##gff-version 3 ##date Tue Nov 28 10:58:53 CET 2023 ## exported from the transgeneomics system molecule_59050424 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59050424 mpicbg region 9631 28483 . + . Name=dmel-5.43-3R;type=genome;start=12261747;end=12280599;strand=- molecule_59050424 mpicbg region 28484 28556 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59050424 mpicbg region 28557 29545 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59050424 mpicbg region 29546 45184 . + . Name=dmel-5.43-3R;type=genome;start=12246108;end=12261746;strand=- molecule_59050424 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59050424 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59050424 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59050424 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59050424 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59050424 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59050424 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59050424 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59050424 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59050424 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59050424 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59050424 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59050424 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59050424 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59050424 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59050424 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59050424 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59050424 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59050424 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59050424 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59050424 coding_transcript gene 10680 19501 . + . identifier=FBgn0044826;alias=anon-WO0118547.285;alias=PAK3;alias=PaK3;id=51107348;alias=DPAK3;alias=DmPAK3;alias=Pak3;alias=CG14895;alias=dPAK3;ensembl=FBgn0044826;alias=DPak3;alias=D-Pak3;Name=Pak3;alias=pak3 molecule_59050424 coding_transcript gene 19704 21264 . - . id=51352589;ensembl=FBgn0038429;identifier=FBgn0038429;alias=BcDNA:SD10961;Name=CG14882 molecule_59050424 coding_transcript gene 21501 22502 . + . ensembl=FBgn0038428;identifier=FBgn0038428;Name=CG14894;id=51352808 molecule_59050424 coding_transcript gene 22848 27628 . + . id=51353538;Name=ema;identifier=FBgn0038427;alias=endosomal maturation defective;alias=CG12753;ensembl=FBgn0038427 molecule_59050424 coding_transcript gene 27915 28463 . + . ensembl=FBgn0038426;Name=mRpS33;alias=MRP-S33;alias=CG10406;id=51353683;identifier=FBgn0038426;alias=mitochondrial ribosomal protein S33 molecule_59050424 coding_transcript gene 28442 30645 . - . id=51475363;Name=CG14881;identifier=FBgn0038425;ensembl=FBgn0038425 molecule_59050424 coding_transcript mrna 28442 30645 . - . id=51475368;parent=51475363;Name=FBtr0083287 molecule_59050424 coding_transcript mrna 28442 30645 . - . Name=FBtr0083288;id=51475398;parent=51475363 molecule_59050424 coding_transcript exon 28442 30214 . - . parent=51475398 molecule_59050424 coding_transcript exon 28442 29914 . - . parent=51475368 molecule_59050424 coding_transcript three_prime_utr 28442 29876 . - . parent=51475398 molecule_59050424 coding_transcript three_prime_utr 28442 28480 . - . parent=51475368 molecule_59050424 coding_transcript cds 28481 29914 . - . parent=51475368 molecule_59050424 CLC misc_recomb 28557 28590 . - . Name=FRT molecule_59050424 CLC cds 28598 28669 . - . Name=BLRP molecule_59050424 CLC cds 28670 28690 . - . Name=TEV molecule_59050424 CLC cds 28691 28714 . - . Name=Precision cut site molecule_59050424 CLC cds 28715 28756 . - . Name=V5 molecule_59050424 CLC cds 28763 29479 . - . Name=SGFP molecule_59050424 CLC cds 29486 29545 . - . Name=2xTY1 molecule_59050424 coding_transcript cds 29877 30214 . - . parent=51475398 molecule_59050424 coding_transcript intron 29915 30002 . - . parent=51475368 molecule_59050424 coding_transcript exon 30003 30214 . - . parent=51475368 molecule_59050424 coding_transcript cds 30003 30214 . - . parent=51475368 molecule_59050424 coding_transcript intron 30215 30268 . - . parent=51475368 molecule_59050424 coding_transcript intron 30215 30268 . - . parent=51475398 molecule_59050424 coding_transcript exon 30269 30436 . - . parent=51475368 molecule_59050424 coding_transcript cds 30269 30436 . - . parent=51475368 molecule_59050424 coding_transcript exon 30269 30436 . - . parent=51475398 molecule_59050424 coding_transcript cds 30269 30436 . - . parent=51475398 molecule_59050424 coding_transcript intron 30437 30496 . - . parent=51475368 