCCGACAAACTGATCAAC CAGGCCCAAGTGCCAGCGGATACACAAAGTGTGGATAAGAGGCGAAAGGA CTTTAACTACAACTGGCGACAGCTGCAAGGAGCACTCAATGCTTATCGCG CTTTGCTGGGCGGAGCCAACGAGATTCATGTGTTCAATCGCGATGTGGAT GACACGGCAGACAGAATAGCTGAGAAGTCCCTGGCTATGAGTTCCACCGA TACAGGCCGAGATCTGGCTGCCGTAGAAGCTCTGATCCGCAGGGAAGAGG CTCTTGAAAGAGACATGTCTGCCGTTAAGCAAAAGATTGATCAGCACGAA ACCGCTGCCGAGTTCCTGATTAAAAAGTATCCTGAACGTGGAGCACAACA TATCGAGAGGAAATTGGAGGAGCTGCACAAATCATGGGGAAATCTGCAGG CCTTGTCCGTTAAGAGGCAGAGTATCCTAAACGAAGCCTACCTGGCTCAC AAGTTCGTGTCGGACGTTAAAGAACTGGAACTCTGGGTTAACGACATGAT CAAAAAGATGAACAACACACAGTCACCATCCACTATCAACGATTGCGAGA CCCAGTTGGAGCTGCACCAGGAACGCAAAGTAGAAATCGAGGGCAGGCAG GAGGCCTTCGCTGGACTGAAACAACAGGGCGAGCAGTTATCCAAGAGACC CCAGCAACAGCAGCCGGATAATGTGCGCAAGTATCTCCTTGTGCTGGAAG AACTCCATCAAACTTTAAATGAAGCCTGGAGCGAAAGGGCTAGGGATCTA ACTGAGGCCCATCAGCTGCAGTTGTTCAAGGCTCAAGTGGAGCAGGTTGA GATATGGCTCGCCAACAAGGAGGCCTTCCTTAACAACGACGATTTGGGTG ATTCCTACACGGCTGTTGAAAGGCTGCTTAAGAAGCACGATGAATTTGAG AAGCTGCTCCATGCTGATCACGTGGACACCTTGCAAAAGTTTGCCAATAG CATTCTAGAGGGTGAGCCCAAGGATGCAGATCTGATCCGGGAAAAACTGG CATACATCCTCAGAAGGAAGCAGAAACTGCTTGAGCTGTCTGAGGAGAGA AAGCAAAGGCTGACACAGTCTCACCAATTGCAGGAGTTCCTGCGCAGTCT CTACGAGATTGATCGTTGGCTGGTGCAAAAACTGCAGGTCGCCCTGGATG AAAACTACCGGGAACCGAGTAATCTGCAAAGTAAGATCCAGAAACACGCT GCCTTCGATGCCGAGTTGTTAAGCAACTCCCCTCGCGTCCAGTCGGTAAT CCACGAAGGTGAACGCCTGATCCGAGGCGATCACTTTGCTAAGGATGAGA TTGCACAACAGGTGCAACTGCTCGAGGGAGATTGGCTAAAGCTGAAGGGC GCTTCCCAGACCAAAAAGGATAAGCTCCAGCAGGCCTACGATGCGTTGGC CTTCAATCGAAGTGTGGATGAGTTCAACAACTGGATGGACGAGGTAGAGC TGCAGTTGAGTAGCGAAGATTACGGCAAGGATTTGGCTGCTGTCAGCAAT TTACTTAAGAAACACGAACGCTTGGAAGCGGATGTGGCCCATCATGGTGA ACTGGCTGACCAGCTGAAGCAGAAGGATGAACAGTTCTTCCAAGCGGAAC ACTTCCTGCGTCATGAAATCCACGAAAGAGCCACCGTTAGTATCCGTAGG TACAACACTTTGCACGAGCCCTTGGGCATTCGTAGGGAAAACCTGGAGGA CTCATTGAGTCTGCAGCAGTTCTTGAGGGACGCCGAGGATGAACTTCAAT GGTTAGCGGAGAAGCAATTGGTGGCTGGTTCCCAGGATCTAGGCACCAGT CTTTTGTCCGTTCAAGGGCTACAAAAGAAGCACAACTCTCTGGAGGCTGA ACTAACATCGCAGGAACCTTTGATTCAGGCGCTCCTCCAAAGAGGCCAGC AGATGATCCGGGACAATCACTTCGCCAGCGAGCAGTTGCAATACAAATCG GAGTTGCTGCAGAAACAGCTTGTCCAGTTGAGAGACTTAGCTGCCATTAG