##gff-version 3 ##date Wed Jul 24 04:31:12 CEST 2024 ## exported from the transgeneomics system molecule_59050488 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59050488 mpicbg region 9631 24906 . + . Name=dmel-5.43-2R;type=genome;start=11198193;end=11213468;strand=+ molecule_59050488 mpicbg region 24907 24979 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59050488 mpicbg region 24980 25968 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59050488 mpicbg region 25969 53011 . + . Name=dmel-5.43-2R;type=genome;start=11213469;end=11240511;strand=+ molecule_59050488 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59050488 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59050488 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59050488 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59050488 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59050488 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59050488 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59050488 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59050488 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59050488 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59050488 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59050488 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59050488 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59050488 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59050488 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59050488 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59050488 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59050488 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59050488 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59050488 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59050488 coding_transcript gene 10429 16785 . + . id=50719298;alias=CG8153;ensembl=FBgn0004698;alias=mus201[G1];alias=Xpcc;alias=DmXPC;alias=Xeroderma pigmentosum group C-like;identifier=FBgn0004698;alias=mutagen-sensitive 210;alias=mus212;alias=mus(2)201[GI];alias=mus(2)201G1;alias=xeroderma pigmentosum group C complementing factor;Name=mus210;alias=DhXPC;alias=mus(2)201;alias=DhR4;alias=XPC[DM] molecule_59050488 coding_transcript gene 16787 21112 . - . id=50994261;ensembl=FBgn0034009;Name=CG8155;identifier=FBgn0034009 molecule_59050488 coding_transcript gene 21417 23837 . + . alias=ARF3;identifier=FBgn0013750;alias=CG8156;alias=ARF6;alias=AFR51F;alias=ADP ribosylation factor III;id=51142329;alias=Arf51f;Name=Arf51F;alias=dARFIII;alias=EP(2)2612;alias=Dm Arf51F;alias=ARFIII;alias=dArf6;alias=Arf6;alias=LD12493;alias=arf6;ensembl=FBgn0013750;alias=ADP ribosylation factor 51F molecule_59050488 coding_transcript gene 24776 26388 . - . alias=BcDNA:RE07473;id=50881043;ensembl=FBgn0034010;identifier=FBgn0034010;Name=CG8157 molecule_59050488 coding_transcript mrna 24776 26388 . - . Name=FBtr0087390;parent=50881043;id=50881049 molecule_59050488 coding_transcript exon 24776 26295 . - . parent=50881049 molecule_59050488 coding_transcript three_prime_utr 24776 24903 . - . parent=50881049 molecule_59050488 coding_transcript cds 24904 26295 . - . parent=50881049 molecule_59050488 CLC misc_recomb 24980 25013 . - . Name=FRT molecule_59050488 CLC cds 25021 25092 . - . Name=BLRP molecule_59050488 CLC cds 25093 25113 . - . Name=TEV molecule_59050488 CLC cds 25114 25137 . - . Name=Precision cut site molecule_59050488 CLC cds 25138 25179 . - . Name=V5 molecule_59050488 CLC cds 25186 25902 . - . Name=SGFP molecule_59050488 CLC cds 25909 25968 . - . Name=2xTY1 molecule_59050488 coding_transcript intron 26296 26355 . - . parent=50881049 molecule_59050488 coding_transcript exon 26356 26388 . - . parent=50881049 molecule_59050488 coding_transcript cds 26356 26367 . - . parent=50881049 molecule_59050488 coding_transcript five_prime_utr 26368 26388 . - . parent=50881049 molecule_59050488 coding_transcript gene 27138 28270 . - . id=50881067;identifier=FBgn0034011;ensembl=FBgn0034011;Name=CG8160 molecule_59050488 coding_transcript gene 31606 39325 . + . alias=Drosophila hormone receptor 51;alias=DHR51;alias=unf;alias=Hormone receptor 51;alias=unfulfilled;ensembl=FBgn0034012;id=50880876;Name=Hr51;alias=CG16801;alias=fdx;alias=PNR;alias=NR2E3;alias=failure to deploy or expand;alias=CG16801/NR2E3;alias=HR51;identifier=FBgn0034012;alias=CG16801 ##FASTA >molecule_59050488 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACATCCCGAGAATTTAAATCCT CTTCTGAGGCCTTCATTTGAGACAGCTCCTCTACTTTGTTGCTAGTGGCC AAACGGAAAAATTTGCTTTTGTCGAAGGGGACTAGGATCCTTTCTGGCTC TCTTCTTGTTTGTGCAGTTTTGTGGGTACTTGGAAGGTTAGGTTGGCAGG TTGTGGGCGCATCCAACACCTCCTTGTAGAACTCACGAGCTTCTGCTCCG TTTAAGCCATCGATTTGGTGCTTTACTGCTTTCGGGGACTCGGCGATAAA ATCCGGATCTCCTGCTCGGACGAATCGCTTCAGTTGGAGTGGCAATGTTG TTAGAGCCAGCCAATTTGGATGCAATTCGTTTTGAGAATTCATTTTTGAC AATAATGATGCTAACTCGTTTTGTAAATAAACATTTCGCAGATGTGCGTC AGAGCTGCGTAGTGCTCAAAAATATCGTTTGGAGATAAGTCGATAGCCAA ACTAATCGAATATAGAGATGGTGATTTTAGGAGATAAAAAATGAATGACA CTGTTGAAATTATTTAGTCAACACTGTCGGTCAAAAATCTATTAATACCG CTCTATGTGAAGTTTCTTAAGCTTCTTTTGCGTTCTTGAAAAAATAAATA ATATAAAATACAAAAATAATATTAATTAAGTAATTATATTAAGTAATAAA AATAAAATTAAAGAAATCCCAGAGTCACTCAAAAATGAAATGAAAAATAA AAATTTTTATAAGGCTAGTAAACATTATTTTATTAACACTATCTTCGTTT AGGTGATAAATTGTCCCGATAAGCCGAAAGTATCGATACCATCGTGGGTG GGCGCGCATCTCTACTGTTCTCGGCCTCTGCTTTTTGTCTGTTTTCTACC AAGCGCGAAAATGTGAATTTCGCAATTCATTTAAACTGTCCAAAACCGAG ATCAGGCAGGATTAAACTTGCCCCCCAACATCCATAATCAAATATCAAAT CAGGAGAACGAACTTAGGATATTCTTGTGTAACGCGTGCCCTGAATAACT GCGCAGTAAAAATCAATAACTAAGTAGCACGCATCGATACATAAATGTAA AACGCCCCAGATAAAAAGGAAGATGTCCGACGAGGAGGAGGATTCCGTGT CCGAGGGCTTCTCGGCCAGCGAGGATGAATGGAAGCCGAGCAAGGACGTC AAGGGAGGCGAGTCCTCCGACGATGATGACAGCGATTTCGATGAGCTCCA GGCGGAGGGAGGAGCAGCGGGCTCCAGTGGACGATCCTCCGCTGTAGCGG GAAAAAGAGGGTGAGAACGGGATAAGGGTCCATTGCTCTGGTACATTTTG AAATTTTCATTCCCCCTCTTCCCAGCAGCGATCACAAGGCACCAAGTGGC ATCAAGGGCTCTTCGGTGAAGAAACGCAAGCCCACTGGTCAATCACTTCG CTCCAAGCTGTACAATAAGTACCGACCGCCTCCAAAGACCTTTCCCACTT CTCCTTCGCAACAGAAGGAGAACACTCCGCGGGCTTCGGGTTCAAAAAAC GCCAAAACGCCCAATGAAAGCGGTGCACGGAATCAGCACGGTCCTGCTGA TTCCAGCAGCGAATCCAGTGTGGAAGACTACCTAGTAAATCCAGCCGATC