molecule_59050424 coding_transcript intron 30437 30496 . - . parent=51475398 molecule_59050424 coding_transcript exon 30497 30645 . - . parent=51475368 molecule_59050424 coding_transcript exon 30497 30645 . - . parent=51475398 molecule_59050424 coding_transcript cds 30497 30605 . - . parent=51475368 molecule_59050424 coding_transcript cds 30497 30605 . - . parent=51475398 molecule_59050424 coding_transcript five_prime_utr 30606 30645 . - . parent=51475368 molecule_59050424 coding_transcript five_prime_utr 30606 30645 . - . parent=51475398 molecule_59050424 coding_transcript gene 30830 32589 . - . ensembl=FBgn0038424;identifier=FBgn0038424;Name=CG17565;id=51236681;alias=farnesyl transferase beta molecule_59050424 coding_transcript gene 32673 34889 . - . Name=CG31279;id=50996357;identifier=FBgn0051279;ensembl=FBgn0051279 ##FASTA >molecule_59050424 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACACAGTGCCGCCCGAGGTACG CATGATGCTGCCCTGGCGGAGTGTGAATTCCCGCGGCTGCTGCTCATGCC CGTCGATGCAATGAGCGGCCGTAATGGCCCAGTTGCTGGAGAGAATCGAG GCGCCGCAGATGTGTACCGTTTGGCGGCGCAGCGAGAGTTGGTATGGAAA CTGGCCTTCGGTGGCTTCGCGTCCGTTCACAATCCGACTGTCCGGCTGCC GAGGGACGGCAGCCTCTGTGCGGGATGCTTCCAGGATCACAAGGATCCCA GCTATGAGAAGAAACGGAATTGGAGCTCGGCACTTTTGCATGACGCTGCG AACGAGTGGAAACTAACCAGCATTGGGAATCCGTAAGTCGATATATTCAA TGGCGCTTTATCAATCACGGACGTTATCTAGTGGGGTACACGATTTCTGA AGAAGCTGCTCCGTTGCCCGTAATTAGCCATTGTCGCTTGGGTTTTTTTG TTGCCTATCTGCCAGATTCTCTGATTTTATTACTGTTTACAGCGGTGACG ATGGCAATGAACTTCCGCAAGAGCATCGGGGAAATGCAGAAATGGTTAAA CCATTTTGATAAAAAAAGGTAGTTTTTATCTTTTTAAAAAATCGATTCTT ATGGGAAGATCAGAAGATATATATATATAGATATCACAAGATCACAAGAT ATGAGGTTTAAAATACCCAAATATAAATGAATGTAAGATGGATGTTTAAA TGTTCTTTTATTTAACTGAGTTCTATTAATTACCGGATTCGGATTTTTGA AGAATTGGAAACCTATATATACTAAAACTAGTTGAGGGTCTATAAATACT TAAAATTATAAGAAACTTTTGTTAGTCAATACTAAAAGGCATTTATCCAG TAGCATGGCCGTTTAGAATAATATTTATATTATTTTATAAAAAATTATTT GTAATATTTTTAAAGTGTTCCGACTCAAAATTGTTGGAAAAAATACTGAA CCACTTGACCAGCATCGATAGTCCTATAAAAGTGTCGATGTTTCGATAAA AGGCCACACAGTGGAATACTCGCCCAACTTAGCTGCGGTCACACTTAGTC TGCAATTTTCAAGAATTACACACGCGCGGATGTTTTTCGGTTCATCCTAA GAAACATAAAATTGCAACGCAAAGAGCAGCTTAAAATCGCGAATTAACCT TTAGGCTTAATAGTAAAAATAAAGAGTGTACATCGTACACAATTCGCATT TGTCGGCACAATTGGTGCGAGTGCGACAACAATAGCAGGCCGAGTGCAGC AGTGCGATTGCAGCAAAGCGAAGGGAAAAACCAAAGAAGTTATTAATTTC GGAGTGTTGCTCTGAAAGCGGCTTAGATATACCCAAATCAACAATATACT TCCGTATAGTTATGGAAGCCTGGAAGGGCTAACAAAAAACTATACGGGAA GGCAGTTTTCGGCCCGCGTAAGAACAGCAACAACAACAGACACTGGAAGA ACAAGACTGCGACGGCCACTCCTTTTGTGTCCGACTTCGAGATGTGTGCG TGTTCGTGTCCGCGTCCGCCTTTGTGTGTTGAGCAATTGAAAACTGGTGA TTGCTGAATAAATTAAGGTAGCTAAATTAATAATTAGCAAAGCGAGTGGG GCCAATAAAAAGTGAAAATCTTCTGCGTTTTCGTAAAGCGAAAGAAACTA CAGCTACAGTTAGAGATAAGAAGAGCTCTCGCACACATACACAAAGCGCA GGCCGAACGAGCGAGTGTGCGTGCTTGTGCATGTGTTTATGACTCACGGC TGGTTCAGTGAGAGAGAGAAAGAGAGCGAGAGTGGTGGCTTGAGTAACAG TAACATTAACAATACCGAACGCGAAACAACAACAAATCTGCCGAGCGTTT AGAATTTCCCAAGTCGAGCGTTACTAAACGCATTGAAGAAAATCCCCCCC ACCCACACACACTCTTATACAATAAAGAGAGAGAAAGCCGCTGGAAAATG AGCTTCACCAAGTGGTTCAAGAAGAAGGGCGGAGATGGGGGATCGATCTC AGAGATCGGTGCACCCACAAACTTCCAACGGCACTTCCATGTCTCGCGCA ACCAGGAAACCGGCGACCTGGAGGGGCTTCCAGCTCCATGGGTGCGCCTA ATGAACTCACAGATCACTCGCGATGAGCAGGACAAGAATCCAGATGCTGC CTACCATGCCGTTAAGTACTACAACTATTCGATTAAGAAGAAAGAGAACG AGGTCTTCAAGCCCTTCATCACCGAAGATGTGATCCACGAGGAGTCCAAG GAGATAGAAAACTATGTCAACTACAAAAACAAGCACAAGTCTCAGGATCC CGAAAAGTCCGACGACGATGGCAGTTCGACGGCCACGGAGACGGAAAGTA GCAGCGGTTGTGGCTCCTCGGCAGGTAATAGTAACAGCAGCAGCATCAAC GACAGCAGCCAGCAGTCGACGGTGCCGCTGGACGCCCTAGAGGAGGTGTT CAAGGAGCTCAAGACCAATCTGGAGCACCGCGAAACGCTGAAGGCCGCAC CGCAAGAGCCTCCACCAGTACCGCCCAAGAAATCGCCCCACACCATACCG CCCAAACCGCAAATCAAGCCCAAACCTCGTGTCACACAGAAGTTCTCACG CACTTCGGATATACGTCGAGATGAGGACTCCGACAACCAGCACAAGATCA ACACAGACACAATCATCATCAAGCCAGCCGTAGGGGCCCAGGATGCTGGA GCGGATGATAATCCCGACGAGACGATACTGCGCCGCTCCAAGGAGAAGAG GGCCCAGAAAACCGATGCCGAAATCTACGTTGAGCTGCGGGCAATTTGCA ATTCAGATGACCCAAGGGAACGCTACAAGACCACCCAGGAGGTGGGCAAG GGAGCTTCTGGCATAGTTTTCATAGCCGCCGATTTGCAGAACGAATCGCA GGTGGCCGTCAAGACCATCGATATGAAGAACCAGTCCTCGAAGGATCTCA TACTCACAGAAATCCGAGTGCTCAAGGACTTCAACCACAAGAATCTGGTA AACTTTCTGGATGCCTACCTTCTGGAGCCCGAGGACCAACTGTGGGTAGT CATGGAGTACATGGATGGCGGCCCATTGACTGACGTCGTTACCGAGACTG TGATGAAGGAGCGCCAGATTGCCTGCGTCTGCCGCGAGACACTCTACGCT ATTAGTTTTCTGCACGCTAAGGGCATTATCCACCGGGACATCAAGTCAGA CAACGTGCTGCTGGGCATGGATGGCAGTGTTAAGGTGACGGACTTTGGGT TCTGCGCCAACATCGAGGGCGATGAGAAGCGCCAGACAATGGTGGGAACG CCGTACTGGATGGCGCCCGAAGTGGTCACGCGCAAGAAGTACGGCAAGAA GGTGGACATCTGGTCTATCGGCATCATGGCCATCGAGATGATCGAAGGCC AGCCACCCTACCTATACGAGACTCCACTCCGCGCCCTCTACCTGATCGCC GCCAACGGTCGGCCGGATATCAAGAGCTGGGATAAGCTGAGTCCCAACCT TCAAGACTTTCTCGATCGCTGTCTCCAGGTGGAGGTGGACCGAAGGGCCA CCGCCGACGAGTTGCTCAGCCATCCGTTCCTCAACGACTGCAGCGAGGTC AAGGCCCTCGTGCCCAACATCAAGGCGGCCAAGAAGGTGCTCCGACGCAA