ACGTCTGCGTCTTTTGGACGCCGTAGAGAGCCAGCTGTTCTACGTTGAGG CCAATGAGGCGGATGCTTGGATGCGGGAGAAGCGTCCGGTTTTGTCGAGC AGTGATTACGGCCGGGATGAGGTCTCAGTTCAGGGACACCAAAAGAAGTT GGAAGTCCTTCAAAGGGAACTTACCGCCTTTAAGCCGTCGATAGAAAAGG TTGCCAAACTGGCCACTGGTTTGATTGAAAGAAACCACTTTGACAGCTCC AACATAGCGGAAAAGAATGCCCAGGTGGGTCAGGAGTATGAGGATCTACT CCGTTTGGCTAAGGAGCGGGAGTCGAGACTTGGTGAGTGCAAGAAGCTCT TTGAGTACCTGCGGGAAACGGAGGAATTGCACGAGTGGGTGGGCGACCAG ATGGCCGTCACCGCTAGCGAGGATTACGGTGAGGACGTAGAGCATGTGGA ACAGCTCATTCTGGCTTTTGAATCCTTCGTTTCCAACTTAAATGCCAACG AGGCAAGGGTTGAGGCGTGCTTGGAGCGGGGCGATCGCCTCATCCAGGAG AACAATCCCTATAGGAGTTCCATTAAATCGAAGCGCGATGAGACAAAGCA GTTATGGGAGGAGCTCAAGGATCTGGTTCACGCTCGCCAAGATGCCTTAG CTGGAGCCAAACAAGTCCACGTCTACGATCGCGTAGCGGACGAAACCATT CAGCTAATTAACGAAAAGGACGCCTCGCTCATCTCTGAGGACTACGGTCA GGACTTGGAAAGCATTCAGGCCTTGGGTAGAAAGCACCAAGTCTTTGAGT CCGAGCTGGTGGGCATCCAAGGACAGGTTGATTCGGTTTTGGCCGAGGCC GCTAAACTGGGCGAGATCTACCCAGATGCCAAGGAGCACATTGAAGTCAA ACGTGATGAGACAGTGGAGGCATGGACGGATCTGAAGGAGAAAACCGCCG CCAGGAAGAACAAACTCAGCCAGGCAGAGCAGCTGCAGTCCTACTTTGAC GAGTACCGAGATCTGATTGCCTGGATCAACGAGATGCTGGCCAAGATCAC TGCCCCTGAACTTGCCAACAGTGTAGCGGGAGCAGAGCTTCTCCTGGCCA GCACCAAGGATCATGACACGGAGATTCGCACCAGAGACGAAACCTTTGCC AAGTTCGCCGCCAATGGTCAGCAGTTGATCAAGGAAAAGCACTTCCTTGC CCACGAAGTGGAGGACAAGATCAAGGTTCTGCAAGCGCGTCACGAACTTC TAAAGCATACTCTCAACAAGCGGCGTGAGATTTACGAACTCAACCTGGAC ACCCAATTGTTCTTGAAGGACGCCGAAATCCTAGAGCAATGGATCAGCAG TCGCGAGCCCCAACTCAAGGATACCAAACTGGGAGATTCCATTCCACAGG TGGAGGATCTGCTTCGCCGGCACGAGGACTTTGAGAAGACTGTGGCCGCC CAGGAGGAGAAATTCCAGGCCATTAAGAGAATAACCATGCTTGAGCAGCT ATTCCGTCACCAGCTGGAGCAGGAGAAAATCAGCAAGTTGCAGGAGAAGG AGCGTTTGGAGAAGGAACGCCTGGAGCAGCTTAAGCAACGAGAGCTCCAG CGCCTGGCGGATGAGAGGAGACGAGCGGAGAAGCAGCACGAGCACCGCCA GAATGCGGCGTCCCAAGAGAAGACCCCAATCTTCTCTTCGCCGATGGTCA CTCCAGCTCAGACAAGTGGTCCACAGTCCCCGGCCTTGAGTCAAGTCCAG TTGAGGCCTCCATTTGGAGATGATAACGAGCACCTGGCTCTACAGAAGAG CAGCTCCAGCGGCATGTTCGGTGACCGACTCCGTCGCGGATCTGCGGATG CCAATGTGAAGCGGGCGGAGAGCATGAAGGTACAGCCCAAGCAGGCCAAG CGTACACCATCGTTCACCACCAGAAGACGTGCTCAGTCCTTCAGGAAGAA