TTGATCTGCACTCAACCTTCTTTGCCGGCGGCCAAAAAGAGAAGTCACCG GCGCCCCAATTCGATTGTAATGCGGGCATCACAAATCTTTCAGACTCTGG ATCGGAGGATAACAACGAGAGCAGCTTCGAGGATAAAGCAGGCAATGCCT TCGACTTTCGCGGTCTCCTGGAGAACGCAAACAGTTTGGAGCGCACTAGG GATGCTTTAAGCAAACGAAATGTCACGGCCACTCCGCCAAGGAGCCAGGC TGCCACCATGGATGTCAATGCGCTGCTTGCATTGGGCGAGAACCAAAACT ACCAGAGTGTGGAGGTGGAGGAACGTGAAGGGAATCAGCGTAAGAAGGCG GGAAGAGGAGCACCAGCAGCGCCTCCGACCCTTGATGAACCGTCACGCCT CAGCAAGACGAAGTCAACGCGAATAAAGCGACACACCAAGACGCGACCCG TCTCCACGGTGGTCGCCAACGCTGGTGATACTGATGACTCCGATTTTGAG GAAGTGGCAGGTAGGCGAAAATGCAAGTAGTTTGACAGCCAGGCTCCCGG AAGAGTTGGCGTTGGCAGAAGGCAGTCGAGCATGCTTATCCAAGTTGGTT GTGGCGCTGGCATTTCTGGTATCTGATGAATAAAAATAAGCTTCCAAATT GCTCTGTATGAGACTGTGTAGTTTTGTTTGTACTAAGTTTATTTGTCGAT GTGAACAGATAGAAATTACTAACTTACCTGTGCAGCTGCGGTCCAAATAA GAGCATGGTTTTATATAGTGTTGTATACAAATTCTTTAACGAGTTTAAAC GTGTTATTTTATATAATAATTTATATTGCATTTTCCGTTAAGACTTATCA TATTCGAATGTATTGTCCTAGTTTGACACTAACAATTTCCCCATTTATAC AAATCGTAGAAGTTACAAGGAAATGCTTTTATTTTTACCGCAACTGTATG CTAGAATGTACATTTGGAACAGCCGCGTCAAAATAATGGCCATGAATCTA CAATATACCTATTTACTGTAACATATTGTTAGTCGATTAGACTGAGAAAC TAGCGTATGAGATGCTGCAGACGCTTATCTAGAATCTTGGCTTACTAACC TATTTATACCCCCTAACCATGTCATGAGTCCGTTGTACTTGGCATACGTT TCAATGCAACATTTGTATGTTTAGCCCGAATTTGGGAGATGCCAAGCCAA AATCAAGATTCCTGCGGCATTTGCTACTTAGTTGTCCGCTAAAAAAATAA TTAAAGTCTATACAATGATCGATAGGAAAATCTACCACAAAAGCTTATTA AAATCTTTTTTAATGTCAAAAAAATTAAATCAAATGAACATTTTTAAACG TTTTTGCACTAGCTTAAGCCCAATCTGCGTGTTAAACGGATGAAAAAAAC AAAAGCATAAACTCAATGTCTACCGAATTCTGAACGTGGTTTAAATGTCT GCACACACACTCTTGATAATAATATGTTAAACAATGATATATTTTACTCA GAAAATGCATTTACTTTTATTTATTATGTCAGTTTTTATATTTTGTTTGC CACGCAACGAAACACGTTGAAGTCAAAAAGAATCTAGTTAACCAAATCAA AATGAGATACAAAAGGATTTTAATCGCAGCCCAGTAATAGAAATAATAAT TTGTAAAAGCTAGTGAAATGTCCTAGTCAACTATTTGTGTACTTACTTTA TGGCAATGGCAAGTGTTTCAATGAAATCAACAAGTAGCTAACGAATTAGA ACTGATGTTTAACGAATTTACTTTAGCAAAATTGTATTCACTTAATATAA ACATCTGCATGCAGAGTTCTAATCTAATTTATTAATGATATACTCCAACA ATGGATGCAATAAATCAAATGAAACTCGTAATTTTAGCGCAATTTAGTGA ATGTTGATTGTAATTAACTCAATAATTGAAATTTCAAATGCACTTTAAAA GATATAAATAAATAAATGCAAATGTTGAAAGGAATCCATGCTCTCTGTCT GGGTATTTTTTGCCTGCCTTCCCTGCTCAATCCTCCCACATAATCATTGG TGCCGAACTTGCTACTAGTAACATTTTTATTACCCGGTTTATTTTAATTC ATTTACAAATGTATTTAAATTCAAAATCATGGATATGATCATATCCATGG TTCATATTGGGAATCTCAATTTTCTTTATATCGATTGAAATGTTCGAGTA TTAGATATTTTACCCCTCTTTCTCCTCCATTTAAACAAACTCTGTCTATC TCACAGTTCATCATTCAGTCCAGTGTCACATCATCACCCCGAATTGAATC CCTTTTGCAGATGCAGATCTATCCAGTGACCAGGACGATGGCGAGACGCC GAACATCTCAGGGGATTTGGAGATACGCGTGGGACTGGAAGGGCTCCGTC CTACGAAGGAGCAAAAGACTCAACACGAATTGGAGATGGCCCTAAAGCGT CGCCTTAACAGGGACATCAAGGACCGTCAGATTTTGCTGCACAAAGTCAG CCTAATGTGCCAAATAGCTCGCAGCTTAAAGTACAATCGCCTGCTTAGCG AGTCAGATTCCCTGATGCAGGCTACCCTGAAACTCCTGCCAAGCCGAAAC GCATATCCTACTGAACGAGGCACCGAACTTAAATATCTGCAGTCGTTTGT CACGTGGTTCAAAACATCAATCAAGCTGCTAAGTCCCAACTTATATTCCG CGCAGTCGCCTGCTACCAAGGAAGCCATATTAGAGGCTTTACTGGAGCAG GTGAAGCGCAAGGAAGCCCGCTGCAAGCAGGATATGATTTTCATATTCAT TGCCCTTGCACGGGGAATGGGCATGCACTGTCGGCTAATTGTCAATCTCC AGCCAATGCCACTGCGTCCGGCGGCCAGTGATTTGATTCCCATTAAGCTT AGGCCAGATGATAAAAACAAAAGCCAAACAGTGGAATCCGAAAGGGAAAG CGAGGATGAGAAGCCTAAAAAAGATAAAAAGGCAGGGAAGCCAGCAGAAA AAGAAAGCAGTAAGTCAACTATTTCCAAAGAGGCTGAAAAGAAAAACAAT GCAAAAAAAGCTGAGGCTAAACCACTCAGTAAATCAACAACCAAGGGTTC AGAAACCACGAAATCAGGTACAGTTCCGAAGGTTAAAAAGGAGCTAAGTC TCTCCTCGAAATTGGTTGAAAAATCAAAACATCAAAAAGCCTACACCTCC AGCAAATCGGACACTTCCTTTGATGAGAAACCAAGTACGTCGTCCAGCTC TAAATGTCTAAAAGAAGAATATTCAGAACTGGGATTATCCAAAAAGTTAT TAAAACCGACTCTATCCTCAAAATTGGTTTTAAAATCAAAAAATCAATCT TCATTTAGTTCCAATAAATCGGACACTTCATTTGAGGAGAATCCCAGTAC CTCATCAAGTTCCAAATCTTTAAAAGAAGAGACAGCCAAGTTAAGTTCAT CCAAACTCGAAGACAAAAAGGTCGCAAGCCCTGCCGAAACTAAAACTAAA GTACAATCGTCCCTTCTAAAAAGGGTCACCACTCAAAATATTTCTGAATC AGGCGATAGCAAGAAACCGAAAGTGGCTCCTGTGGACACATTCTCTCCAG TGGCAGGTCGCACACGCAGAGCCACTGTGAAACCCAAAACAGAGGAAAAA CCGCAGGTGGTTGGATCACCAGTTATACCTAAACTGATGCTGTCCAAAGT TAAGCAGCTAAATGCCAAGCATAGTGATACGGAAAACGCTAGTCCTGCGA ATAAACATCTGCAGGAACAGCGCAACACACGAGAAACTCGATCAAGGAGC AAGTCCCCGAAAGTACTTATATCCCCTAGTTTCCTTAAAAAGAAATCCGA CGGAGCCGATTCCACTTCAGACCCTCAAAAGCATCAAATGGCGCCGGAAA CTAAGGCGCGAATTTCGCCAAACTTTCTGTCCGAAGCTTTGCCAGCTCGT CAGCTACGAAGCCGAGGTCAAAAAGCCAGTAGTCTAGCCATTCCGCAATT AGACGGCGGTGACGATGTGCCGCTACCGAAAAAGCGCCCAAAACTGGAGA AGTTGAAAAATTCGCAAGATTCCGATGAGGTGTTTGAACCCGCCAAGCCG GTGAAAAAGGCTCCTGTACTGCCCAAGTCAGTACAGAATCTGCGAAAAGA TCGGCGAGTGATGTCAACAGATGATGAGGGCGGTTCCAGGCTCAATCGGA AAACGGACGCCTCTGACATGTGGGTGGAAGTGTGGTCAGATGTGGAGGAG CAGTGGATCTGTATAGATCTGTTCAAAGGCAAGCTACACTGCGTGGACAC AATAAGGGTGCGTATTTATCAAGCCAAATGTCGTGCCCTCCATCCAGTAA TTGTATTTTTGTTTCTGCGCAGAAAAATGCAACGCCTGGATTAGCCTACG TCTTCGCCTTTCAGGATGATCAGAGTTTGAAGGATGTGACCGCCAGGTAC TGCGCCAGTTGGAGCACCACTGTGCGCAAAGCCCGTGTAGAAAAGGCGTG GCTAGATGAAACTATTGCTCCTTACCTCGGACGCCGCACCAAGCGCGATA TAACAGAGGATGATCAGCTACGTCGCATTCACTCCGATAAACCCTTGCCA AAGTCAATTTCCGAGTTCAAGGACCATCCGCTGTACGTGCTAGAGCGGCA CTTGCTTAAGTTCCAGGGTCTATATCCACCAGATGCGCCTACATTGGGCT TTATCCGTGGTGAAGCGGTGTACTCCAGAGATTGTGTGCACCTCCTGCAT TCTCGGGAAATATGGCTAAAAAGCGCACGGGTGGTGAAGCTTGGCGAACA GCCGTACAAGGTGGTTAAGGCACGTCCAAAGTGGGATAGGGTATGTTGTG CTCATTTTTTAAATGCATATGTGCTTCATTTTATTGTGTTGTATCCTTCA GCTCACGCGCACTGTTATTAAGGACCAGCCATTGGAAATCTTCGGGTATT GGCAAACTCAGGAATACGAGCCCCCAACTGCAGAGAATGGAATTGTGCCG CGAAATGCCTACGGCAATGTTGAGCTCTTTAAGGACTGCATGCTGCCAAA GAAGACGGTGCATTTGAGATGTAAGAAAGGTTTCTTCTCACCAATTTATT TAAATAACCTCGAAATTCAATTATAGTGCCCGGCTTGATGCGCATCTGTA AGAAGCTGAATATTGATTGTGCCAATGCAGTGGTTGGCTTCGATTTTCAT CAAGGCGCTTGTCATCCCATGTACGATGGCTTCATTGTTTGCGAGGAATT CCGCGAAGTGGTCACTGCTGCCTGGGAAGAGGATCAACAGGTACAAGTTC TCAAGGAGCAGGAGAAGTACGAAACCCGCGTGTACGGAAACTGGAAGAAG CTGATCAAGGGTCTCCTCATTCGCGAGCGACTCAAGAAAAAATATAACTT TTGAATTCTTTGGCCTCTGATTTATGTTCGTATTATTGTTTCGTTTAAAG GCATTTTGATATTTTTGTATTTAAAACGTAATTTGATTCCAATAAATTGT ACACTAGTTGTTTAGAATTCGTTTATTAATCGATTGTTTAAAAGTTCTTT TTTTTCGTAAATTTACATAGCATATTCGTTAACTTTACTTCGAATTTTTT GAATTAAATTTTAATTTACAAAATTATTTTGTTTTCAGAGTACGTTGAGA GATTTTTAAGATACAGAACGTTTGAGATAATAAGATTATGGTTATTTGGG TTATAGATCCGTCAATTTATTTGCATAAAATAGTATTTAGGCGCGATTTT AAATCTAAAATATAGTTTTTACAACAGCATGGAATGCATTAGCAGACTAG AGAAATAAAGCAATTTCCAGCCAAACAGCTCGCATTTGATCGTTTGGCAA AGGTGCAGATAAATATGTAATAAAATATAAATAAAACCTTAATTCAAAAT AAGAAAGTACAAAATCCGTATACGTACAAAAAGAAGACTTTGGTTATGTA