CGTATAGTTGCTATGCAATCACCGGACGGCCAGGCTGCTCTACGCGTGAT CGGAAGCGGAATCGGGTTCGGGTTCGGGATCTGCCCCGTGTGTATAATGA GTTTTCAATGTAAATTTGTTTTGTGTGGACGAAACCGGAACTGGAACTGG AATAGAATGCTGACCGTAGTCTTTGTAGTATGTACAACCGTAGAAATGGC GAAAGCAGGACTAGGACCCGGCAACTCCCCTTCGAAAACAGGTAAGTCCC AGGTAGCCCATTTGGCCAAGCTCATTATTCAAGCGAAACGATATCCATTT CAACGGAAACCTTTTCGCAATCGCACATGTGGAAACAGAGGCTGTCGGTT TATTGTCCGATGGGTTAGTTTCTCTTTGCTGTCTAAATTTTGTCAAAGAC CTAGACCCAAAACAGCGATAGTTGCCTATCTTGGGACTTTTAATCAGTAA CTCACTTCGGTTCGAACAACAGATTAAATTCGATCAAGGTTGCGAAGTGC ACGAGGCTTTTGTCTCTGATTAATTTTATTTCTTGTATACCTGGGAAAGG GAATCTTTAACGCGGTCAATTGCTTGCAACGCCCTATAGAGCAAATATGT TATGGTGCCAAGACAGCTTAATATGATTTAGAAAGTCATCCATCAGAGAA ATGGACTGGGACCAGTGGGGTTGGATTTAATCCAAAAATGATTCACTTCT ACAAACAGTTATACTTAAAACTCATGTTTTATTCAACAAATATTTAATTT TCTTCGTTTCATATGATTCAAACATGATTTGAAAAAACCAGATGATGATA ACTTAATGCGTTATTATAAAAGACACATTTTTTAGTTTTCTGGTATAGCA AAAATATTATTATTTCCTGAATTAAAAAAATTCTTTGCCATTTCCATGAA CATCTCTCCGTAATAATGAAGTTTGGGATTTTCCTACATGAGAGCACACA CCGTTACTTGGCTAGCGCTGCAATTGTTTATGTCTCATTCGTTTGGACAC CTATTACGTATAGGGTTTTTGCACAAACCATTCCATTGAAAACCGACAAT GGACAAAAAAGCAAGTAAAAGAAAGAAGCCGCTCCGGCAGTAACAACAAA CAACAACTGAGTACGCAATTTAACACGCTCGTTCGCATTTCCTGTTTGGA ATATCGCTTTGTCTGGCCAAAAAATATTCATACATCATAATAAAGAAAAC TTTAATTCAGGCACACAGACAGCGAAAACACCTACGCGCAGCGAAATGCA TTTGTATTGGCCTTATCAGGCGCGTACAACATGCTGTATAAGTGCTATTG TAATTCCCCCAGCTGTAGAGAAACCGGAGGGGAATTTATCAAATTCTTAG AACAATTTTCGTCCATTTCCAATGTGATAAGCAAAGCTAAAAAATAGATC GTGAAAGTTCTACGAGAGAGTGCGAGAAAGAGAGTGCTAGAGAGGGGGTG GCGAGAGAGCGAAAGTGGAGTCAAAGTCAAACTGAGTGTGTGTAACACAA AGAATGAGAGTGTGTATAATTGATTCTGATGGCGGTTCTTCGGCCTCTTC CTCTCTCTCTCACTCTTCTTTAGTTCTTCTGCATCTTTGGTCGCCCTCCC ACTTACTCAACTTAATTGCTTCTGTGGCAGGAGCAAACGAGAGGGGGGAT GGCGACGTCGCGACTCGGCTGCGCTATTTTTACTCTCTCCCACTCCCACT TTGGCTTGCATCTTCCCCTGCATTGTGATGCACTGGCTCTGCATTTTCCA GGGGCGGATCTGGAGGCTAGTTTTTCAGTAGGTTTAAATATTTTAATGTG GTGACAACTGAGAGTATAATTAAAAGATACTTTCAGAAGCTAAGTTTAAT TACCAAAACATTAGGGGAATATTCCTTGCAAACCACAACTAGATCCGCCC CTGGTTTCTTCTCCAACTTCTACCGGATCTCTAGGCTCTCTATTTGTTTA TATTACTGGCGCATACTTTTGCTTTCCGTTTTGCGGGAGAGTGAGGGAGA GATAGCGATGGTTCTTCTCACTTGCGGATATTGAAATCTTTAATTCTGCA AGTACTGGAAGCAGGGAGAAAGGAGGGATACGCTCAGGAATTTGCGCAAA AACTAAAACATTCTCTTCGTTTTCCATTCTGGCTTCTGGGCGTGGAACCT CGATCTTGGGGCAAAGTACAGCTGGCTACACTGAACAAATACTTGCTTAA CCTGTGAATAATCCCTGATAAAAATACTTATGAGTATCTGCAAAATATGC TTATTTAGCACATCAAATAACTATTTATTGTACCTTAGCGTTGAAAGTAT GTTTCCACTGTTATCTATTCCACATTAATAGACAAAGTAATGGTTTTTCT CTGTGCATCCAGTTGTGCGTTAGTGAGTGAAAGGGCCTCATGAATCCCCA GAGTCGTTTGAAAATGGTCTAGCGACGCCCCGAGACCCAGAAATAATGAC TAAACCACTCACATATAGTTCGATTTCGAACGGCGCCGTCGAATGATAAT TTCACCTTGCTCGAAAGGTTTTTCGGCTGTTTCCCTGCGTGTGTGAGTAA GTGTTTCGTTTACTGAACTGAACCACACACACAAGTTGTTGTTTGGTAGC TATGCGGAATTTTAGATGATTCATTCATTACTTTGCGCCAGCGACTTATT TTTCCCATCGACCGCTAAGGGGGGATGATTTAGTAAACGACCCCACCACC CCCCGCGCTGATCATGCAAACCAACAATGCAAAAGTTGTGTATTATAATG AATCCGATCCGAATCCACTGGCTTTAGTAGCATTTGCCAACGAATGTTTT GTCAGAGTCTCCAATGCCTGCGACATACTCATCCACTCACACACACGTAC TCGGTGCAAGTACACTCGCAATAAAATTATATATATTTTTGCGGAGCCAC TCACTCAGTGGATTGCAATGTAATGTTCGCAGGCAATGGTACACGATCTA CACGTGAACTTCTTTTGACCCTCTTTGCATCTGGAACACGCTCTTATTAG CTCGACAAGACAACTGACAACAGCAAGAGATTGTTGTATCACTGTTACTG AAAATATTTTTTATTTTATAATATGAAATTTCTAATACCTAAAATGTATT TTTGATCTGGGCATTAAGATTTTCTCATCTCTGGTTTCGTTAAAGGAAAA TTGTGGGGAAAACTGAAAAAGCTCGACAGTCCGTGTTTCATTGAAATCGA AGCGTGACTTTGGAGCGGGTGCCGCTTCACATGCTGATAAATATAACCAA TTATTGTGCTGATAATTGACGTGCTCCGCTCTCACATGGCATAACAATAG TTCTTTTCAGCAACAGAGATATCTGGGCGGGGAAGGCGGTCGAACAAAAC GGGCGAATGACGCCAAAAGATTATGCAGATGCCCCCCAAATATAACACAT CCAAAGGGGCGCCATAAAATGGGATTGATAATGCATTATTATTAATAATG TGCAGTTCACCTGGCCTCGAACCCCCTTACCCAAGGTCCTTTCACCTGTC GTGAGTGTAGCGATCTATTTTTAACGACTTCTTTGGCCAGCTATCAGCTG GTTATATCAAATGCGGTGATAAGGGGCCCGCCGATAAGGAAAAAGTTGTT TGATTAGCTCATTTGACTTACGCTTCCCGAACAAATTGTGTGCTCGACCT CATATTAAAAACATGGCATTTAACAATATCAAAACCATGAGCTTAACTTG CTAGTATTCACTTATATAAATGCAAATTAATGATGTTACATGAATTCATT TTGTGGGACTTATATTTATATATTCCCAACTGCAAGAACCACTTTAATGT GTTAAATTAACATACTTTGTATTCGTGGCACATTTTAGTGCAAGCATCGA AGTCTGTAATTTTCAAGTCCATTTATATATTTCAGTGCACATAATTGTAC ATTCTTGGGCCCATAAACGAATTTCAGGGTGATGACAATTATTAGAGGTC GATGTGTTAATTATTCGCTATCCCGTTCCCTGTTTGCCCCTTTGCTCTTC TGTAGTGCAGTAAACCGAGCTGAATACCTAACAACAATAAGTAATCATAG GATTTTATCTCTTCTTTTTGCAGCACGAGTCAGCGAGGACAGAGAGATGA GCAGGGGCCGAAAAACTCGAAGGAAACCGTCGCCAAACCGTGGATCCATA TCGCATCGCTCGAGCAGTTCATCGATGGCAGGGGGGCGGGGTTATCGCTT AGATTAGATTGTCCTATGGCAAATTAGCTTACTTCAACAACGCACACAAA CACGCACATATGATATACATAGATACTGTATTATTAAATGTAGGGACATA AGTTTGATTACTCTTTATATACCCGTATATATACATAATTGTGATTTAAG CGATTTTATCAAATCAGCATTATGCGACTCTTTATAAAATTCGTCGTAGT CAGTAAGTGCAAACGAACCCTAACAGAGAACATGCAATACTTGTTGTACA TTACCAAAAAACAAAAAAAAAAAATCAAAACAAAACGAAGGCGATAGATA TAGCAAGTCGAAATGAGTGTAACAAGTGCCATTAGGACTAGAGCTAGCAG CAGCAAGCGACACACAGCAAGATTATCTCCACAATTTATGCATTTCCCAT