CCAGAAGGGTGAAGGATTCGACCTGCCACCCGTTGAGATTCAGGGCAGTC TGGAGCGTAAGCATGGTTTGCAATCTGGCGGCAAGAAGGCTCCTGTACGA TCCTGGAAGCAGTTCCACACTGTCCTCTGTGGCCAGTTGGTGTGCTTCTT TAAGGACGAAAATGATTTCCTGCAACAGAAGACGGCCACTGCACCTGTTA ATATCCTCGGTGCCAAATGCGAACGTGCTGATGATTACACGAAGAAGAAG TACGTGTTCAGGCTAAAACTACCCGACGGATCGGAGTTCCTGTTCGAGGC TCCCTCGCTGGACATTCTAAATGACTGGGTGCGCAAGATATCCTTCCACG CCAGTCTGCCGCCGAACATGCAACTGCTTAGCTACGACGAGTCCATGAAG GTAAGATTGTATATCCATACGAGAAATAAGAATTAATCATATTTGTAATG TCCTAACAGCAACAGTCGAGCAGTTCGCCGGACATCAAGGTTACTAGCAG TGTGGAATCACCAGTTAGTTCTCGTAACTCATCTCCCGACTCCCAGCGAC GTACTAGCGGAGCCCAGGTCCTTGACGGAACAGCCACTCCCCAAATGGCA TTCCTTCAACGACAAATGCAACAACAACAACAGCAGCAACAATCCCAGCC CAGTTCACCCACCGGCGGATTCGACCAGAAGCCACCGATCCCGCCCAGAG GAGCTGCCCCAGTGGCCAGCCATCGCCAAAGCCAGGAGAATCTAGTTGTG ATGCGCAATCGCCAAAGTTCCAATGGTAGGAGATCTTTAGGCTAATAGCT AATTGGATTTATTATTAATTTTTAAACATGTTATTCGACATGTTACAGAC CTGCAACAATCCGCCACTTTACCCGCTGGCTTGACTGGAGTCCAGCAAAA TGGGAACGGCAAGGATGATAACGCGTTGTTGACGCGCAACAGCGAGGCCA GACAATCGGGTAAGTTCTCCAAACTAGGTGGTATTCCCATTTCCGAGCTA TTTGTGTCTTTGTCCATACACCTGCTCCTCCACATTGTTTCACACTCACA TTGTAAAATTGTCCTCCAACAACGCAATGCCGTATGTATTAGATAATCCG CCGCCATTGCCAACAACGATGCCACCGGTGGGTGGCCAGCATCAGCATCC CCAGAACTCCCATTCCCATCAGAATCAGCATCAGGCGCAGGTTCAGCAAA GGATTAATGCATTCAATGCGGCGGCGAGTCAGCAGCATCAGCCGGATTAC TTTAACAACAATACAGCGAGGCAGCAGCCGCAGAGGATTCCCTCCGGCAG GATCGACTCTACGAGGAAGTTTATCGAAATGGAGGCGCATAACAATAACG GCGGCACTAGCAGCAGTCCCAAGAGAAGTACCATCAACTATTCCAGCAGC GGGGCCAGCAGCAATGGCAACGGTAATGTGAAGATAGGCAGTGGAAATTC GTCTACGACCACGATCACCACCTCCACCACCACACACCAAGTGACCTCGA GCAGTCGCACGGTGTGGCATCTAACCTCATCGCCCACCTCATCGACCAAA TCATCATCAACCGGCGGCTCCGGGGAGCCTAGCCATGCCATCAGTAATCC AAGCTACATGGGTCTGCATCTGAATAACAATAACGATTCAATTGGAATTG GACTCGGTGGTTAGACGATCCTCATTAATCCTAACAATCTGTATATAAGT AGTCTTAAGTGCATGGTCCTTGGTTACGGTTGATTTGAACTCTTTGGACA TAAACGTTAATTTTTCTCTCTATCTTGAATGCATGCATATGTGTGGAAAA GGTTCTTCAGCTTTCAAACCAGTGAAGATAACCCGCCGATCCTATCTGCG AACGAGTTTGCAAAGTATTTCCATGGGTCTTATATTCTTTACATATTTAA CCTATCCCTACACGACTATATAAACGATCGTTTTATCCAATTGAAAAAAG GCGAAACCAGCTGTAGTTAGAACCATTGAAATATGAATGACTATGTACAC