TTCTGCCATTCACCTCTAGCAAGACAAATCTGAGCAATCGACTGAGTTTA TGGTTACATCAAGAGCTGCACTTTCATGAAATGTTAAAACTTAAAGGAAA AGTTCGTGCATCGAGGGCATGGGGTTATCGTGGAGTCAAAGTTTCTTTTA ATGCCAAGATGATAAAATTGTTTATTGTAATGGGTTTTTTGTTCTGTTGA ATTGGAGAAGTTCTGCATAACACTCATCGAATATTTGTGAAATTTCAGTA ACTCATACATAACGGTTGCCAAGCTGAGATGACACTAAGGTTTCATGGAA GCGGGGTAGGATTGCAAGTCTCTTAAGCAGGCATTGATGAAGTCAAGCTC GCGCCCGTGGAACCAGTGGAGACAGTCCCGCTGGGCGATCTCTGGCGCTG TGGGCTGCTTTGTGCCTTAAGGTAGTCCACGAACATACGCCTGGCCTGAT TGAGAACCCGAGTGACGTCGTGTTTCCTCACCATTTTATCAAAGTGCATG GCAATCTCGTTGTAGTCCATGCCTGCCTTCATGATCGTGTTTCGGTGCTG TAGCAAAAGTGTTAGACAGAGAAACATGAGGAATGCATTACCTCCACCGA ATTCTGTAGGTGGAGGCAATGCGGCCGCAGTGGTATTCACTGCACTGACT CCATTAAGATGGGTTGAACGCTGGGGGGATCGCGTATAGGCGCTCTCGTC ATCTGCATTCGTGGCGATCTCCACCAAAGGCGAAACCTCCACTAGACTCG GCTCAGTGGAAATGGGCAGGATGACTTCGGGCAAACTGTTGCTGTTGCGC ATTCCCAATGGACTGTGCCCATCCATAAGTTGGCTTTCGTCGATGAATGG ATTAAAGGCATGCGACTCGTTTTGCTGAACGCTGTTACTCTTAGCCGCCA GTCGCTGTCGACGACGCATATGTAGCTCACTGACATCGGGACAGGTTATG ATCTCGTTCTCCTTGAGATCCTCCACTAAGTCCAGGGCGTCCTTGTCCAG CTTCTCGTACTCGATGTCTTCCCGTTTCTCGCTCTCCGTAAAAGGCAGCC CAAAAACTTGTCGATCTAGATTCTCGGCCTCTAGGCGCAGCTCACGCGTT ATGGCCGTCGTCATGGGGTAGTACTCCTGGTCGGGATCTTGATCCGGTGT GTTTGAATCGTCGGGGTCGCATGGGTGATTGCTTTCCAAATCTAGCTGTA GATTGTAACTGCTCAGTTCCTGTGCCTGCTGAATGGTCGTCGCAGCCGTT GAAGCGCTCCAACTGGTTTCCGGAAGTGAGGAAGAATCAGATTCGTCCAG GGAGCTACCCATCCCACTCTTGGTTAGCTGTACCACGGGCTTAGTAACCG AAATTGGACCGGATGTTTGTTGCGGCTGAGTGGCAAAACGATCGGATATA CGATTCTTATTAATAGTTGCAAAATTTAGGAATTCATTGAAGTTTTTTAC AAGCTTTGGCGGCATCTTCCGATCACCATCATCTTCTCCTTCTCCATCAA AAGAGATACCAATACGACTGCTTGCCGCCAGCTTTTCCTTGAGATCCTTA AAATGGCCACCACTAGAAGTGCTTACTCGCTTCATACTTTCACTCACTTG ACTAGCATTAGTAGCTAGCTGTTTGGCGATGATATTGCTCACGGTCATAA TGTTTTTGTGCTGCAGCTTGGCCTTCCTGTCACTGGGGTCCTCGTCCAGA TTCGAGGAAGACGAACTACACAGAAAGGCTCGTCCTGGTGAAACAGGAGG TGTGGTTTCTCTTTCTGGTGCTCTCTGAGCATCATCCTTAAACGGATTTG TCTCCAAAAAGCTTGGCGACTCCTTCCTATCAAATACATCATCATCTTCG GTTTCCTCGCCGGCGGACAAGTTTTGTTCCAACTTGACATTCCTATTATC CAAAGCGCCCTCAATAAGCGCCAGCATTTTTGACTCGTCCAGACTTTGAT GGACCTTGGCCGAAGTCCGTCTTTGGCGGCGAGCAGCGGCTGTCGCATGA CGCGACATATTGTCGTCTAGGCTGTGATTCAGCCGTTTTGTATTGTCCAA TCCGTGACTGGTTCCCACCGAAGAACTTAGTGAGCTCAAGGAGGCTGAAG AGCTCTGACGGCGCAAAGCGCATACCTTGGTGTAGGGACTTTCACGCGGT TTTGTCAGCAGATAGGAAGGACTGGTCGGCGTAGCGCTGTAGGAGCTGGA AAAAGTGCTGGCGCTATTGGGCACGGAGGCATCAGTAATGGGTACGAATT CCTGTGAAAAATCATGGTGATTAGAAATTAAGCAATTCCCTTTGGGTTTC GCACTAACCTTTTCAAAGAGCGCCAGCTCTTTCTCCCCATCACATCGATA ACGAAGTGAACTCCACTGCACCTCCAGCATGCGAAGGGCATCCTCAAAAG GAAACTCCCGCTTTAGCTCCAGCAGTAGCCAACGGTAACAGAAAAGTAAG TCGTCCGCTTGCTGCGACTTGAGGTACTCCCAGAACTCAGGATCATAAAA ACTTAGCGCCTCCGTTAGGTGAGCAAATTTCTGAGTCATTGCAATCCCAT CCAGCATGAAGTTTCCACGCATACGTGACATTATCGCACAAAAGCAGATG TAGGCCTGTGCCTCGTCGTTCATGGTAACCAGTAGCGGGGAAGCAATGTC CGACATGCCTTGACAATATGAGACCGATGGATGGTTTAGTGCATATGTGG TGAGGATATTGAAAAGCGCAGCGATGTTCTGATTGTCGTCGCTGCCTGCA TAAAATGGATGCAGGCGGTCCGTGCGGAGAACATCCTTCTTTACCATGCT CGTTACGTAAGCCAGTTCTCCAGCCACACTGCCTCGCTTCACGGCCGCTT TCCATGTGTCTCTCAGACGACAGTACTGCTCAGACTTTCGTCGCATGAAT TCCATACGCTGGTGTCCATCAAGTGCCAGTCCGTTAGCGCCACCGGGATA AACGTTAAGCAGATGTTTCCACACAACGCGCCGCAGACTGGGGTCAATGC CTCCTAGGAAGATGACCCTATGCAACTCGTCCTTGCGTTGAATCTGACCA AGTGCGTCCAGAAAGAGCCGGAACTCGCTGTCGCACATGGGCGGCCGTGG CGGTAGATTGGCCATATGCTCCTCGGATAAGTTAAACGCTTTCTGCACTA TGGAGAAGGTTTTCTCCATCTGATTCAGAATGGAGCTGCCCAGTTTGGTC TGCATGTGCTGGACATATTTCTGGGAGACTCCTAAGGACTGCAGTGGTGA CATAAGCTCGCGGGCGGGTACAAAAGGTGCAGGAGTTGCGGGAGCAGGCG CTCCCGTTATGGATCTACCCGGGGAGGCCTCGGTCTCACACTCCCTGACC ACCGTAAATGGCTTCACATCGATCTGCAGGGTGAGGCAGGGTTCTGAGGC CGTCTGAATGGAAATGTTGTGAATCCTCAGAAAGGCGGCATCCAGATCCC AGTCGGAGCGCACGGCCAGGTAGATCTCGTTGCCCGCCGGATCAAAGGCC TTGTACTTAATGGAGAAGTCCGACTTGACATCGAAGGCCTTGGCCAGCAG GGAGTACAACACCTCCAGCGTGGTGATCTGCGGGTCCACTGAAAACTTTC GCCACTCCGGCCGAGCAGTGGGTTCGCATTTCTGTGGGCGATTTCAAAAA AATTAGATTGAGGAACACAAACTAAGCAGCCCTTTTGTTGTCTCGCCTTC TGGCCACCTTTCACTTGCCTTCACTTTCACCCGAACCGCCTCCCGGGGGC AAATGCCAGCCATGTTTTCCGAGTCTGTTCTGGTCGACGACTAACTAAGT TCCATTGTACCTCTGAGCGATGTCAGTATCGTAAGTATTGCTCAAATATA AAACAATACAAAAGAAGGAAACTGAAATCAATCGACTTGATTTCAATCAT CGGTTTCAGTGTGGCCGCCCTAGGGCTTTGTAAGTTCACCAGGGCTACAT TAAAATACCAAATCACTAAATACACAAAACAAAAATTTTTAAAATTAAAA AAAATTAACAAATTGTTGAACGTACGAGGAGAATATATCAGCTACATTGT TTGCTAAATTAATATGAATAATAAATGAATATAAGAAAATAAATCTTTTT CAATTTTGAATTGCAAAAGTAATAACTTATTGGCCAAAAAATCACGATAT CCCCGCCAGTCACCGTTTTTCATCTGATAAATTCAGTATTTTTGGTATTT ATCCTCCGCATTCTTTGCATTTTTTAGCGTATTTTCTGGAATTCCCGAAG ATCTTGTTCCGCTCTGCGCTAACGGGCACATTGCTTCGTGTATGTGTATA TAAATACAAGAAGATTAGTGCAAAATTGTTGTTGTTAGTTATAGTTTTTT GGCCGCCGTGTGCTAGCAAATGCATTTTATGCCCCGGCCCGCGCACTTTG GCACTACATGTTAACGGATTTCAGGCTGGCGTGGAACGAATTGGGCTGGA AAGCGGTGCGTAACGGCGGTCGTCGGAGACTTGGGTGTGTATACATGTGT ATGTGTGTTACGGGCGTGTTTGTGACGTAGGCAAGCAGCAGCGAGAGAGC GAGCGAAATTCCGTAGAATCCGAAAACCATCCGATATCGTTGCTCCCAAG CCGGCTTTACTGGGTCGTCGAGGGGTGCGGTGGCTGTTCAGGGGGCGGGG GTGGAGCGGTCGGATCCACCCGCCCATTCAGTGGAGCCAGCGATAAGCCC GCAATTGAGATAACTCTGCCTCAATTTGCGAGACACTATAGTGTGTTTAT CTGTCCAATTGTACTTCCTATGTGTAAGCATGTGTGCGTGTGTTTGTGTG TGCGACTGTGTGCTGCAAGCTCTTCACTGATAAATTCTGCCTCTCCACTT TTTTCTCGCTTTTTAGCAACGAGCTGATGACAATGTAAGTGAAATTATTA TGCAAAATAATGGTCTTAGCTTCCGCCGTCGTACAAGCTCTATATGGCCA CCAAATTGCCTGTGCCCGCCGTATGTGTACATATGTAGCTACATTTGTAT GTTCATATATCACTTACGCGCCTTCGCGCGACGGCGTTCTTATATCATAA ATTGATATGTTAACTGCAAACTGTATTACAATGGCCCTATTATCTGGAAA TTCACTGACCCTGCCCTGAATCTCGCCCAGCTATTCTTATCGATATGCTT ATTTGGAAGACCTCGCCAACTCTACTCGAACTGTTTTTCAGATTGGCTAA GGTTTAATGGATGACACATCAGCACCATGGGAAAGTTACTATCAAAAATT TTCGGCAACAAGGAAATGCGAATTCTCATGCTCGGACTGGACGCGGCTGG AAAAACAAGTAAGCACATAAACAATAAAGGGTTCTCGAATTCGATTGTGG GCCTGATTAGTACCCATTAGTTTCATCAGTTTCCTAAGTGGAAACCAATC CCATTTAAAAAATACTCTTGAGGCGAGGCAATTATTGTTTTGTTTTTATT CTTATTGTACTTTGAAAAAATGTACAATATAAAGACCTTTCAATACGTAC ACCAGTACTATCACTAATCGAATTCGAGCTATTTTGTTTATACATCCTTT GCGTGTCTAAAGTAATATTGTTTTTGTCCACCCACAGCGATTCTGTACAA ACTGAAACTTGGCCAATCTGTTACAACGATACCCACTGTGGGCTTTAATG TGGAAACCGTCACCTATAAGAATGTCAAGTTCAATGTGTGGGACGTCGGT GGGCAGGATAAGATTCGACCGCTATGGCGACACTATTACACGGGTACACA GGGTCTGATCTTCGTCGTGGATTGTGCGGATCGGGATCGGATAGACGAGG CGCGCACGGAGCTGCATAGGATAATTAACGATAGGGAGATGCGCGACGCC ATCATACTGATATTTGCTAACAAGCAGGATCTGCCTGATGGTTAGTATAG TGCTCAGCCAATTGTTTCCATCCGCTTATTGTTCTCTCTTGCAGCAATGA AACCCCATGAAATCCAGGAAAAACTAGGTTTAACTAGAATAAGAGATCGC