AGAATACAGATATCGATGCAACAGATAACTAATTAGAGCCAGCTAGACAG AGCTTGTATGTATATTAGCTGATATTCGCAGTGTGGACGGGATTGAGGGA TAAATGTTCGATATTCCATTTTAATTAGTACAAACGTAAGACTAACCAAA CGCCACAAAAGAACAGATTAAAGTAGATTCCCTTGTTCCTTCCTTGGAGA TATTTGCCATACGCACAAAGAAAATTGTAATTCTATACAAGCCCCTATCA CAATAGAGATGTTATTTAACGCCGTAATGTGTGTGTCAAAGCTAAAGTGA AATATTGAAATATTGTCCCTAGAAAGACTATATAGATCATATAGAAGTGG TATACGTACACTAAACCTACTCCCAACGGGAATCATAAGCAATGCCAATT GCCGAAGAGAATATATTGAAGAAGGTTTAAACTACCTATTTTTCCATTAT CCTCTCAGTTCGATATTTTATGCTATTTCCCACCACCACAAGTTCTATTC GAAAAGTATATCTGTGGGCTAGTCGCCAGACTACAGATATTTTACGAAAA CACAACGAAGGCGAATGAAAAAAGGAGTGCATTCAAGGATCTTTCGCCAG CCGGTGTTAGCTTTTTTATCTGTTATATATACACTTACCGATAGGGATTA TATTTTACTTGCAATTTTGATATTAATAGGGAAAATGGATTGCTGCTGCT GCAGATCGGTTCATAGTTAAATTTTATATACGAAATGAAATCCCAATATT TGGCCTACAATTATGCATTCATAATTTTTAAAGAGCTTAATTATTAATCG AAAATATACTTGATTTTCTTAGTTTAGCTTAAATGAGTATTAGGCAAGGC AACGAACGGATAGTATTTTGGGGCAGTAGAAACGGGGTTAGATTGCCTTT TTGGAAACCGAAACATACCCGACATTACATATTCGCAAACGCATTTAAGA CGAACGCAAAATTTGCAATTAAAAACGTAAATGTAAAATGGAACTTAAGT CTTGAAACCAAACAAAGAACAACATAAAGTAGCATAATTTTTTATACGCA ACTTTTATTGCAAATGTAAAGGGACGAATAGGAGAAAGAAGAAGCTGACA TCAATTTTGATCGATTCGTAATTATATTAGTATACACTAAAAGAATTGGC TCTATTTCAATTAAACTTAAACGTAGATAAAATACAAAATGCATATTATT GTGCAAGGTCAAAACGACTTGCCAAAATAAACGTAAACAGTATAATAAAT AAAAAGATCTAGATATTTAGAGAAGCGGAGAAACAATAACGATACATTAG CGCTTTACCAATCGGTTAAATTCAAAGAGCAAACCCTACTATACGTTTTA TGTTTTATGTGTGCACGTTTAATTTGCTTGAAACCTAAGTCGTAATCTAT ATTCTACCATTATTTAGATATATTTTGCAATTTACCACTTAAGTCAATTT TATACACAGACCCAAATCCATTTAGTACACGTAGTCGTCCCCATCCACTT CGATCATTGAAGATGGCCCTCACAATTGTATGTATTTAGTTTACCTTGCA CTGTAATTTTTATTTTGTGTTGTTAAATATATCGTTATTTACTTATTCGA CCAAAGCTTTCTGTTTTATAATTATTTACATTGAGGCTGCAGTTAAAATA ATAGCAATTGATTTACAAACATCTGAGTGCAAATACTTGCATACATTAGC TACTCAAATGAGCAGTGGAAGTGGTTCCTTTGCTACACTTATTTTCAATT ATGAAAATAAACGACCTTAACCGTACGTAAAAACAACAAACACACTAAAA ATTCAAATTTTCTGTAAGAGTTACAAACGACTAATATATTAAGGTATTTA TTTATAGGGCTTAATTAATGAAGCTTTTATTTTGACTGCACCTAAGACTT GTCCATTACAGCCAAACATCCTCGCGGTATTTGTCCTGCTTCCTCAGTTT TTTTAACAGCTGCGAAGCTTCTTCTTCAGTGAGATGCATAGCCTTCTGCA AGCAACGACTTAAAACACCTGCAATGGACTGCGAAATCTTGGCGCCATCG GCACAAATGTACAACACAGTCTCTGACTTCATCAGGAACTCGACCAGATC CTCACAGTCCTCCTCCAACATATGTTGCACGTAGCTGGGGGATTCGCCTC GCGAGTAACACATCCGTAGGCGCTCGAGCAACGAAGATTCCTGCCACTCC ATTAGTTTTTCACGCTTAAGAACTGCTTCTGGGGTCTTGGCACCAATGTA GAGCCAGGATTGCCCGCTTGGCTGTTGCGGCTGCTGTTTTATAAGCTCTT CCTTGTGGGCTAAGAATCCAAGAAAAGGCGCCAGACCTGTGCCAACAGCA ATAAGTATTTGGTTTCTGCCCACATCCCGCTCTGTGTAACGGAATAGGTT GCTCATTCGTGGGTAGATAACTACTTTTTTGGAATGCTCCGGACTGCTTT GCTGTGCAGCCGCCTCCAACATGCTGGTTGTGACTCCAGGTTTGAGGCTG AGCAGCGAGTAGATAACGCGAAGTTCGCGATTACTAGCCTCCAAGGGACT GTTGGCAATGGAGTACGGTCGCGGCAGCAGCCGTGGCAAGTGCTCTGCCA GGAATGCCAGTGGTGGCCTGCAGTTGACGCACACTTCAAGAATGTCTATG AAAAGCAGGCCTTGCTCTAATATCAGCGATTGGTAGTACTCGGTGGCCTG TTTAGAGGACAGACAGGACAGGAAACAACGCTCTTTGTCATCGCTTGTAA ATCCGGCCAGGGCGCTGAGGAGCTGCTTCTGCGGAACAAAATTAAGGGAG AGGCAGTGGGTAAGGATCTCCCGGGGAGTAGTAGTTGCTGGAATGTGGGC GGGTAGCTTAGCATTCTTATTGGCGCAGTTGAACACCAACTTTAAGTGGC AAGTGGTGTCGGCCTGGTCTAACAGTTCCAGCCGATGGAGCAGACTTTCC ACTTGTTCGAGTTTATTAGCAGGCAAAATTCCAATGGTATCCCCGGGCTG GTAATCGAACGTGGACTCCAGAGTCAGCTCCACCACGCGTTTTGTCTCTG TAGCCTTATCAGCAGACACGAGCACCTTGCTCTCCTTTATCTCCACTGAA CTTGGCTGGAAATCAGGGCGGGCGAATGGGAACTTTAAAATATCGCAGCA TTTAAGTTGGCCGCATGTTTCGGTGGGTCTCTACAAAGATAGGCTTGAAA AGGCTATTCTCACGGTAGCTCCTAACTCACCTGCTCTTCGTCCGTGAAAC ACAACTCCAGATTACCGACCAGCGGCTTGGCGGGGATGTATTCACTCAAT TTATAAGCTCCTAAGTCCATTTTTCCCGTATTTACCAATTCGCATGGGCA GCAGTCAAATCGTTAACAAGCGGTAGTGTTGGAAAGAGTTTATTTACAGC TTCCCTTATCAAGGGAAGCTGTAAAAGATTAAATGTTTATTTTAAATTGG TCTTCATCTTTGCCAAATACAACATTAAGGATTATCCTTAAATTATTTGT TTTAAAAATTATCTGTACCTAACATTTCTTAGCTTGGGAAGGTACCTAAT CAGAAACCTACCTTTGTCAACACTGTACGACATCGGTGTTATCGATATGC ACAGTTATCGTTAGCATGAGGAGCTTTATTTGTTGCTGAACAACAAACCG AAATCTCCAGTAAATTCGGTAAGGATCAATTTTAAAAAGAATGGCAGGCA ACGCCAACAGTGACGACGAATTCCATGATGCGATCGGGGAGGAGATAACC GAAAAAGAGGCCACCAGCACGCGGCAGAGCGAAAAGGACGTGGATGAGAT CGTGGAGAAGCAAAACCAGCTGGCGTTGGATGACGAAGCGGAACAGGGCG CGGCTGGTGGAGATTCCATCGCGACACCAACGACAGTGGACTCTGAGCTA ACCATTGAGGAGTTGCGCGAACGGGAGAAGGATCTCAGCCCAGAGCAGCT GACAGCTAACAAAGAAAAGGCCGATAAGCTGAAAGTTGAGGGCAACGAGT TGTTCAAAAATGACGACGCCGAAGGCGCCGCCAAGACCTACACAGAAGCC TTAGACATTTGCCCCTCGGCCAGCTCCAAGGAGCGAGCAGTTCTCTACGG AAACAGGGCTGCTGCCAAGATTAAGCTGGAGGCCAACAAAGCGGCCATCG ACGACTGCACAAAGGCTATAGAACTGTGGCCGGAGTATGTGAGGGTGCTT TTAAGGTCTTTATTTTAATATCTCCCTTAAAATTTCTAAAGTCTAATTAC ATCTTACAGGCGCGCCAAGCTCTATGAGCAAGAAGACAAGCCCGACGAGG CTCTGGAGGACTACAAAAAAGTTACTGAGATCGATCCCGGTCAGCAGGAG GCTCGCGAGGCTCAGATTCGGCTGCCGCCAATTATAAACGAGCGCAACGA GAAGCTCAAAAACGAGATGATGTCCAGCTTAAAGGACCTGGGCAACATGA TACTCAAACCGTTCGGACTGTCTACACAGAATTTCCAAATGCAACAGGAT CCCAACACGGGCTCGTATTCCATCAACTTTAAATAAAAACCTAGCTAGCT