TTTAGAGCTCTTCCTCACATATATTTTAAATTTAAGCTAATTAATGATAT TCTGTTGCCTCTACACCTATAATAATATTATGCTATACATCGAACACTCT CATTTGCATGATGTCTTTGTACTTTCAAGATTTCCAACCACTCATAATTG ATATTTTGTACAGGTTGGGGAAATACACGCTTTGAGAGCAACCGGCCCGT ATCCCTGCAGCCCGACTCCATCAGCTTCTCCCGTGTTTCAGCGGAGAGTT CCAGCGAAAGCGAGGCCCAGTCGATATCATCCGTGTCCGGAGTGAAGGGC AGCAAGGGAACCAAGGAGGAGCGCCGCAGCGGCATGTTCCGAATCTTCGG CCGCAAGGGCGACAAGGAGAAGGAAAAGGACAAGGACAAGCGCCGCTCGA GTCAAGTCCCGCCACAGTGAGAACATATATAAATTCCGGATAATGAGAAG GAGCGCCACCGTTACAACAGATGAACCAGGCCGAATTGTTTTTTGTATTT TTTATAAACACCATGATTATGTCATTTGTATTCGCCAAGGGCAATCAAAT TTAAAAACAAAACCAACTACTAAACGAGACAAGATATGAAAAAGTTGAAA CATTAACGTGTCGATTTAAAGCTAAAGCGGCAAATGAAAGTATAAAAGAA ATATTATATATATATAAAGTCAATGTGTTAATTGCATTATAAAATGTATC TGTAAGTTTGTTCGTTGTATGATTAAATTTAATATTCGTAAAACAAAATA CTTAAACAATAAATACCATACATTGTGAAATCAAACTCAGCTTAATGTTA ATTCTAACCTTGTGGGAGATTTAGGACAATTCTGCAAGTAAGCTTATACG ATGGGATGGTAATACAAGTTGGTTATATATTATATTATATTATACACTTT CTACCTAAGGCAATCTTAGCAACAACGATAGATAATATTATAGGAACATA TGATGATATAGAAAAGAAAATAAGAAAATCAGCTTAGTATTTTTATTTAA CAAAAACACTAAAATAAAAACTTCAAAAATTATGTAGCTGATTTTTGTTA TAATCGCACGAAGCCCAAAAGAATGCTGCAAAAATGAACAAGGGAAAATG TAGCTATTAAAAGCGCAGCATGTAGAAATCTTGTATTTATACAGTTGCTT TAAATAATCATCAATGCTTATCTAATATTTTGCAAAAGTAAATTTTATAT TGTTCATAGAAATTCAACAATATAAAAGTAAACAAAAACGCTATTAGGCC GGATGTTTATATTTTCACGACGAACTTCAATAACATAATATTTGATCTTC ATTGAGTAACGCATTAATCAAATTTTTTACTTTTTCGGTCGTTTCGAATT TTGTTTACCGTTTTATCAGTCTATTATTATGATGGGCTAGATGTTGTTTA TTAGATGTTTATTTAAGAACATTATCAATACAAAAACATCAATGAAAGTG ATAATACGAATTGACCATGTAGCAATTTGTTTTGTGTCTATAGACTGAAT TTTTTCCCCTACATTAATCAAAATTATATTTTTATATTTTATTTTGAGTT TACTTGGGTTTTTCATGAAATTAAAGATTAACCTGGGGTTTTTACAATCC ATTACGATAGGCTTTCTGTTCATTGCATCTATAGCCTCTGTACTTTTCCG TGCATTCTTAAAGCAAAAGCATACATGTATATCTTCAATTCAAGTATATC TGCAATTTAGTTTGCTTATCTGGAGTCGCTGTATCCCGACCTATCCAAAC TCGCGTCCCAGTCAAAGGTAAACCATTTTTATTTAGTTCCCAGCCTCTGG TATTTGTTGTTATTTATCGGTGACTTTTTGAAATTTATTCAATTAATTTC AGTCTTTGTGCTCTTGATAACACGATTTCCTCGTTATTCATTTAGTTTGG GTTTAACCAAAACCCTTTAGCGAATCATTTTTGCTGGACAGTCCAGTTGA ATTCGGTATTCTACACACAAAGCTCATCTTACAGTGAAAAGTGTTACTTT ATGAAATACAA