AATTGGTATGTACAACCATCATGTGCCACATCCGGCGATGGCCTGTCCGA GGGCCTCATTTGGTTAACGTCGAACCATAAGTTATGAGAATCGTAATCGA GCATTTTCTTATATGTATGTATATGGCATGTATTATTCGAAGCGAAGCAA AAGCGAAAATATTCTATTTTATTTATACAAAGAAAACCAACCGCAAGCGC ATAGTAAAAACTCAATTCGTAAAAACGAACGTACATAAATTACAAATGTT AAAAATGGTATATAGAAGTCAGATATATATAGTAATTATATATACTCTCA ATTAACCAACCAATATTCTCACTAGTAAAAATACACATACCTACAAAATA AAAGAAGCATCAAAATAAGCAGCCGGTAAATATCCGTAAAGTAAATTATG CGTGAAGCACAGAGACATAAAGCAAAACATCAACGGAGATTAGCCTTAAG TAAGTTTTTCTTGTAAATTATATTGATGAGACACGTAAGCAATAAGTTGA AAGCTTGTTTATTGCAACTGTTACTATATTTGACTTGAGCAAGGGTGTAA CGAGTCTTAAATAAATTGTAAATAAATATTCAAATTAAAGCCCATATACA ACAACAAACGAAATAAAAGAAAACACCGAACAAACAATTGAACAAACCTA TAGATTGCTATTTAGATTAAAACTGAGTCTTCAAAATATAATGAAATAGT AACTGTGCCTTCCTCAATGTGTGTCTATGATCCCTCATTATTTTCCCCAC TCCAACAGCTAATTTTCTCAATCTGATATCCTTCGAGACGAAGAAGGTCC CTGGATTTGCGAGAAAGGCATATTCTGACTTCAGTGTCAAACGCATTTGG TTTGTATTGTGCGCTCAATTTGAAAGGTAAACATGCCACATTCAGTGCCA TAATTTGCAGGGTAAATGAGCCTGGGTATACCTGAGCATGATTTGTTCAA CACGGCGTTCAATAATTTACCTTTGTTTTGCAATCATCCCCGAATTGTCC GAAAAACTCCTTGGTACATCCTTGCATGAATAATATAATTTATTTTTTGT GGGTGTATGTCTTGTTTTATACCTTTACCGTTTTTATCAAAACCAACCTA TTCATAATACCCCGTAATATCTCAGTATCTAAGATTTTTGTTGCTGAATT ATAATTATAAATTTTAAGTTATGAAACAAATCATAGGTTTCAAAGTTATT TTCTGTAAATATGTTTTTGTATTATTATTGTATTATAATAATAAAAATAT ATAATAATTAGTAGAGTCACGTTTTACAGATGAAAAGGTTGTGATGAAGA TGACGAGTTCCCAAATAAACGTCATCTAGCGATCCACGAAGTGACGAAGC GCTTATTGCCAAGATAATCTTGTTAATATTCTCACATGAAGTGACACATC CTATGAAATTTGTATGTAGAATTAAACGATTCCGACTTAATAAAGTGTAT ATATTGTTAATATATATATTATTAGTCAGGATCAATAGCCGAGTCAATCT TTTCTGTGTGCAGAATCCCAGAGTGTAGTATTTCCTTGGTTTTGCGTCTC CTCAAGATGCGTGTTTGTTCTTTCCTTCGTTTGCGAGTTATCTCCAGGAT CCGTGGTCTCCTTAATATTTGGTTCACGAAAACAGCAGGTATATGTTGGA AAAAACTATTTATTTTTTGTTTACGATTTTAAGACGATTAAGAAATTGGG GTATTACTTGTCGTCGTCATCCTTGTAGTCAATGTCATGATCTTTATAGT CTCCATCGTGGTCTTTATAATCTGTCGACGAAGTTCCTATACTTTCTAGA GAATAGGAACTTCCCGAGGATCCGCTGCCGCCGGCGTTGCTGCGCCACTC CATCTTCTGGCTATCCAGGATCTGGCGCAGGCTGCTGGCCATGCCCTGGA AGTACAGGTTCTCGGGGCCCTGGAACAGCACCTCCAGGGTGCTATCCAGG CCCAGCAGGGGGTTGGGGATGGGCTTGCCCTCGAGCTTGTACAGCTCATC CATGCCCAGGGTGATGCCGGCGGCGGTCACGAACTCCAGCAGCACCATGT GATCGCGCTTCTCGTTGGGGTCCTTGGACAGCACGCTCTGGGTGCTCAGG TAGTGGTTATCGGGCAGCAGCACTGGGCCGTCGCCGATGGGGGTGTTCTG CTGGTAGTGATCGGCCAGCTGCACGGAGCCATCCTCCACATTGTGGCGGA TCTTGAAGTTGGCCTTGATGCCGTTCTTCTGCTTATCGGCGGTGATGTAC ACGTTGTGGCTGTTGAAGTTGTACTCCAGCTTGTGGCCCAGGATGTTGCC ATCCTCCTTGAAATCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTAT CGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGGTGCCGTCATCCTTG AAGCTGATGGTGCGCTCCTGCACGTAGCCCTCGGGCATGGCGCTCTTGAA GAAATCGTGCTGCTTCATGTGATCGGGGTAGCGGCTGAAGCACTGCACGC CGTAGGTCAGGGTGGTCACCAGGGTGGGCCAGGGCACGGGCAGCTTGCCG GTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGTTGGTGGCGTCGCCCTC GCCCTCGCCGCGCACGCTGAACTTGTGGCCGTTCACGTCGCCATCCAGCT CCACCAGGATGGGCACCACGCCGGTGAACAGCTCCTCGCCCTTGGACACC ATGAATTCATCAAGTGGATCTTGGTTTGTGTGAACCTCGTCCAGCGGGTC CTGATTGGTATGCACTTCGAAGCGCCCATGATGTCCTCCATGGTGTCTGT GGTGTTCGCCAAAGCCGCCTTGTCCGCCACCGAAACCACCTTGACCGCCA AATCCTCCCGGTCCGCCACCGAAACCACCTTGACCGCCATATCCTCCCGG TCCGCCACCGAAACCACCTTGACCGCCATATTCTCCGGGTCCGCCACCGA AACCACCTTGTCCACCAAATCCAGGACCTCCACCGAATCCTCCCTGTCCA CCAAAGCCGCCTTGTTGACCACCAAATCCTCCTTGACCACCAGGTCCAAA TTGAGGTCTGGCCAAAACTGCGGCCACCAGGGCAAGAACAACAATCTATA AAATAGACGAACGTAAGATCCTTCTACTTTCTTTCACATAACCCAGCTAG CTTACCAGTAGTTTCATTTTGCTTTAAATTATTAAACTGAAATCCGCTCT GAAAGTGGCCTCTTTATATACCCGATCTGTAAGCGTGGACTTAACTATGT CTCGACTTTCAGATACCTATTAAGCGTAGTACACTTACGATTTGACAAAC GTATGTAAGCAAATGTAAACTTACAATGTAATAATTGTTTCGATTATTTG TATTTAATTTATATAGCAGAGGCTGGAGATTTTTAAAGACTTTTTATTTT CAAAATTTATAAACAAATGTGCCAACCTTAAGCTATTTATTTATACTCTC ACCAAAATACGATTACCCTGTAAAAAATTCAACATGTTGATAACAGAAAC AGGAGGTCATTGTTTAGATGAAAACAAAACAGTCGAATTGTTAATCACAG ACAGCGGAACCACCAATTAGGCAGAAAGTATTGTTTTTTTGCGTTATTAT TTGATTTTCATTTTGGGCACGTGTGCGAACTTTTTATGTAAAAGAACCTA TTTAAAAAATAATATAATAATATGATGTCTGGAAAAAAATTAAATTTAAT AGACAGATTAACGGTTTAAAACCAGACTATGAGAAAATTCATATATAAAT TTTAATTGTATTATTTACTTTAATATGTCTATGTCTATTTGGATAGTACA GATTATTGATTGGAGTGCCCTGTGAAAAAAATATACAAAAAATCTGTCAA AAAAGTCTTTGTTTTGTTAATATGTAACAAACAAAATGTTAATCTTACAA AGAGGAAATATACTCAATATACAAATATAGACAAAAGTTATATATTTCGA TTTGGGAAAAAAGTAGTATAATTTAAGAATTGCTGTTGCTAAAAAAAAGA CCGATTTTGAATTTCTAAAATGCATTTCTCGAATAACTTGCAGAGGTTTA TAAAATAGATGTGTCATTTCTAAAAACACAATCTTAAGAACTTGACAAAT TGAATAAACTATTTAATGTTGCTTTAATCGACTGGTACTGAGATTAGTTC GGGAAATCGAAGATTGATAATTATTGCGGAAGTTCAATAGAAAGTTGTAA TGGTGCTTGTATTTTTGGCATATTGATGTCTATGTGTTTTAATTCCTAGT TTAATGTGAGCAATAACTATACCTTAAGAATTAAGTCAACTTTTTCGCAA GATTTAATTTTTTTTTTTTTTTAATTTACTTTGTTATACTTAAAGTTGCC GTTTTAGTAACGTCCATGATGTCCATGATGCTTGTGATGCTCGTGGTTAC AGTTCTCGTGACCAATTCCGCCGGAGAATTCTCCCTGTACAAGTTGGGGG CCTGCTCCGAGCTCTCCTGCGGCATATAACTGGCCCGATTGGGGAGCTGG TCTTCGGTAGCCTCCCTGTCCGCCGCCGTATCCCAACTTTCCACTCTGAG GAGTGGCATTGCCATATCCTCCCAAACGTCCTTGGCCCGAGAGTCCAAGT GCGAATTCATTTGGGGGCACGGATGCGCCATATCCTTTCTGTGCACTGCC GTATCCACCCTGAGTGCCGCCGTATCCCACCTGTTCAGTCAATGGAGCGG GTTGGCCATATCCACCCTGAACGCCACCGTATCCTCCTTGCCCGCCACCG TATCCTCCCTGCCCGCCACCGTATCCTCCTTGCCCGCCACCGTATCCTCC CTGCCCGCCACCGTATCCTCCTTGCCCGCTCTGGGAAGCTGATCCGCCGT ATCCGCTTGGCGAGCTGCCGTATCCACTTTGTCCGCTCTGTGGAACGGAT CTCAAACCCCACTGGGCGGTTGCTGCTCCGTCGTATCCCGGTCTGGCCAA GGTAATGCCCATCAGGGCGAACAGGACAACCTAAAGGGTAAATAAATTGA GGATTATGTAAACTTCACTGACCATTAGCTTAATCACCATTAATTTCATC TTGATATTTTTTTTCGAACTGTAGTCAATGCCAAAGAGTGTCTTCTTTTA TACCCAAGCTAGTGGGCATTGCGTTTCGACATTTAGTTACCTGTTATGGA CTGTCATTGATTTTAATTCAGTTTATATTGTCATAGTAGATATCGATTGG GGGGTATCTTGCTTTTGAAAGGAAAGGCTTTTTTGATATATTTAAGCAAT AACTTTTCCGGATCTCAACATTCCCCTATTCCAGAATCTAAATTGTAGGT ACATCCGCTTAAGAAGCACACATTCCTAATCAACTTCGACTACCCTGTGG AAAATCCCAAATTTTGATGGCGCTGAGGTCAATGATTAGTAGAAAAATAA AACAAAATTTTGGACACGGCAGGGAATGCTGCGATTAAGCAAGTGTATTG GCCTTAAAAATAAGTGGTATAATCAACTTGTAAAAAGGGCAAGGGCAATA AAAAATGTATAAATTTCATTGTCGCTAAAAATGTTACTTTATTAATGGCC TCGATTCAACGCTTTAAATTTGTGATAAATTTTTGAATACATTTCAATAT ATTTTGCTTAGAACCATTTATAGATAAGCTAGAAATAAATTATTTGTGAA TTTGTAATCTCAAACAGTTTGTATATATGTGTTTGGTTTGATAGAACAAA ATAGAACAAAAACTTGAGATTACATTTTGGCCGATAAGCAGCACATGTTT ACTTTCGTGTACACTTTTTATTATTTATTTTATTATATTTATTTCATTTT ATGAAACTAACTATGTTACTAAGAATGTTAGATAAACGTTTACGTTTTAA AGATACAATAGTAACTAACAAATACAATTCCTTGTAATCCCGCTTTACCG