AATGCTCTGCAGATCAACAAATAAAGCCGTATTCGTGGATGATGTGTAAA ATAATAGTCAAACTGTAGCAAAACGTATCAAATTCAGTTCTCGTACATTT TCACCTCTGTAGAATATGCAAATGTGAACCCATTTTCATAACAAACGGTA CCAAAAAAATCCATTAATTATATTTAATGTAAAATGCATGGTGTGATATG CTATTAATATATGAGGTTTGTTCCAAATTTTACTGTCTGGTTTTACAAAA TTCAAACGGTTCTTTTGAGAGGTTTTTAAAAGTCGTGAACCAGTCGCAGT TCTCATGCAATCACAACAAAATAGCCACTTGTCATCTCTGTTACTTCGAT ACCGATAACCATAAATATGGGCGGAAGCAACAGCTGACTGTGACACTTGT GTTCCCCGTGAAGAAGAAGAGCAATTTGTTGGAAAAAATCGCCATTCGCA AATTACAATATTAGATTCGTGCAATCGCAGGCATTAGGTGCCCCCTTATT GTGGGCCAACCCAGTGGCGTGACCGTGAGCAGTAGTGCATGCAAAGATCC AAGAGAACAGCGCTCCCGCACTCCTCCTTACCCTGATATGAGAGCAGTCA GGCGGATCGTGGCCAGTTGATTCCATCCTAGTTGCCAACATGTTCCGGAG TCGCAGCTGGTTTGGCGGACCCTGGGGTGGGCGGCCCAAAAACCGCTTGT CGCTGGAGCACCTTAAGTACCTGTACAGCATTCTGGAGAAGAACACCACC GTGTCGGAAAGTAATCGTGGCCTGCTGGTGGAGTCGCTGCGCTGCATCGC AGAGATCCTGATTTGGGGCGACCAGCATGACTCGCTGGTGTTTGAGTGAG TATTAAGCATCTCAATGTAATAAACCTTAATCTAATTATTTGCAACAGCT TCTTCTTGGAGAAGAATATGCTATCGTATTTCCTGCACATAATGCGACAA AAGAGTGGAGGCTCGAGTTTCGTCTGCGTGCAGCTCCTTCAGACTCTCAA CATCCTCTTTGAGAACATACGCAACGAGACGTCCCTGTGTAAGTACAATT TTCAACAGTTTCTATAATACAGTAGACGTAATCATTCCTATGACGTTGCA GATTATCTGTTGAGCAACAACCATGTAAATTCTATCATGGTGCACAAGTT TGACTTCTCCGACGAGGATGTGATGGGCTATTATATACTTTTTTTAAAGA CGCTAAGTCTAAAGTTAAACACTCACACAATACACTTCTTTTACAATGAG GTTTGCATTGCCTAAAACACATATTTACATCCATTTAATGTGACATATTC CTTACAGCACACAAATGACTTTCCCTTGTATACAGAGGCTATTAAGTTCT TTAATCATCCCGAGTCAATGGTGAGAATTGCAGTGCGCACCATTTCCTTA AATGTCTACAAGGTTCAAAATCCAAGCATGTTGCGTTTTATTCGAGACAA GTACGACCTTTGCCTTCAGTCCCATGAGCTCCATTAAACTATTTTTTTCT CCCTAGAACGGCTGCTCCATATTTCAGTAATCTGGTCTGGTTTATCGGCA AACACATTCTTGAACTAGACACTTGTGTTCGCACAGATATAGAGTAAGAG TTATTGTAATATAGTCCCTCGTTTTATAGTATTGATTTCTTAATTCATCC GCAGCCATCAATCGAATCAAAAGCTGTCCAATTTGGTTGCCGAGCATCTG GATCATTTGCATTATTTGAGTGACATTCTTCTACTGGAAATCAAGGATCT GAACGCGGTGTTAACCGAGCACTTGCTGCATAAGCTATTCGTGCCTCTGT ACATATTCTCACTTACACCAGCTCCGCCCCCGCCCTCACTGGCAGTGGTT ACCCAGAATCTAGCTGCTGTGCTTAATCGCAATGTGGACATCGACATACA GGAGATGCACAATCCGCGAGTGAGCTCCATCGTGGCCCTTTTCCTGCTCT CATTGGTCTTCCTGGTGGTTTCGCATGCCCCTCTGGTGCACGCTCTGGCC TGGGTTATCCTCAATGGTGACCACAGCGTTTTTAAGGAGGGTGCAGCCGA GATTCTTAATTCATACGTTGAGCACCGCGAGGTGGTTGTGCCTGGCTTCG GCGAGCCCGACGAGAGTCTCGAACAGGCCTTGGATACAGTCACCGGTCAG TCCAGCTCGTCCAGCTATGCCCTTAGCGAGGACAGTGGCGTGGAGTCCTC ATCCCCAGCCACCACAGAACTGGACTCTCAAGCAGATGCGGTTGAAGCGG AGCAGATTAAACTGCGCAACATAACTGACGAGGAAAAGCAGCTGCTGCAG AAGTCATCTTCCTCAACGAAGGCTGACTTTGCTGAGATGGCCAAACCGTT TTTAGACACGGTCCTGCATGCTTTGGACTGCACCGAAAACGATTACCTTG CCCTGCTGTCGCTGTGCCTCATATATGCTATGTCGCACAATAGAGGTAAT ATTCATGGATATTTCCCTTAACTCAATTTGACGTTTTTTTTGGCTAATGT TGTGTAACTTTCCATTGCTCTGATCACCCCATTTTTGCTTCATTCTAATT GCTTTCTTTGTGTGTAATGAAAATGTCACATTCTGGTACATGTCCCAATC CGTTCAGATGGTATGTAACTCGTCCACTGCCCGTACTAATCAATCGTATG CATCTATCATAGTCTCCTTAATAAATATCTTTATGTACCTTTCCATATAG GCATCAAGAATGAGTGGTTCGAGCAGGTTCTTGCAAAATCAACCCGTGGC GCCTTCAGTTATAAGACAGCCTTGATTGAGCATCTGTTAAACATCATCAC CCAGTCCAGTCAGCCATGTATGTACAACTGTTCGAACTCCGGTTATCATT AGCTCTTTAATAATTCCATTTGAATTCCCTAAAGCGTCCCGCATTCGGTT GATTACCGTGGAGATTGCCTTGGAGTTACTGGTCACTTTCACCCGTCCCA GCTCGGATGATTCGCGCTGCATAACCGCCGCACAACAGGATCTGCTCTTC AGCGCCCGCAATCAGTCGATGGTGGTGATCCGTAACTTCTACAAGTCGGA GGACATCTTCCTAGACCTGTTCGAAGACGAATACAACGAGATGCGAAAGG CGCAACTGAACGTGGAATTCCTGTGCATGGACTCCACCATTCTACTGCCT CCCACGGGAACGCCACTTACTGGAATCAACTTTACGCGACGACTTCCCTG CGGGGAGGTGGAAAAGGCACGCCGAGCCATTCGCGTTTACTTCCTGCTGC GTCGCACGTGCCAAAAGTTTTTGAATGAGAAGGAATCGCTATTGCCGCTT ACAAATGTAGTCAATCTGGTTCAGGTGGAGAACGTACTCGATCTGAGTAA GTATACTCCTCCTACGATGATGTATGTATATATTAAGGCTAACCATTATC CATCTAGACAATAGTGATCTAATAGCCTGCACCGTTGTGGCCAAGGACAG CAGCAAGCAAAGACGCTTTCTGGTCATTGACGCATTGCAGCTAATTCTCG TCGAGCCGGATGCAAAGCTGCTTGGCTGGGGCGTGGCAAAGTTCGTTGGC TTTCTGCAGGACGTAGAGGTGCAGGGTGATAAGGATGACTCGCGCTGCTT GCACATCACCGTGCACCGGGGCGGAGTCACTCACAACCGCACTCCGTTGC TCTCGGCTAAGTTCCTGTTCGACGATCACATCCGTTGCATGGCTGCCAAG CAGAGGTTGACAAAGGGTCGTAGCAAGGCGCGACAAAAGAAGATGTACCA GATTGCGCAACTCATCGAGATTCCTGGACAGATGGACTCTCCCGTCTACG CTGTTGGTGGCACAATGGTCGCATCCAGTAGCGGCGGAAGTGGTAACAGC AGTGGCAGCAGTTCGCGCAGTAGTCACCACCGTCCCATGTTCTCCACGGC CAATCGAGTGCCGGGATTTGCAGCGGTGCTGCGTGGAAGCAATAGCGCTG GGGTTAGTCGAACCCAGATGGCCCCGAATCGATCCATCGAAGGGTAAGTT CACGTCGGTGTGTCCTCATGTTCCTCATTTCCATCCTCATCTGTGCGTCT TCCCGCAGAATTAGAAATGAAAGCGCTGGCCGCTCCCGACGCCGCAGTCC CAGCTCAACTTCGGGCTCGAATCTTAGGGCCGATCACTCGGATCGGGAGC GATCGCCCAGTGTTAGCATGGGCAGCCACAGCTCCTCGCAGTCTCGGGAA AACTCCCAGCCCAGAAGTACTGGAAATCGGTCGCGGGAGAGCAGCCCTAG AATGCCCAGGCCGCGGTAACAATGAAACATTTTCGTTAGCTCTGTAGTCT TAGAATGGTTTCTGTTATAATTGAGATTTGTAAAGTATTGCAGTATTCTA AACTAGTCTTTCTATTTTTTTTAATTGGATTACGCCCAAGACATCAAAAA GTTTATTTTATAATTTATCGAGCTGTTTACATGATTCTCGAAATTTGCTA CATTTTTGGCTCCTTGGCCAAAAAAAAATCTTTAAGATTGACTAAGTTTG CTTGTAATACCACCTTGTATAATTATGTATAAAGATATCGTTTGTCCTAT ATTTTTATATTTATTTGCATATTATTTTGACAAATAAACAAAGAATAGCA