GAACGTAAATCAAAGATACAAAGTGTCTGAATGTTGAATAAAAGAGGCAG TCCATGAATTTTGATTGATTAAATAAAGTGCACTGCACTTGATAGGGCTT GCCACCCACCGCCCTCTCCAGTGGGTGGCACTCGCAGAGATTTGTCGGTG TGGGTGAGTGTACGAGTATTCGTGTATGTATCCTGGCGATGCGAAATGTC GCCGTTCAAATGTCAAGAACCAACCCCGTCGTCTCTGCTCGTCCTGCTCG CACGATGTCATTGCTCTCGCTCACACCGACGGGCATCCTGCGTGCACGTC TGTTACAGGATAACGTCGCTCTGTCTCTCTGTATTTCTATCTCGCTCTCG TTCGCTCCTCCCTCGACGTGGTGGGCGTGGCCATGCTGGCAAAGCGCTTT GACTTTTGCATTTGTTCACTTTTGTCCCGAGCATAAACTTCTGCCAGCCG CAGCTGCTCTCTAGCTTTCTCCCCCGCGAAGAGAGCGAGATTGCAGAAAG GAGCGGTGAAAGGAGCAAGGGAGGGAGCTGCGGGGAGGGGCTGTGGCTTG CCAGGATCCTGACTGTTGTATTCCGACATCTCATTTGTTACAAAGTTAAT GTCGGCGCATTAAGCATGGCAAAAGCCCCACAACAAAATCGGGGAGCACA ACGGAGCCCCCATGCCGCCCGTTTTGGTCCTGCGAGCAGCATTTATCGAT TATTGGATTAGTGGACCCGGGACCACCTCTAGCTCTGGCTCTCTTATCCA TAAAATTATAATGTATAGAGAGTAAATAAAAATGTGTATGCATAAATAAG ACTACGTAGACCATTAGATAGAACATCTTTACACATTACATTAAGTTTGA CATTATAAATATTTTAAGGTTATACTTTTTAAAATATAAAAACCCACTTC TGAGCATATATATTCTGTCTTCAGCATATTTTCTCGAACAGTTCACAAAC TTGAATGACTGGTTCTATGAGGCTTCTTAAAATTCGTTAAAACTTAATTT AATACAAGCCTTGGTTCTTACTTTAATTTCTTGTACAAATAATAATCTAA ATATCTATATCTAAATATATAAATATATAATTGTTGCAATAAAATCAGGA AGGTAAATGAAACATGATTGTGATATTAAAGTTAAATAAAATCACCCATC AAATTAGAAAAATATTTAAAAACAAACAAATTATAATATTAGGATAATAT ATGTATATTATAATATATATATAATTTAAAACTCTTTTGGTTATATGTGC ACTTAAATATTCTTGATTTAGATCCAAGTACACCCACAGACACCAGCAGA AACATTTTCTTCTTCAATTCAATTACAGTTTACTGGGTGGCGGCAATTTC TGGGTGGAAGTTGGGGCTTTTAGGGGGCGGTTAGAATACGAGGCCAAGAG TGACGTCGTTGGCAGAGGGTCAAGAGGGGGGCCAAACTGTTAGCGAAAGG ATCGAGGGGCAGGACGACGCAAGCTCGAAAGCGCCGACATCACAAAGGGT ATTATAAAACAAAAACAAAATGTCAAAACCCAAGACGATTATACGAGCGC CAGCCGCGCAGCTGCGTCATTCGTTTCATGGTTGTATTGGTGGGGCGCCA CCATTGCTCTGCTCCACTTCCGCTCTCCCGCCCACTTCCGTTTCCGCTCC CCGCCGTCGCTCAGCTTTTTTGAGTCATGATGGCGACCGGGCGTTCTCTG CTCTTTCGAGTGCCTTGGTATGTGTGCTTGTGTGTGTGCGCAGAGAGCGC AGAGCCGGGTGTTTATTGGAGATTGCGATTGCGGCTTGGCTTACCCACAC TCGCAGGGCCGCACACCAACACACTAACACTAACAGCGAGGACAAGCTCC TGCCGCAGCATCAAGAAGGAACGAATCAAAGCAAGCCAACAAGCAAATGC GCCACCAGAGTTGCCACTAAAAGTCTCCGTTGGTGGGTGGGTGGTGTGCG GTTATCCTTCGCTCGCTGCTCCTTGCTCGCTGCTCGATGCTCTCTGCTCT TCCTGCTCCTATGTGTGTGTGTGTGCAGTGTATGCCGTGCTTTTTGTCCT CACACACACACGCGCGCGGCAAGGACTTCTCTGCCCACTCAGCGACCGCG GATTATATCCTGCGATATGGTTTTTTCCCCCTAGTCCGGGGTTGGCCCGT TGGCTGGTTGGCCGACTGCTGGAGTGGACACATCAGTGTTTAGCTCCTGT CACGCTTTTATGATAAATCTGAAATCCGGAATCTGAAATCGTACATCGAG ACGTTAACATCATCATCGCGGCACACTCGCAGCGCCGTCGGATCGGATTG GTTCGGTTTCATCAGCGGGAATCAGAGGACCGTCCACTTGCCGTCGCCTC TCCACGATTGCAAATTAATATGGAGCCTACTGCGATGAACCCGAAAAGTG CCATTTAAAAGTGGTGTTTTAGAAATTCTTACAAATAGTGTCAATTGTTA ATAAACTTTTCAACGAGGTGTGATCTTTAATCGCAGTCCGCCAAAGCTCA ACAAAATGAATAAGGAAGAAAATTCCTCCGAAACACGACCATCTTCTCAA GGTAAATTAGTGTGTTAATAAAAACATGAGTATGGTGATGAAATATATTT ATTAAGCTGTAAACACAAAGGTGTGGTTTCCTTACTTAAATACATAAAAA AATAAATATACAAGATGGCCCTAATGGTGGCTAAAAATTCCTTTACCAAC AAATTTTAAAAAGGACAATATCACGTTTGTTGGGAAATTGTGCGTGAAAT ATAATTACGTTTCTTACACCCACGATTAATTAGGACGGATAAGATAGGAA AATAAAAAAAGTGATATGTTAAAGAAAAAAACGGAAAGGATGTGAAAGCA AAGATTACAAAAAACGACTGGCATCGTAATATAAATTAAATTTAAGCTTT TTCATTCTAATTACCCGACGGAAAAAATTGTTTCAAATGTGAGTTGTAAT TAGTGCCGAAATAATAATGTTATATCGAAAACTAACACACATTTTAAGGA TTGAGTTCCTAGCAAAAAAAAAACTTTAACAATTCATTTTATGATATTCA GATATGACTCCTTTTTTAAGCGAATTCTTATACGTCAATTATAAGTTTAG CGATTTGAATAGAAAATCTATTTTATAGCTGTGTGACCAATTTAAATATA ATGTTAAGAAGTATAACTTTTTATATGTTGAAATGACTGGATCAATTGTA AAATGCCCAGACTAAAACATGAAAAGAAACAAGCGGATTCTGATCGCTCT GCTCGGAAATCACATTGGCAATTTTAATTACCAATTTGCAGGAACCAGTT GTCTGCGGAGACACTCAAATCAAATCGATGCCCAACTTGCTGATGGCATG CACGAATGGCCAGGCAAATTCAATTTGCGATAATCACCAAATTGAATTAG ACTCCGAGTCAGGCCGCCAAAAATGTCAGAAATTCATAACACAGCCATCC CGGCGCCCTTAACACTTTTGTGTGCGCCAAAGTGAATTTCAACGAGCCCA TAAAATTAACAAAGATGCCCCGGTGCCCCGGAAAATGCAAGCATATGACG CTAATCCTCCGGCTTTGGACCGCAGTCCTGCCAGTTGGTCCCGGCTGAAT GGCCGCCTGACTTTGTCTTTCCATTCCAATGCCAAGCAGGAGCAAAACCC AAACCCAAACGCAAACCAGAACCACGAACCCAAATGGTCGAGCGCACAGC CAAGTGGCGAGTGTTACAAATGTGTCCTCAGCCTCGTCCTTGGAACGTCG AGGGTTAAGTGCATCAAAAAATCAGTAAGGAAACTACAATCAAATTAGGG TGTGATGGCAAAACAATCGTCCCCCGAGGCAAATTTGGCGCACAGATTGC TCGGCACGCTCTGGTCGAGAGCCGTTTGGCTTAATGGCACCCTAATTGAA TGTGTAAATATATTTGCGGATTACAGGGCGTCAATGTCGCCACGCAGGGA TAAGATCGGCAGGTCCTTTGCATCCGCAATCCGGTACAACTGACAAATTG GGATTTAATTTATATGAACTGCATAAGTGATTTTTTATTGCACCACCCAT TACCACCGGGAAAACTGGTCTTAAGTCTGGTCGAAAATTTTAAATGTCTT ATGCTGGAACGAGATTAATCATTTAATATGCCGATGAAAAGAATAGCTAA AGGACAATCATTACGCGTTAAGTTTAAAAATGTTAAGCTACAGTGCGGAA ATTGTATAGAATTATACATTACATTTCTACATTCTGCTAGTATTAGCTAA ACATTATGTATACTATTTTTCCCGTTTTATAAACAATTTTGAATATTTAT TAATATTTAAACGCCAACTAAGCTTTAACCACTTGCACAATTCGTTGATT TTAAGATCTATATACGAGCTAATAAACCCAACTGTATGATCTTAATAAAG CCGTAGTAACTTCCCAGATAACAAAAAGATACAATTTCGATTCTCTTAGA TACCATTCACTAATCTGCTTCATAACTTTAGAACTCCACAGTCCGCAGCG GCATTGCTACACTCCGCCGCCGGCGCCGATGCACGGACAGGCGCCTCCAC CTACATCAACGGGCGTGGCCCCGCCCACACAGCCACCGCCCCCTCATCCC GCCGCCCCAAACGTGCCCAATGGTCGATTGCTGAGCTGGAATCACAGTGC CGCTGCAGCTGCTGCGGCGGCGGCAGCCCAAGCGGCAGCCAACTCCATGA ACCACTCGTCGGCGGCGGAGGGTTCATCGATGACCCGGATTAAGGGTCAG AACCTGGGCCTCATCTGCGTGGTGTGCGGCGACACCAGCTCGGGAAAGCA CTACGGAATCCTAGCCTGCAATGGCTGCTCCGGATTCTTCAAACGCAGCG TGCGGCGGAAACTCATTTATCGGTGAGTGCACACAGAAAGATATTTTGCG GACCTCAAATTAGAAATAAAAACTATAAATAACAAAAAGGACTTCCTTAA CACGTCATATAGAGAGTAAAGTAATTATGCCATATAGGCATAAAGAGTAA TTTAAACCATTAATACATATATTGATACTCCCCTGCAAACACTCCCATTT TGTGAATTTTAAATGTGTGGTGCCAGTTTTATTTCAGTGTAGCCCTAACT ATGCTCCCAAATCCAGTCATTACCATTTCATTTCCATTAAATGTTGCAAC ATTTGCCCAAAAGTGGGTGGTGCCGGGATGGGTGTGGGCCGCTGTGCCCG GAGGCTCGTCTGGCGGATTACGGAGCTCCGGCAAATTCATTACAATTATT CAAATCTTTGGGATTTGAGCGTCAACTTTTGAATGCGCATATTTGCCCTC GCGTTGACTTTGTGCCCAGAATGGCATCATGTGCGAATGCCACTTTACTT TCGCTCCCCTCTCTCTGGATTGCAGCTTAAAATGTAATTGAATTTAAAGT GAATTCGTTTAAAACTTTTTCTTTTGACGTGGGAATTTTCCAAAATCTGA CAAAAAAAAAAAAAAAGAAGAGAAGAGAAGCAAAAGCGCGAATCAAAGTT TGTCGAGCGTTTTCAATTATCATTAAATCAGAGAGAAAAATCCCATAATC CAAAACGACGGAATCAATGCCAGCAAAAACATAAAGTTATGATACAGTAA TGCATGCTTTGCTCTGCGGCTTTCCAGCGGGCTCGGTAAATCACAAATGT CGAAATCTCTATATCCGTGTCCTGGTCCCATGAGATTGATATGGAGGGCT TAAGCGCAAAACACTTGGCCAAATGTGGCCCAGCACCCGCATCCATCCGC CCTCCCGACATCTTCGTCCATCGACTAAGCCGAATCGCAACAAAGTCAAA AAATGGGGGCGGTTCTGTGCGGCTCTACGGGATGAAATAGAGCAACATTC TCCCCCTGCACGGGAATGAGTGAACGAGGGATACACTCCAGACATGGAAA AGGGATAACAGGTCTAGTGTATATTTTCACCGACGTGACTTGTTTCCCGA TGGGCGACAGAGTCAATCTGGCCCTTGGTCCTTTTTATATCCTTGTCTCC GGTGGCCCCATTAAGCCGTTTTCAATTATAATCAATTGCTTCCAATCAGA ACTTTCGAATGTGGTCAAAGGAATTTTCCAAGGACATGCTAGAAATATAT TCGATTTGTTATGGTTGTAGGAATAGCCTACGGAATTTATGGATTTTATT CATTTGTTGTTCATTGGCTAAGAAAAAATGCCCTTATATTTTTCATTTAC TTTAAAAATGTATTTTATGTGACAATTTAACTTAAAAGTATATCATTTGT AGAGAATATGAAAGCCAAAGTCTGTCCTTTATTTTCCAGTTTTAGTATAC ACAAATGCGTTCATGGTCTATTCCTGGATGTTTGATGGTTGGGGCAATGG CAATATTATGTGATTATTTTTATAGAGACACAAAACTTGGAATGCCAAAG GAATGAGCTGCCCATTCACACATATCCAATCTACTTGATTTGTTTACGAA AATTTAACATTTGCATACACAAAATACCTCAATTTTATATACACACGTAG ACAAGGGCTGTATCTCAAGGATACATTTCGCTAAGTGATTTCCTACCAAG GCGCCACGAAGCACATAAAATGGAAACGAAATGGACGGCTAGAGATTTCT AGGAGCGTTGGCCATCTTTGAATTTTGGCGCAGGCTTAGTGTGCAAAAGG GCAGGCGATGACTGGGCTAAAAATGGTTGCATGGATTTCGATGGATTTCG AGTGGGAGGGATGGCACTCAGCCCTGATTTGATTAAAGTTCCACCAGGAC AGAACAAAGGGCGAGAGGTCGATGAAACGGAAGAGAGGAACAGGTCCTGT ATCTAGCAGATACAGAAGTGCTTTTGTGGCTGGATTTCCGCTCGGTTGGC CTGAGTCTGAGGTTTTGTGTTCGCCATTGAAATCAACAAATGTTGCAATT TTTGACACTAGAAATCTTGTTAGCTGCTCATCAGGATAACCTGATTATGT CCTGGCACTATTTTAATCGATTCTGTTTACCATTTCAGCTGCCAGGCGGG AACGGGACGCTGTGTGGTGGACAAAGCTCATCGGAATCAATGCCAGGCCT GCAGGCTCAAGAAGTGCCTTCAAATGGGAATGAACAAGGACGGTGCGTAT TACCAACTGCTTTATCATATCGCTTCGCATCACAACTCAGCTCGCTCTAA TGAACTGAAGCACGTTTAATTGGTCTTTAACAGGACCTTAAAAGCCCCGG GAACACGTGGCCCCGATCAGTGCGCCCTTTAACCCTTTCCCACGTCGGTA AACCCATGCCAGGAGCATCCTCATTTTAGGGTGGCTCACTTCGGGTTGCG GGTGCTCCTTATTTACATATTGCTCACCCAATTGATTTGCTACCTGCTGC TCGTGTTGTCTTTGACAGATTTTATGCAGCTTTGCCGCTGCCACTCCACT GAACACCAATTGTTCATTTTGACTGAAAGTTTTCTTCATTGTTTCGATGT CTGGAAAGCAAATAGACAATCGGCAGTCGTCAGTCAGATTCAGGCTTATA AAATCAATATAAGCCAATTGTACTTACCTGGTTGTACTTAACGAGTCACT GGGTATTTATAAGGAAGTTGTTCTTTTCATACCATTCTAATATATCCATT CAACTACTGCCACTAATCTGTTAATATTATTATATATATTTATATCTACT TAATCGAACATGACATTATAAAGATAAACATAATCGGCGAGAAACTTTCA CACCTTTCACTTTGCATTCTAGTCTCGTAAGTTTGCCATTTGATAAATAT AGTCTTCCTCCCTTGGGGCGGTTCACACACTTTCCCGACTCTATTGTGGA TCCTTTAATTTAGCCGTAAATTATGCGAGCCGTATGGAAAATAGCCACAG TTTGCGGATACGCCATTAGCGGCGAAGTAGCTTTTGTGGCCCGGCCTCAT TGTGCGGTGAAATTGCATAAACAAATAGCGAAACAATTTGTGGGCGTGAG CGGCACGTGACCACAAAACCAATTTGCCATCAATGGATGGATGGCCTTGT TCCCCAGCCGGAGATTCCATACCATTCCGTATGCTGATGAGGAAAGGCCG GGCACACGCGGCCGCTTTTCGTCCTGCCATCCTGCGATACCTGTGCTCAA ACGAGTGCTCGGAGCGATTTTGTCAGTGTGACATTTCCTCATTACGGACA CCTCCCAGTCCCACTCCCACTTCCACTTCCAGTCCCACTCCCAATTCCTA AACAACTAGATGCCGAGTGCTCATGCTAGTTGCATTTGTTTTCCAATTAC AGCCGTGCAAAATGAGCGACAGCCCCGCAACACGGCCACTATACGGCCGG AGACTCTGCGGGAGATGGAGCACGGACGGGCGCTGCGAGAGGCCGCCGTG GCCGTCGGGGTTTTCGGGTAAGTCTATCTCTACCGCTGCACTCGGAAAAA TTATGAAAAACATAAACTGGAAGATAAGCCAAGGCTTGAAGACTACTATT AGTACTTGTGCTATGTTCTTTTCTAATACCAAACTTTTTGTCCAACGAAA GAATAAAGAAATGTCGACCACTTTAAGATTTTATTGGTATCTCTTTAAAA AAAAAAAGTTGCATGCAATTTTTTCGAGTGCAGTTGTTGTGCTTGGCCTG TCATTTGCATAAGTCCATCTAACCGCCCGAAATCTGCGGGCAACTCCAAT TTGCAGACCACCCGTGCTACTGTCTCCGCCCTGCTACGGCTCCGGACTCC TGCCGCCGCCCTGTGAGTAGTTGCTGCCCCCCAGGCTGATAGTTGGGAAC GTATGTTACTTATGGTCCACCTTGATTTCTGTTTGATCCCCGAGCAGCAC TGGGCAGTTTGCCGACGGGACGATTGCTGCACCACAACCACCTCACCTCC TCAATGCAATTGGCTGCGAACCACATGGGCGCCGGCAGCTTTCCCATGTT CAACGCAGCCGGCGTGCACCACTCGCCCAAGGAAAAGGCCTACGGCATGG AGATGGCCACCAGTGGCAATGTCTCCCACTCGACCAACTCGAGCAGCAAC CACTCCATCGACCCGAGCTCACCGGCGCCGGAAAACGCCAAGGAGATAAA CATCGCCGGCGGCAGTGTCTCCTCCGTCAGCTCTTCCAGTCCCACCATGG AAAATGACAATGATGGTGGGTATATTTATAATTATACAAATAAATAAAAT CAATTTTGATAGAAGATATAAAATATCAGTTTAGAAATATATATGCTTAT TTATTCTGTTTAAAACGGAGTCAATATCTTATACATATAAAATATTAATC TATTATATAAACATATTTAAACATCGTATGTATTTATCCCATTTTTTTGA CAGACGACTCCATAGATGTAACCAACGACAACGAGGAGCCGCATGCAGTC AGCAGATCGGATTCGAGTTTCATTATGCCGCAGTTCATGTCGCCCAATCT GTACACCCATCAACACGAAACAGTTTACGAGACAAGTGCCCGGCTGCTCT TCATGGCCGTCAAGTGGGCCAAGAACCTGCCCAGCTTTGCAAGACTTTCC TTTCGGGATCAGGTGAGATTAATATAAAAACCGATCAATAGCAGCCAGGG TCATTTACTCAAAACATAACGAAATATCCCCTGTGTGCAGGTAATTTTGC TGGAGGAGTCCTGGTCGGAGCTGTTCCTGCTGAACGCAATCCAATGGTGC ATTCCCCTGGATCCCACCGGCTGCGCCCTCTTCTCGGTGGCGGAGCACTG CAATAATCTAGAGAACAATGCCAATGGCGACACTTGCATAACAAAGGAGG AGGTAAGTCTACACAGGACTCCGTCTAATATGTATATTATATATATGACC ACAAATTTCTGCTAGCTGGCGGCGGATGTGCGAACGCTCCACGAGATCTT CTGCAAATACAAGGCGGTGCTGGTGGACCCCGCTGAATTCGCGTGCCTCA AGGCGATAGTTCTCTTCCGGCCGGAAACGCGCGGACTTAAAGATCCGGCG CAGATAGAGAATCTTCAGGATCAGGCGCACGTAAATATACTGCACTTTTC AAAAGCAATAAAAGCTTCATTGAAATTTTACTTAACGAACAGGTGATGCT GTCGCAGCACACAAAGACGCAGTTCACCGCCCAGATAGCCAGATTCGGAC GACTCCTTCTCATGCTGCCGTTGCTGCGCATGATCAGCTCCCACAAGATT GAGTCCATCTATTTTCAGCGCACTATTGGGAACACGCCCATGGAAAAGGT GCTCTGTGACATGTATAAGAACTAGTTAACTCGAGCTTTAAGTTACAACA AATTTAAATAAATATGTTTTTGTGTCTTGAATGTTAGATGGCGTGACTTT TGATTTTTCCAGTTTTTCACCACTAGTTGCATATAATTTCATATAAAAAT GCTATAGAAAACAAAGTTAAAAAAAAAAAAAAATTTGATCGAAAATTATG TGTACTTTTTTTATCTGTACAAAGAACAAGACGCCATGAATTAACGTATG AATTTGAATTTTTTAATGAGTTAGCGCCAAAAGTTTTAGTGTTCAATAAC ATACACGGTGCTGTGTTGTAAAATGTATATTTCTATACAACCAAGCTGGT TTCGCTACCGTCCCATAGAAGCCGTTGTGAGCCTTTTAGAATCTTAACAC CAGATGTCGCACAAAACTAAAGTTAATTTTCTTTCGATCTGGCAGCACGT TTATAGTTCCTATTTTTGCCGCTAGGCTGTGTAAAATAAAAGAGGCGTGT AGAAATGAGCATGAATGTAAGATGTAAAATTGTGTGTTTATTGGGCACAC TGGAGACTTTTTGAAATTGGCGCCAATAATAAACTTTTGTTTAGCTAACA AGCCACCACAGAAAATGCATACAGAGGCTTTTAAGTGATTAGAATTGTGA TTCTAAGCACAATTTCTTTAACAATTTCTGATACATTTACATCAATTACA TTTGGAACATTTAATTAAACTCATATTTGGGTTAAATTAAATAGGAAAAG CTAGGTTATTTACGGATTACGTACAGCGAATCAAATTTTTCAAAATTAAA GTACGAGTTCAAAAGTGTTGCTAGTTACGAAGTGAAAAGATACGGGAACC GTATCTCTTCTTGTTGGCGAAAACCAAGGAGTAGATTGTTGATATTTAGG TATTAATAACAGAGGGCAGGACTTTTCTAGATGATTTTAATGCAGAGTCT AGTTTATCAGAATAGAATTGTAAGCAACTATTTCAATTTTTAATTCTGGT TCACATACAATTAAAAAAAACTTAGTAACTATAGGTGCATATATACAAGA CTTCCTTTCTTATCTGCGCATGATGCCGCCAAAGGATTCAAAGCAGCTCC CGGAAAACCTTCAACCCTGATTGGAGCCCTTGGGGTCAGCTGGTCACACT GGGCAACGGGAGTAATCTGCGGGAGCACAGGCTCCAATTTTGATGCCAAA GGAATGTGCTCGGCGAAAAACAAAAAGGCAAACAAGAATCGCACATTCGT CGGGAAAACTGCAGTCAATGTCTGGGCCATAAAATGTGCAATTAAGCCGC AATAGATGGTAAAGTTCAAGTGAAATAAAGAAGGAATTACATGGAAAAAA CGGCCATCAAAGCCAACAAAAATCTTCTGGCTTAAATAGCATGTGTGTGT GTGTGTTTGTGTGAGTGCGTAGTGAAATTAGTGGTGCTGTGGGTGTGCGC GAGTTACCACCCCACCCCCTAAACCCCCACGCCTCTAAACAAATCATCGG ACACTCAACCGGGAAGACGGCAACTGGAACACCGCATCCGGCCGAATGCT GACATTCCGGCCGAATGCTGACATTACACAAAAGTCGCACTGCAACATTG TCCCCAGCTAGCCAGCCACATGCCGAGTCGGCATGTTCATTATGCTTACA ATTAAGAACCTATGTACTTATGTATAAGACGAAAACGGAGGACTCGAGTA GCCACTCTCTGACAATAAACTTCATACTGATTTTGAACTTCAAGAAAGTC