TGCCTTTAAGCCCTCCAGTTTTATCTGTCCTCGTTATTCTATGTGTTTGT TAATTATAAAATTTACTAATTTTCACCTAATCGAGTTATAAATAAATGTG TAATATTTTTTCATTCTAGGTCGGAGGAGATTCCTCTCGAGGACTTCCAG CACTCACGGAACAACAGTCCGCACTCTCGGGGAAACCCCTCGCCTGCCTC CCGCTCACACACACCCATCCGCGTGCTCCACTACGATCAGCTGTCCGGTC ATAGCGGCTCACCACGTGAAGCGTCCCTGGGGGGAACTAACGCCCTGCTA AGCCAGTTAAATGGGCTGAACCGTGAAGTGCTCCCAACGCAGAGCTCCGA GGAGACTTCTTTTATTGGGAGCGACGGAAACGAGGCCACTGGCGGATCGG AGGGCAGGCGACGGGGGGCCATAGAGACGGTTTAAGATAGACTAGAAGTT TTAGTATTACATTGGAAGCAGCCTTATGCTTAGATTGTTGCTAAAATTTT GTTATTCCAGTTGACTAATAAGGTGGTACATACTCTAATTCCTTTTCATT TTAAATAAAAACTAATTTGACGAATTTGAGCTCAAGTCTATATATATATT AGTAAAGAAGTATGTTTTTTGAACCTTCGATAATGGAAGCCACAAATTAT TGTTCTAAAATGTGGGTTTCTTATATTTCGCATATGTTCATTTTTATAAC AAGGTTTTACTTTTAATTTTACTGAATTGTCTATAGACGCCAGTGCTGTT TTGTAGTCAGTTTTCAAGTAAATGTTCTATAATAATCTTTAAAATAACGG TCAATACAGGTTTAAAATTTGAGGAATGTCCCTATTGTCGGCCTTTTGTG TGAATGCCAACTGCACTTGGAAATCAGCTGTCGCTTGTTTTTGTTTCGTG ACATAACCGCAATTTACTAAAACTTAGAAACTTAACTTAAATTATTTCAT GAAAAGCATAGCAAACTAATATTAACTATGTCCCACAAGTACACGGAGCT GATTAAGGTCGGCACGCAGTATGCTCGCCGGATGAACTACCTCTCAAATC GCATTTTCGGCGAAGTGGCTCGCACCACAAACGAGAAGTCCATGAAGGTA TGTTCTCGAAATAAATTTATTAATTAAAATGTAAACATGTTTTATCCGAC CTTCCCCAGGTGGTTCGCATGTTCTCGGAGGAACCAATTCACAAACGGGA CTACGTGATCAACTGGTATCCGCGGCACGTGGAGACGCACTTGCTGATGA AGAACCTTCGCGACTACGGACTGTTCCGCGATGAGCACCAGGACTTCAAG GAGGAGATGAAGCGTCTGCGCAAGCTGCGCGGCAAGGCGCCTCCCAAGAA GGGCGAGGGCAAGCGGGCCTCAAAGAAGTAGTAAAATAAATATTCTAACA TCCACTTTTATTGAACCAAAGCTAGTCTTTTTACTTGTCGTCGTCATCCT TGTAGTCAATGTCATGATCTTTATAGTCTCCATCGTGGTCTTTATAATCT GTCGACGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCCGAGGATCC GCTGCCGCCGGCGTTGCTGCGCCACTCCATCTTCTGGCTATCCAGGATCT GGCGCAGGCTGCTGGCCATGCCCTGGAAGTACAGGTTCTCGGGGCCCTGG AACAGCACCTCCAGGGTGCTATCCAGGCCCAGCAGGGGGTTGGGGATGGG CTTGCCCTCGAGCTTGTACAGCTCATCCATGCCCAGGGTGATGCCGGCGG CGGTCACGAACTCCAGCAGCACCATGTGATCGCGCTTCTCGTTGGGGTCC TTGGACAGCACGCTCTGGGTGCTCAGGTAGTGGTTATCGGGCAGCAGCAC TGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGATCGGCCAGCTGCA CGGAGCCATCCTCCACATTGTGGCGGATCTTGAAGTTGGCCTTGATGCCG TTCTTCTGCTTATCGGCGGTGATGTACACGTTGTGGCTGTTGAAGTTGTA CTCCAGCTTGTGGCCCAGGATGTTGCCATCCTCCTTGAAATCGATGCCCT TCAGCTCGATGCGGTTCACCAGGGTATCGCCCTCGAACTTCACCTCGGCG CGGGTCTTGTAGGTGCCGTCATCCTTGAAGCTGATGGTGCGCTCCTGCAC GTAGCCCTCGGGCATGGCGCTCTTGAAGAAATCGTGCTGCTTCATGTGAT CGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTCAGGGTGGTCACCAGG GTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGT CAGCTTGCCGTTGGTGGCGTCGCCCTCGCCCTCGCCGCGCACGCTGAACT TGTGGCCGTTCACGTCGCCATCCAGCTCCACCAGGATGGGCACCACGCCG GTGAACAGCTCCTCGCCCTTGGACACCATGAATTCATCAAGTGGATCTTG GTTTGTGTGAACCTCGTCCAGCGGGTCCTGATTGGTATGCACTTCGTTGC GAGTCAGCAACTTGGCGCTGCCGGCGAACACCACCTCGTCGTTCTGCCTT ATATCGTACTCCACGGTGGAAATCTTGCGAGATTGTAGCAGACGTACGGT CACCACGGTGTCGGTCTCAATACGACAGGGTTTCAGAAACTTGAAATTCT GCTCTAGAACCACGGTGCCCGGACCAGGGAGCTGGGTACCCATTATACCA GCCACCACCGCGTTGAGCAGGGCTCCATGGACGCGGCGCTCCTCGGTGGG CGTTTCCAGACTATGGATGTAGTTGTGGTCGCCGGTGAACTGGGCAAACT GCTCCAAATCGCTTTGGGAAAACCGCTTAACCACTTGCACCTGCTTCACT GCTTTGCTGCTCAGCTGTCGGAACGTTTGGGGAAGCCTTTTGCAGCTGGA CAACCTCTGTGCGTGTTGCGAAATCTTGCAGCAGCAACTGACAAAGTTTA ACGATGCGTTCATCGTGGGCCTTGACCCGCCACTCTTGCACCGTCCTTAG CACCGCAGGGCTCAGAAGTAAATCCCGTTCAGTCCGTTCACCAAATTCCA GTAATTGGTAAAAGAGCGCCAGGCTGTGAAGTACTATTTCCGGGTGATCA GTGCGCACAAAGAGGCCGGTTAGCAGTTTTAGCTGCTCTCTGATAAATTT GGCAGCCGTTTTGTCTGCAATAAGAATATGATGAACAAGGTTGGTTTGAA AATCAAATGTTTGCTTACCCAGGCAAAGGTTACACAATGCCGCAATTCCG TGCACTTTTAATAGCTGATCCTGTGTCTCCAGCGATGCCACAAATACATC CAAGGCGTCCGCCTCCAGGAGATGCGACCAGTTGATGGGATCGTATGCAA AATTGGCCAAATTAGCAGTCACCTGCTGCTGGGCCTCTAATAATGAAAAT CAAAAATGAATTCACACCGGCAAAATGACGTGAATAAAAACCTTACCGAT GTTGGTTGTCGTATAATACTCATCGACCAGGTGACCAATGTACTCCCGGC GGTCAATGCCCTGGGCAGGCGTCCTCCTCTTCAATGTCCTGTGGCTGGAG AACATAAAAAGGATGCGAAGGCAAAGCTGCGATTTGAAATCAGTCCCAAA ATGCCATTCACAACGCAAACTATTCATGTTTTACCATTCACATATAAACG TGCTGAAATACATTGGGGGCAAAATAATAGCTTTCGGATTCAAAGCCACA TTTATAAAAGTTATTTGTTTCATCTCATTTTTTTTTATAATGAGCAATTG GGTTGTTGTACAAAATCACACATGAATTTATTTGAAAACATAATAATTTT ATTTCGAAATAATATATGACATAAATATTTTTTAGAAAACGTTAAACATT TTAATCAATTCCTTTTCCAATAAGTACATTTATACAAGAAGCGAAAAATA CAATATTTCAAAGATTAATTTATTAAACCAAGTTTAGTTCTTTAAAGGTA AACCACCAGCAAAACGTCCTCATTACGCAGGCTCCTCCTCCTGACCTGAA GCCTTAACTCTCCTCCTTGCTGGGACTGTCTTTCCCCAAGAACTCTGTGT CATTGGAATTGCTGAAGTGGCTCCTGGCAGCTGCAACTGACTTTGGTGGG ATGTTGAACAGTGGGTGGGTAGGCAGTAGCTCGTTAATGGTGTCGCCCAG GACCTGGGGGCTGCTGGCGCACTCCGAGTGCTGGGCAATGGAAACGCCAC TAAGAGTATAGCATGTGTGGTAGAGATCCTGCGGTCTGAAAATATGGGTT TTACATTAAAAAACATCACAATGTTGGCATTAATCCCTTACTTTCCGGGT TTGTCGATAAGCCCGCCGCTCTGCTTTTGGCAGCAGAGCAGGATGTACTC CTGCAGGGCCTCCACATCGAAAAGGGTGTGCTCCATTTGCTTATCGACGC CGGATAGCGTTGCCTGCGTAATGGGAATGGTGGCTCCCACCCAGAAGGAG TAGCAGCCATCAACCAGTTTGTTGGTCCTCCCTTGGAAGCCGCCTTCGTA