AGTCGTATTCTTTATTGGAAATCTTCACACTACAACTATCTGCTGAAACT TAAAAACCTTCATACATTTACACATCATATCTTCACAAAAGGCTCCACCC TCGATCACGGACTTAACTGGCGCAGCCGGTAGGATGTCCTACCTATTAAT AATTACCTACCTGTAAGTAAACATGTAAGAAACGAAACAAACTATATGCA AGATGTCGACTGAAAGTGACTAGGAACAAATTTTTATAAAACAAAATTGA AGTTGTGAAGTACCAAATGAAACTCAAACATATATTCAAACACAGGAAAA AAAAAGAGAGAGGAAAAATGTAAAATAAATAAATATACAAAAAAAAAGTG CAAGTGTACCGTACTGCCGCGCTGACGTGGAATCTATCGCTGATCATCAC GCCATCGGTATGTCCATACTCTGCCGAACGTCATAATTTTTTTTAAAAAG TGCAAGTGTACCGTACTGCCGCACTGACGTGGAATCTATCGCTGATCATC ACGCCATCGGTATGTCCATACTCTGCCGAACGTCATAATTTTTATAAAAA AGTGCAAGTGTACCGTACTGCCGCGCTGACGTGGAATCTATCGCTGATCA TCACGCCATCGGTATGTCCATACTCTGCCAAACGTCATAATTTTTATAAA AAAGTGCAAGTGTACCGTACTGCCGCGCTGACGTGGAATCTATCGCTGAT CATCACGCCATCGGTATGTCCATACTCTGCCAAACGTCATAATTTTTATA AAAAAAGTGCAAGTGTACCGTACTGCTGCGCTGACGTGGAATCTATCGCT GATCACCACGCCATCGGTATGTCCATACTCTGCCAAACGTCATAAGTTTT TATAAAAAAAAAAGAGTGCAAGTGTACCGTACTGCCGCGCTGACGTGGAA TCTATCGCTGATCATCACGTCATCGGCACTTACATACGCTGGCCAACGCA TCGCCAAAGCCTCTATATACACTTATATATGTGAGCATACAATATCAACT ACAATCCAATACATCCACGTACTGTACCGCCTCGTTGGCATGGAATCAAA CGCTGATCACCATGCCACCGTGGTAAACAAACAAAGCACCAAAGCCTCTC TAATACATTGTACACTCAAAACGCACACTGCCATACGTCGGCGAAAAATC AAAACATAAGCAAAAATCATTTCAAACCAAGCGAGGCTCATTCTGCGTAC CACAACGACAACGACACTGCATGTGTAGTGGCGCACCCATGTCTGGGTAG CCGAGGTAAGGGGAAAACGCTTGAGTATCGTCAAGTGTTCTTGCCTTTCA CTCTTCTACAATGGGTTGCTACGCTCATGTATTGCACATTCAAAATAACC AAAACAAATGTACTAAAGAAGTCGACATATACAGATATATTTTGTTTCCT TTCATTGTGTAATTTTGTATATCAAACAAATACTAATACCAATCACATTG CAGAATATAAAAGGGAAAATATAAAGCCAAAGACAGACACCCATACACTC TAGTAAACAAGAAATTTGTTCATTATTTTTCAATCATACATAATATACTA AGTAACCTCAAATTTAATGTCAAAAAAGTTCGTTTACAACCTTAGGAAAA CTACACGTTCAGTTGTTGGAGTTCCACCAAACACTAATAGGCCCCCACAT CCCGTTAGACGTCCTGACTCCCTTCTCCCGATTTCGGAAGAACCCAAATC AATATCTTCCCAAACCCCCAATATGGACTCGGGAAACGATTCTGCCCGCC CCACTCCATCCCCTCTGGCGCCCACTGTCAGTGGTATTAGCTCCTTAATT TCAACTACGTTCAAGCCTAAAGATATCATGGCATTTGTTGAGCATTTGCC AACCTTTGATGGTACACCTCGTCTATTGGACAGGTTTATCACTAGCGTAG AAGAAATCCTGATGCTCATCAGGGGAGCTGACCAAACACCGTATGGCCTG CTTACTCTGAGGACCATCAGGAACAAAATCATTGATAGGGCCGACGAAGC CTTGGAACTGGCAAATACCCCCTTGGTTTGGGATGAGATTAAAAGCAATC TCATCCGCCTCTACTCGAGCAAGAAAAGCGAGGCCAACTTGTTAAGCGAG CTTAACACATTTTCGGACAACCTGACCTTGGGCCAACTGTTCTTTGGTAT ATCAAAGGTGAGAAGCCAACTCTTCTCCATACTCAAAAACAGCGAACACA ACAACACTGTTGTAGATGCAAAAAAGGTTGTCTACAACGAGGTTTGTCTC AATGCTTTTATGACTGGTTTGAAGGAACCTCTCAAGACTTTCGTCAGGAT AAAGTCCCCTTCTACACTTGAACAGGCGTACGAGCAATGCCAAATAGAGC AGACCTTATATAGGGCACAAAACAAGCGAACCAACAGACCAGAGCAGGGA CCCAATGGATCAGACAATAAAACCTACCGAAATAGCTACGACAGCAATTA CCGCAGCGGACGTAACGACCGAAATGACCGTAGGGGACCCTACTCTAACT CTAACTCTAACTCTAACTCTGGCCAAAATAGACCATTTAATTCACACAAT CGCACACCCCAATCCGGCACCAAGGACAACCGGGCCAATACATCAAACCC CTTTCGAGCACCTTCACATAGTTTGAATAATATAGAGGAGAACCCTCAAC CTGATTCGAATTTTCAGCAAACGGCCTCGGGAAACCAACAGGGTACATAA GCCCAGCCACGCACAACCCCTCGCTTCCTTTTATAAAAATCAAACTATCC CAGACAAACCCCCTGAAGTTTTTAATTGACACAGGCTCTACACACTCCTT CATCGACCCAAAATATGTCGACCCTAGGAACTGTGTGACCTTAGATACGC CCATAACACTCAAAACAGCCCTGAACAGTTTTAAAATATATCAAAACGTC TCTATACCATTTCCACCGGAATTCCAAATCACGGGCAAAATGACCCTTCT ACCTTTCAAGTTCCACTCTTATTTTGACGGATTGATAGGAATGGACTTAT TATCTTACCTAAAAACAGAAATAGATTTACTTAACCTAAATCTAAAAACC CCAAGTACCATTATACCCTTATGGACCCACAGTAACTCAACTTCAAACGT ATTTAATATCTCTGGACATACGAAAACTATTTTGCCACTACCAGTGGAAA CCAAACAGGGCGACTTCTACATCGATTCAATTACAATCAATGATGACTTA ATAATATCAGACGGGATTTATAATGCCCAAAACAATATTGCTAATTTCGT TATCACAAACTATAGCGAGAGGGATCAGTTATTGTACCTCGAGAGCCCGA TAAAAGGCATGCCATACTCCACGGCCAACAATGTTGAACTTTTCAGTATC ACTTCAGACACCCCACAGCCCCAAAACTCCGCAGCGTCGTTACAAGCCCT TGGCGTCGATCACCTCTCCTCTGAAGAGAAACAAAGCCTACTTTCACTTT GCAAAAGTTATCTAGATATCTTCTACAATGAAGACAAATCATTGACCTTC ACCAACAAGATTACACACACGATTAAAACCACGGACGACACCCCCATTCA TACAAAATCTTATAGATATCCTTACATTCATAAAGAGGAGGTCAAAAAAC AAATAGAGGCAATGTTAAATCAGGACATTATCAAATCCAGTTATTCCCCG TGGAGCGCCCCCGTCTGGGTCGTCCCAAAGAAAATCACTCCTACGGGAGA GCAAAAATGGCGTCTAGTTATCGATTATAGAAAACTCAACGAGAAGACTA TATCCGATAGATATCCAATACCTAACATCGCGGATATCTTAGACAGATTG GGCAAAGCCAAATATTTCTCCACACTTGATCTGGCAAGTGGATTCCATCA GATAGAAATGAATCCCGACGACACACCCAAAACTGCATTTACAGTAGAGG GGGGCCACTACGAGTTCATTAGAATGCCGTTTGGCCTCAAAAATGCCCCA GCCACATTCCAAAGGGTGATGGACAATATTTTTGGAGACCTTATCGGAAC TATCTGCCTAGTTTACCTAGATGATATAATAATTTTCTCAACCTCCTTAC AAGAACACTTCATACACTTGAAAACTATTTTTGGAAGACTCAGATCTGCC AACTTTAAAGTCCAACTCACAAAATCCTACTTCCTCAGGCGGGAGACAGA ATTCCTTGGCCACATCGTTTCACAAGAAGGTGTTAGGCCAAATCCCAATA AGATCGAAGCTATAAAAAACTTTCCATGTCCCCACAGTAAAAAGTCAATT AAGTCTTTCCTAGGCTTGTTGGGATATTACAGAAAATTTATCAGAGATTT TGCGAGACTTACCCAACCCATGACACAAAAATTAAGGGGAAACAATAAAT CGATCATAATAGATGATGAATTCAAAAAGGCCTTTGAATATTGCAAAACC TTACTGTCTAACGACCCAATCCTCCAATACCCGGACTTTACAAAACCTTT CACACTAACCACGGACGCAAGTAATTTCGCAATAGGAGCTGTCCTATCCC AAGGTCCGGTGCATAGTGATAGGCCCGTATGTTTTGCTAGTAGAACCTTG TCGGCTGCGGAAACAAATTATTCCACAATTGAGAAGGAAATGCTGGCCAT TATATGGGCGGTCCAATACTTCAGACCCTACCTCTTTGGCAGGAGATTCA CTATAATCACCGATCACAAACCACTAACTTGGTTAATGAATTTCAAACAA CCAAATTCTAAAATAGTTAGGTGGAGACTCCAGCTTCAGGAGTACGATTT CGAAGTCGTCTACAAGAAAGGCTCTCAAAATGTAATTGCTGATGCTCTCA GTAGACCAGAGGCCTCTGTCAACCATAACGAAGCCCTATCAATTCCTCAA AATGTTTGCCCCATCTCAGAGAAACCCCTTAATGATTTTAATATTCAGCT CCTGTTCAAAATAACCCCAGATACAAATAACGCCACACTGACCCCGTTTA AACACAAACTTAGGAGGGAATTCTGTAAACCCAATTTTCAGTATGACGAC GTAGTTTGCATTCTTAGGCAGTCGTTAAAACCAAACAAGACATGCGCGGT ATTTGCCCCCGACCACATTTTTCAAATGGTGGAACAAGCCTACCAAACCT ACTTCTCAGCCCACAGTCAATTTAAACTCATTAGATGTTTGATCTTCCTC CCCGAAATTACTGATAGTACGGAGATCGAAAAAATTATAACCGACTATCA CTATAATAGTAACCATCGAGGGATCGATGAAACATATTTACACATAAAAC GACAACAGTTCTTCCCACATATGAAGGAGAGAATAACTCAGTTAATTCGA AAATGTGAAACATGTTTAAAATTAAAATACGACAGACAACCTCAAAAGAT CACTTACCAAATATCCGAACTACCTTCAAAACCGTTGGACATCTTACATA TAGACATTTATACTATTAACAAAAATTATAACCTTACTATTATCGATAAA TTTTCTAAATTTGCGGCTGCCTACCCTATAACTAATAGGAATTGCATTAA CGTAGTTAAAGCCTTAAAACATTTCATTTCCCAATTTGGTATTCCCAAAA AGCTGATCTATGATCAGGGAGCAGAATTCGCTAGCGATATGTTCAATAAG TTCTGCACTCAATTTAACATTGACCTACACGTTACGTCCTTTCAACAATC CTCTAGTAACTCTCCCGTTGAACGGCTTCACTCGACACTAACTGAGATTT ACAGAATAATACTTGACGTCAGGAAACAACAGAAACTCAGTAGCGAGCAT GACGAGATAATGTCCGAAACCCTAATCACATATAATAACGCTATTCATTC TGCAACTAAACATACCCCCTTTGAACTATTTAACGGACGTACTCATATAT TCAACCAAACAATCCAGTTCAATAACGAACACGACTACTTAACGAAATTA AATGAATTTCGCGAGAAGTTGTACCCCCTCATCACGGACAAACTTTCAAA TGACGTAGTTAGGAGAACCCTAAAATTAAATGAAACCCGAACAGACCCCG TAGACCTACAACCAGACACTTTAGTCCTTAGGAAGGAAAACAGACGTAAT AAGATTACACCCAGGTTTTCGATTCACAAAGTCAAACACGACAAAGGTCA TACATTGATAACTGCTAGGAATCAAAAACTACACAAATCAAAAATTCGAA AAACAGTTTTGAAAAAAGACAAAAGCAACAACGTACCCAACACTGATAAT AACTGACCCCACTACCTCTTAACTTACCATTTCAGGTTCACCCTTGTGCC AACTCAGGCTATCCATGTCCATTATTTAAATGATAACGCCCCTATAGCCA AGATAGAACTAGGGAAAGCCTTACTAATTGAGAGGTACAAAATAATTAGT CATGTAATCAACCTACAAGACTACAGCAGATGTATGGAACAATTCCATCT GACCATTAATAAATTTAACCCCGATTCCACGTTGACGGACTCCGTCACAA TTTTAAAAACCAAATTAACCCAAGCCCAAGTAAAGCTCAAAGCCCTTACA CCTTCATATAGAAACAAACGGGGTTTGATTAACGGATTGGGGAGTCTAGT AAAGGTGGTTACCGGCAACATGGATGCCAACGACAATAAAGAAATACATG AAGAACTTGACAATATAAAGAAAAATTCCGAAGTCAGTAACGACAATCTC CAAAAACAAGTAATGTTTAACAACGAAATACTTATCCGGTTCGAAAATAT CACGGACCATATAAATAATGAACAAATTTTGATAAGTAAATTCTTTGATA CCTCACAAAACAAAATATACAAACACTTAAACTTACAAGATACCCTTCTG GAAGAAATACAATATTTAAATAGGATTAATTATAACATAGAATTATTCAT TAACCACCTAAACGACATAACAGAAAGTATGCTATTGGCGAAAATAAATA TAATTCCCAAGTTCATCCTAAATGAACAAGAAATGGATAAAATAAAAACA ATACTGGAAAAACAAAATATCACAGTCAAAAATGAACAAAGTATATACAA TTTCCTACAAATGAATACACTAAATTACGAACAAAAGATTATTTTTAATA TCAAAGTCCCAATTTTTAAACAACCTTTTCATACCCTCGCCAGACTAGTT CCATTACCAATAAATAACACATATTTTGTAATAACCCCAAATTACCTAGC TTATAATATTAATAATAAGAAATTTCATATGACCCGTAAATGCCCCAAAC TGGATAATACATTCTTGTGCGACGAGAACTTCTACGTTGATACACCACAG AACAACACATGCCTGGAACACCTTTTGAACGGAGAAAACAGTTCCTGCGA TGTACGGGAAACCGGCCCCATCACCGACGTGTTCGAGGCAGAGAGAGGTT ACATCTTCGCATTCAACGTGAACAAACTGAAGGTATCCCTAACAAACGGC TCCGAGCTCTCAATAATGGGGTCAGCCATCATCAGATACATTAACGAAAC AATACAGATTAACGGTATCGATTACGACGGCACGGTTGACACGTTCCCTG AACAGACGGATTTTGATCTTCCCCCCATGCGAAAAGTAACTAGGAATACC ACTATTACGGTACTAAGCCTAGAAAAACTGCACCTCGAAGCCACCCAAAC AATGGATAAAATCCTGGCCGTCCATCACAATACTATACAGCACACCTGGA CACTCTACACTCTGCTCGGATTGGTAACGTTCCTAGCAGTCATCTTATGG CTGCACCGACGAACGAAACACATCGTCCACATCCACGAGGATCATCACGT ACCAATCTACGCGTCATCCATACCTTCGCTATGGCCGTCACTTCGAACTG GGGGGGGAGGAGTTACCACCCCACCCCCTAAACCCCCACGCCTCTAAACA AATCATCGGACACTCAACCGGGAAGACGGCAACTGGAACACCGCATCCGG CCGAATGCTGACATTCCGGCCGAATGCTGACATTACACAAAAGTCGCACT GCAACATTGTCCCCAGCTAGCCAGCCACATGCCGAGTCGGCATGTTCATT ATGCTTACAATTAAGAACCTATGTACTTATGTATAAGACGAAAACGGAGG ACTCGAGTAGCCACTCTCTGACAATAAACTTCATACTGATTTTGAACTTC AAGAAAGTCAGTCGTATTCTTTATTGGAAATCTTCACACTACAACTATCT GCTGAAACTTAAAAACCTTCATACATTTACACATCATATCTTCACAAAAG GCTCCACCCTCGATCACGGACTTAACTCGCGCACAACAAAATATAAATAA AACTCCAATGTCACCGAGTCGAGTTGATAAAAAGCATCGCTAAAGGCCTT TTAATTGCCGCTGCAGTCGATAAATCATCAAACGGGAATATGAAAGCATC TCAGGAATTCAGTGCGTAAAATTAGAATGCAACAACAACAGCAGTAGCAG CAGCAACAACAACAACACGCGGGCGGAGGCAGGAAAGATACAAAATAGCC AAGGAGCCAATATACATACATATACATGTACATATACATCCACGTCGTAA AGTGCGTCTCTCTCTTGCACTCTCTCTCTCTCTCTGTGTTAGAGCTCCAT CTCCCTCTCCCCACAGCCACCTACTTCCTGCACATATGCTGCGAGCAACA ACAACACAACGTGCTCCTCTTGGGGATGCTGTGTGCGAGCGAGAAAGAGA GAAAGCCAGAGAGAACGGCAGAGTAACTTCGAATCAAAGAGCGCAACTAC ACTCGTAAAAATTATTACAGCTGCCAAGTTAAAAGCTATTACATCGTAAT AATGTTGTTGTGGAATTTTTTTAAAACAAATATAACTTTTTATAAATACG TTACATTTGAATAAGATATAATTACGAGAAGGTTAGGGAATATATTGTTA TTTAATGTTTTTACAATAGATTTGCGTTTTACTCTATTACTATTACTCTA ACCAAACTAAAAAAAAGTTATAGGAATCTTTAATGAAATTCCTTTATTCC TTTTGTTTGAGTTGACTGATAACTGAATTTCCACCCTAAATTTTTGCGTT ATCGTTTTCCCGTTTAGGGCATCCATTTCTCTGAGTGCAGGGCTCAGTCA TCGCAGCCTTTTCGCCTTGGCCACGAACACACGTCTCATTTGAACGCGAA ACGCCGAGTCAAACGGACGCAGTCGCTCGTCGCAGTGGTTGTTAAACTCG AGTTTCGTACTTTCGAGCGCGCGTATTGAAACATAAGTGAGCGATCGTGT GAACAGTGATATAAAGTGCACCGTGTATGCGGGATAGAGATACCTAACCT AGTGCCACACGAAAGTTGAAGTAATACCAGCAGGATATCTACTCAGTTGG CAGTGAAAAGCGTGGTGAAGTGTTCGGTCATAATGAGTGTGTGAGCGGGG ACAAGCTGACAAACTGAATGCGATAAGGTTACAGATGTCCTAAACACACA GGCACTGGCACACAAGGATTCCCGGGGTCCTGGTGACATGTAACTGGATC CGGATCTGGATACATGTTGGCTCCTAAGACAACAGCCCGCTCCTTTGCCT ATCGTCTGGCCGCACTGCAGAAACGGGAGCAACAAAAGCGAGACACCGGG TAAGTAGCGATGCTTAACTATAATAAGAAACCTGTCCCCTCGGACAGGAT AAAAACAAGCCGCACACACAGTAGCACATGCGGACAAAGGGGCGCACTGC AGTGGTCGTCCGATGCTTCCTGCGCCGCTAAGTATGCCACTGCAATGCTA TTTTAAGGTGCAAAGTGCATTGAGTAGGAGGAGGCAAAGTGCCAGCCAGC TAGCCCTAACCCACACACACACTTCGCATAGACACACATGGGCAGTGGAC TACGGCGACAACACACAAAACGTATTCAAGTGTAACTAAAGACGACCAAT TCACAAACAAACAAGCGCGCCAGGAGCAGTTGGCGGATGTGTGGGAGGGA GGGAGTTGGGGGAAACGGAACCGACTGAAGCGGAGCGGAGCGGTCGACCC TCGAACCGTGTGACCGCGGGGCAGGAGGGGGCGGGGTTCTGAAGGGACGA CAGGGGCCGCTCGCTAATGTTTATTATGAAAAGCGTGCCCTTTTGAACGC CATCGTGTATTTTTATTTTTATTTGTATTTTATGATTGCGCTTAGCCATG TGTATTTGCTGTGAGTGGAACTGTGGTGAGCGCTAGTGCACAGGAAGAAA AAGATATAGACTTGGTTTTTTATTTGAGGTTAAAGGGAGATCCCATTTCA AAGCAAAGGAAAACAATTCTATTGAAGGTTTCGATTAGGAGACGTTTCGT TTTTTGAAATCTGAACTCTACACTGTGGAATTATTGAAGTTCATACCATG TTTGGTTTACGATCAATTAAAATGGGATACATTATACATCATGAATACTA TGTTTGGTTTACGATCAATTAAAATGGGATAGATTATACATCGTCAAATG ATAAGACAGTTTAAAACAATGATTAGTGAATCATATAATGTGTATTGAAA CCTTTTCGATTGGAATACGATTATAAAATCCATCTAAAGGCCTGGGAATA ATCCCCCGAGAGCTCTTACAAACCATTCTCGATCGATTCCGAGTACTACA TTTTCTCTCAGTATGTTTATTTATGTTTTTCTTGTCACGGAGCTGGATCA GAGGGGGTGAAGGGGCGGCTGTCGAGAGGCCCTCATGTGAGTGCAGCACT CAATTCATTGATAAAAGATGCAGCTACAATTATAATAATAATAATAAGAA CTCCGGCCAACGGGATGCCGCCGCGATCAACATGCCGCAATTACAGTTAT AATTTGGGCCCGTAAGCGTTGTTCAAATGTAAATTCAAATGTGGATGAAT TGCAATTACCAACCCTCCGCGGCGACAAACGTTGGCTGCTTCGCTGAGTG GGGGTAACAAACAATCGCCAATTGGCATATAATGATCCCCTTTGGACGTC GAAACGTCCTAACTGACTGACTGACGTACCAACTGGCTGACTGACTGACT GACAGTCGGACGATATACATACGAGTATATGCGCCATGAGGTGGGTATGG TAAAAAGTGGCATGGGACTCAGACAACCAGCAGCGACATTCGGAACAATT CTCAGGCCTTGACAAATGCACGTAATGATTGGACTCACACTTTGGTTTCT GCTTTTTTAACAATTTACGCGCAGCTCTTACTCTTACCCCTTCTTCGCTG GTTCTCACACTCACTCGGCCTAGTCATAATTTTAGGGGTTGTGCAACCCG GCACAGTAATCGAAACTCAAACCCAAAAACTCGTAGATACAGATACAGCT GTTCGCCTTGATGGGCAAACAAGGGCTTGGAGGTAGACCTCCGCCCTTCG ACTTTCGATTTTTCGGGACATGGGAACGGAACGTTGCATGAACATCTTAG ACTCCTGCGGTGATTAATTGTCATTCCAGGGCCCTACAGCATATGTAGAG GCCACTCGGGCTCCTATGTATATGCGTTATGTAGGATCCAGGGTTCAGGG TCTTAACACTGGATTAGATGTCGATCGAAGTGAAAGAATAGGCTCTTTTC AGTTTCTTTCGGCAACTGGCTTTGTTCCGAGCCTAGGTAGCTGATGTTGG TAAGGGCTTAGCGTCGTAAATCGTTGGATTGAACCATTCCGATCGATGGC GGAGAGAATCGGTAGGGCATTAACATGCCTAGGTAGTAGAACTTTCTATA CGCCAGACTCTTATCATTGCATCTTCGACATGCGTAGGCAATACGTTTGC TTTCCATTTTTCTCTGGCTATCATCAGCTGGCATCATGTGGCAGTAGTTT TGGCAACATAAATTAGGCCACGGGCATCATTTGTTACAACCGGACACATT AGAACTTTGCTAATACGATACAAATGATAAGGGCCTTTCATCAGTTGTTC AGTTTGTGCTACTTATGCCGCTGATGGGATAGAATCATAAATAATTTGTT TATTGCATGCAGAGGGGGTCACAAGTATGCTGGCTACGATTGTATCTTGT GTATGCTGTGT