GGTCATCTGACGGCGCAGTGTCCATTTGAGCAAAGCCTGCCTGTCGCACT TATCAGCCTCGTTGAGCAGCGCCAGGCCCGCGATTCCGCAGAAGGTGTAG CCACCATGGGCCTCCAGACCAGGGGCTCCTCCAAATCCTCCCTCGTATGT CTGACACTGGGCTATCCAGTCGCCAGTGCCGGCAAATAGCTCCTTGATCA CTGGCTCGGGAAGATTTAGCAGCTTTGCGCAGGAGATTGCGCAGTAGGCG CCACGCACATCCGTCTCACCATCCACGTGGAGCCGGAAGGAGCCGTCTGA GTCACGTACACTGAACAGGAACTGGACCAAAGTCGGTCGGTCTATGGCAC GGTACGCCTGCTCGCTTCCGATGATGCACAGACTGTTCACTGCTGCATAG GTGGGCGCCAGATGGGCATACTGTCCAGGTCCTCCTCCAAAACCCCCAGT CGGCGAACGGCAGCTATGAAAGAGTGATTGGAGCATTAAGGATGCCTATT AGAGAAATATCCTTCAAAGACGCACTTGCTTAGAAACTGGACCACGTGGT TCAATGTCTGGTCGTCGAAGTTAAAGCTAAGTAGCTGGGCCGCCTGCAGG ATCCAGTAAACGCACCACGCGCGACTGCTGTCCAGGCACTCGTAATTGGA CGGCAGCCGCCTCAGCATCGCGTCCAGGTAGTACTGGTGCTCCAGCCGGA AGATCTGGGTGAGGCGCGGGTCGGTGAACATTATCTGCTCGAAGCGGTCG AAGCATTTCTCCACCGAACTCTCCGTCTTTTGCTGCAAGTATTCATCGGC TCTTATCTTTTCCTGGGCGACATTCGGGGATTACTCACTTGCTCGCGGGA TGTGGTGGTGGACACCTTCTCGTCGTCGAAGATGTAGCTTTTCAGGCGCT GGAAGTTGCGGAACATCAGCTCCTCCTCGGTTCCCATTTCTACTCCGAGC CGGTTAAATTAAATTAAATAAACTAAAAAGATTTGCCGAGCAGGAATTTT AAGCGAATGGTTTTTGTTTGTGTGATGTAAATTCAACTTGCAACACTGCT TTTTATTTGATTAGGGTATTCCCTATACAAAAACTCGATTTATTTTCCTT TGGCTAGATATTAAAAAATTTTACATTTTAATAATTCATTATTTCCAACA TTAAAGCCAGTAATATACAATTAAATATTTATAAAAAGACCATAAATTCA CATTTAAAATTCTTAAAACTCGGTTATCGATGTGACATCAAACTTTCTGT GGTGACGAGATTGTAGGCGGTGGATTGAGAACTGGAGTCCAACATAAATG TCTCGGGTGCATCGTCACTAGTCCACAAGCCATACAGTTCCATAAATCCA TAGACAAATAGACACACTATAAAATAGGCCGTCAGAGTGGCGAAAACCTG AAACACAATTAGCAATAAGATCTGCAATAATTGTATAATATAAATTTACA TTGTTCGGGCACCGACATCACAAACTCACGAAAAAGCTTCCTCTGAGAAT CAGGAACAGCCAGCCCTTCCAATCCAGCTTGCCGATCCACGTGATGAGGG GTTCCGATCCCGATGAGACATTTTGTGGACTGGGATCACCTATGGCACCG ATTTCTCCGCCTTCCCCCCAGCTATCGCTCCTTAAAGGAAGATACCAGTC GTAATAGAGCTGCGTTAGCATGGGCACCTCAAATGGCGATTTTTTCTTGA TTTTCTTCTCGATTGTGGGTTCAACTGCGACCGGCTCGGACTGACCATCC TGCAAATGCTGAAAGCAGTCGTTAAAATCGGCCAGGGTTAGCTTACGCAA ATTGTCGCAATCATCTGACTTCTCATGCTTGGAATGGACAAAGTGCCTTG TTGGCCTGGTATTTTTCTTGTAAGGAAGCGCTTTGTTGGCTTTCGGCTCA TGCTGCTAAACGGTAAGATTAATTTAGTATATAAAAATAATAGCTTGATA GAAATAGAAAATATAATAGAAAAAATATTACTGGCACACTCAAATCGTGT TCCAATAGGCCCCGGCGAGATTCGAACTCACGATCTCCTGTTTACTAGAC AGGCGCTTTAACCAACTAAGCCACGGCGCCATATTCACGCATGTGGCACG ACTTTACTTTAGTGCTTCCTCAACAAAAAATTTGTACATACGCACGCACT GCTTGACCCCATTGTTGCGATGCAAGCAGTGCACGAGCTTCAAGCCAAAT ACGTAAGATGGCGCCTGTGAGAATGCGTTGATATGGGTATTTAAACGCAC GCAGATTTTCAATATTTTAGAAAAGGTAAAAACAAAAAGTTATTGGTATT AACAATATTTACCGATGGTGGCCCCCGCAAATCCAAAAAATTAAAGTCGA ACTTTCCTTGCTTAATGAGGTCCAGCTCCTCCTCGGACACGAAATTGCCA GGATCGACGCGCTCGTTGCTGAAGATGTCGTAGTACTCGCCTGGGGCCGA GCAATCAGTCACCGGTTCGCACTGTTCCGTTTCCCTATTGAAAAAGCTCC GTTTCCCAAAGTAACGCTCCTCACAGTTCAGCGGTGTGCAGTTGCGCAGG TAATCCTTGTCCCAGTTGCGACAGTCCTTGTAATCCTTCCGCCGGCGCAG CTTGTTGCCGTGCGGATCCAGGGTCTCAAAGCGGGTGTCAAAGTGCAGCA CCTGCCTCGCGGTTGCCACTGCATCCGTAGCGTGGGCACTTGTGGCTGAG ATTAGAATGGGGCAGCTGCCCACACGGTTGTACAGAGACTGTAAGCAAAT GTGGAATGTGCAATTTCATATGCCAATATGTCAATATGCAAGTGTAAATC TATAAGAATCAATGATCATTGGACCTACCACAGTGGGCCAGACCAGGGAG ACAGTTTCACTCTTGCCCGGTTCGACGGAGCCAAAATCCCCGCCAAAGAT CCTTCCCATCGCGTGCACCTGCTCCCCATGGGTCGTGTTCACAGTGCATT CCCCATTCGAGACGACATTGAAGTCCAGCGTCTCCCTTTTGTCACTCCTG ATGCGATTGGTGACGGTCAGATCTGTTGGGATCTGATTCTCAATCGAAGA ATCATAGCGAATCGCAATTGCAGCTCACCGAAGATCAAGCCAATGTCCTT GTCGCGAGGCACGCGCACTATGAACTTTGTGGCACACAGGCTGCCGTCGG TGCGGCGTCTGATGAGTAGAACGAAGCAAACCAGCAGGTATTGTAACATT TTGTGACTGAATTTGCTTGGTTACTAAAATAACAGAGTTTTAGCGCATTG AATAATATTCATAACGACCTATCTAACCAGATGTGCATATACTTATTCAT ATGATTGATATTCGTGAGTCATTAGATGATACAAAAGATGTGTGTGATAG CTTTGCCAAGTCTTTTTTAGAATTACGAGCTTTCACAATTTTTTCTGACA TTCTGATCAATTTTGTGGCAAGACCCTGGATAAGTTGATAGTCCCCATAT AAAATTCGTCGAATACTCCAACCCTTTGAGTCCCCTTCTCCACTCACTTT TGCGCGAGGGGCTCGTCACGATGTGGATCCTTAATGGGTTGTTGTTTAAT TAAGTGTAATTTTAGTGCCAGGCAACCCTAACACGGGCTCCTTTCCATAT CCTTACACTGTGCTCGTCCTGGGCACACGTAGTCGCAGTATCCGTGGCCA CGTTTACTGCATCCATTGCAATTTATGTTTTAATCATCAAACGCGACCCA ATTAATCAACGTTGCTGGCCTTAATTTATGCGGCGGAACAATGTTTTGAA GTAACCCAACGTGACATCGCACGACAGGTGACATTTGGCGGCGATAAGGA AACCTGAGTGCAATGCATATTCATAGCGACCCGCTCGTAATTTATGCCGA AACTCAAAACTAATTTGACAGGAAATAATTAATTTGGCATCGAAAGAGTC CAAAATAAAAGTGCTGCCAGCCAGTGCCAATTAAAATTATTTCGCTTTCA TTACCCAATGCAGCAGCAGTAATAAAAGTCTTACCCAAAGCCCGAAAAAA GAAACCCCCAGCCTCTGTCCAATCCCGGAGACAAAGACAGCGAGGAAAAG GCAAAAACTAAGCAAACCACAAAAAAAAGTTTAAATAATGAAATCACTTC GCACCATCTCGAAATTGCTCATTAACATTTTGTGTTTGCGATATCAACTT GTGAAAATCACAGGGCCCAGCAGACTCTCCGCTGTGGCTGTGCTGGAGTG GAGTCCGGACTCCAGGCCATACTCCAAGGCGAGCTCCAAAAGACCAGGCC CAAATGCAGACCCAGACTCCGAGGCAGCAGCAGCTACTTGGCTTTTATTT ATTATGCCATGTTGTTGTTGTCGCCGTTGAGAGGTGTTGCAGTTGCTGTT TTCTCCTCTGTTTTTTTTTTGTGAAGCTGACTCTTATTAGTTGGGTCAGT CCGTCTTGTTTTTTTTTTTTTTTTGATTTTTTCCTGTGTGGAGGAGGTGT GAAATCGGTTCCAATCCCCTCTTGACCGTTCCCTTCAACTAGATGGCCGG CTGGCTTCCTCCGCGGGTCGTGATTTGTCTGCAAAAGACACAAACAACTC CTCGAACCTCAACAATTTTTCTAAAGGTCGTTTGCTTTACCTTTGCATTT GCCTTTACTCAATGAAATTCGCTCAGCGTCCCAAAACACATGAAAAAATG TAGTATTGTATATCAAGAAGCTTAAAACAAAGTTAATACAAAGGCAAAAT TTTTAACTTATATAATAATATCATATTTTATAAAAAACTCGTATTCAATT ATATAAATATAATATATAAATTGAATATAACTTTGTTTTATATCTAAAAT TTGATTTGATCTATATGTTTCATGTTTTGGTATATCTTCATACCGCCCTC CAACGTGGCGTATACTTGTTTTCGGCAATAGCCGCTTCTTTTCTTCGGGT GCAGTGCATCACACACATCCCGGCAGCCAGGAGAACTGCAGTCAAAGTCA GGAGATAAGACGACTGGCTAACTGACTGGCTGACCGGGTGTATTTCAGTA GCCATTCGATTTATGTTAAATAAGCTGAACGCGAGCTCTGTTTGTTGTAA AATACCAATTGCCAGGCTCATCCGCACGGAGCAACAGAGACGGATGGAGC TGAAATGCTCGTCTGGAGGTGGGAGTGAGATTCCTCTGTGATTCACGTTT CTGCATCATTTCATTTCTGTATTCTGTTTTTTCTTTTCGATTTTTTGTTC ATTCCATGTGTCGTTGTTTTGCTGCTGCTGCTGCTTGTGTTGTTGTCGTC GGACTGCATCAGATTTCTTAATTTAATTGGCTTTATGCAAGAGGTTCTCA TTTTCTGGTCGGGGGAGAACTTTATAGACAAACTGTCTGCAGGTCCTGTT CCTCCTGCTCCTTCTGCTCCTCCTGCAGGCCATATCCAATCTGCGAGGCT GAAAGAATCGTGGGAATCGTCTATCTGGGCGCGTGTGGACTCACTGCAAA TGCAAAACAGCTTAACCCAATTTTTTGTTTCTTCGCCTCAGTGCAAAAAT AAAAAAGAAAACGAAAAATCAATAAGAAACAAAAGAAAATGCTGCACGTA ATTGTAAGTTATGAGCAACAGCCGCCGCAGTCAAAACAAAAAAAAAAAAA AAAACAACGGCCAGAATAAAATGGAAATCGTTGAGGTTTTCCATCATCGC GTGCAGGTTGGCAGCGTTTTAAGAACAATTGCAGCGCATTTAAGCATAAA TGCTAGCGAAAAATCCGCGCTTCCACACTCGGAGAAATATCACCTGAAGT TTGTGGCTAAAACCATTTGAGAATTACAAAGAAAAGGTTGTTGGGGGAAA ACTAAACGGTAACCCAAAAGGCTTATTCGTTTTACTATAATTGTTGGACT TTGCATTCTCAACGCTAGTTAGTTAAAATAACGTTTTATGATGGTTATTT CAATAATTTTAACATTAGTAAGCTGATTTTATATTTTTAGTGTGCTATGC ATGCAATTGTATTAGTACGTATTGGTATAGGCAACTGTGAGGGTGTGCGG CACTTAATCATCAGCGTGAAATGCAGAAAATGAAATGGCCAAGTTGAGGC CAACTGTGCACTTGGCTCTTCTTTCCGCGCTCACGAGAGTGTACATATAT AATTAAGCTATAAATTCTGTTTTTATGATTTTCCACAAAGTTATGAATTT ATGGCAGCCCACAAAGCACTCAAAGCCAGACACACACACACACACTCACA ATAATTTGCGGCAAAAACGGAAGTGAATTTAAATGCGCGCGCATGCGAAA TGGAAGCGAATCCCCCCCACTCCTCCCTCTCCCACAAAACGAGAAAGAAA ATGAAAAACCTACTTGAGTTTCCAAAAGAGAAGACCAATCGTAGAGTTGG CCCGGCCATGTTTGGCCCGTAAATGTGTCGAGCACTTTGTGCAGACCTCG TAAATTTAACGCTTTTAAGTTTTATTTCTTTCTTATTTTTTTTCGCCCGG TCTCGCTGCTAATTTCGCTGATGGATGTTGGCCGAGGGGCGCAATAAAAT TTAAATATTTATTGTACTCTATATTTTGTTGCCATGCAAATTTGGCCGAG GCCCTACATTTTTTTATATGGAGCAAGCAGCTCGTAGGGTGTCCATTTTA GATGGCATTTCGGTTACAAAAAAGTACACCGAATTTGCGGCATTAATTGC ATAAAATTGCGCCCTGTCGCTGGATAAGAGTCCCTTTACAAAGAGCCACT GCTCACTGGGTCAATTAGCATAATCGCTTTTGAAATTGCAACCCGAACTC AAGTTGCAACAACTTGGGGCGCTGCAGGTCGACGCGTATCTTCAAGTGGC TGGCTAATCGCCCTTGATGCCATCGATCGTCGGGGTTGTCAAAATCGCCA GTACTCAAGAGCCGCTGGAGTCGTGGGGAAAATGAATACTATAATTAGCG TAATTACGCGAAATGCTCATAACTGGCCGTGTCATGGCTGCTTCCTAATG CGAAAATAACGTTATTAATTTCGAGCCAAGTGGGCAGGCACTTTGCCGGA AGGGCCACATGATCTAGGCAGCGTTACCAAGTTTAAAAAGCCACCCCTGG AGTGAAATTAACTACATATTACATTGCAATTATAAAAACACTCGAAATAC TCTATTTCGTGAAGCAGTTTCCCCTCTCAAATATGATCAAGAGTTACATG CAAATAAACTTTCAAATTGGAGTTGCTACTCAGAATATGGAGTATTGGAT GGATCCCACGATATCTTTTTAATAAAAAACTTTAGGATTTAGATGTTAAA TGGTTTTACCTTTTTAAATCAGGGATTGCATGGTATATTTTTAATCAGAG TTAAATATTTTTCATATACCACCGAACAATTGTAAAGATTGTAATGACGA TTAAAATAAAGTATAGCCATATTATTTTACACCTACTTTCAAAAGAGTAT TGGCTAGTCTTTTCAAGGCAAGTGCTTGCTCGCATTATCCTTCGAAAGTA TCCTTTTCATGCGGACCCTGGACAGGAATATTCAAAATGACTTGTCACTA GCGCGGCATGCGCTAAATGGGCAGGTGCAATTGAGTCCGGCGACTGGGAG ACGCGGCCCTTTCGGCGAGCGATGTTCTTGTTTTCATAAAATTGCAATAT TAATGCGGAAAATCTTTGGGGCAGGGGCACGGAGCACGGAGCACAGGGAC AAGGTGTGCAGCAGGCCATCATTTTGTGCAACCCGGCGTGTTTTTTTTTT TTTGCCTCGAAAGCCGCTCCACATGCTTGACATTGATGCAATTTCGATTG CCGGCAGCTGACTGCAAGTAATCCCCCTTCTGGCCGACATATCCGCACTT AGTCGCAGCAATTAAACGAGATTAAATCGCCGGTGCAAAGCTGCTCCAAG TGGAAATATGTGCCCATGTCCATGTCCATATTCATGCCCAACGCGAGGCG CAATTATATTTGAAAATGCAATAAAATATGGCTGGAGGAGCTGCAACAAA GCGCAGCTTGATTTGCATAAATATTTTTTGTTGCACAGAACCAGCCACTC ACTCGAAATGCGGCTAGAAGATGGAGAACTGTGGGGCATAAATTATACTC ATGGCGGGGCAGCGAGTTTAGGAGAAAGAGTGCTTATCTCGGAAGGAAAT TAGCTGATAATATGCAAAACACGCCGCCAAATTGCAGCCTGAGCCAAATT TCAAATTGTTACCCTGCGCAAATAAACACGAGCATGCTTATGAGCAGTGG AGCCCATTTAAAACCCATTTCGTTCTGAAATGCAAGCACTAATTCCTACA ATATAGATGCATTTCTTTGCTAGTTCTATGCAATTAATTCTTATTAAGTT CTTCAATTTCTCCAGTTAAGAATTATTCGTTACCTATCATAAGCGGTCTT TACTGTACTTGGCCCAAATATCCTTACGTTTTTGAATAAATATTCAAGTC GTACAAGCAAATGAAATTTTGATTCGCTGTGGTTTTACGACGATATAGTA AAAGTAAAAAGGTGCAAGAAAAACATACGGAGGTGTGCATAAATTCCGAT GAATTTGAGATCAGCATTAGTAATTTTATTTCTCCGTGTTTGACCGATGT TGTAAACTCACGTAATTCATGTAAATCAAACTTAAAGAAAAAGTCAAAAA CATCCAAGAGAACTATGCTTTTAATTGAAATTCGTTCTTTGTTTAAAAAA CACCGAATAAATACATTTTCAATATACTTATGCATATAAATAATAAGTTA TTGTATCTAAATATAGATGATAATATATTTAGATTAGATTTGACCTTATC AACATTTTAAACTTGCGTGGAGGCAATTTATTAAGTGGAAGTTGGAAGTA CCTTTTTCCGTTGCATATCAGCTATTATCACTAAGTTTGTTGAAGTTTGA AAGTATCTATGGACAAAGTTTAATTATCTTAAATGGAAATCATGAATAGT ACTCCACTTTTCAAAATATGGAACCTCATAAAGTACTTCTGAAAGGGGCA ATGTATATGGGCGCCGTGGCTTAGTTGGTTAAAGCGCCTGTCTAGTAAAC AGGAGATCGTGAGTTCGAATCTCGCCGGGGCCTATCACAATTCGGTGGTT GCTATATTTTTTATTTTCATCCTTCCATTATTAAATATTTAAAATTTAGA TGCCCATAGATATTAATGATATAGGCCATTTCTTAAAAAAACCTATCTAT TCATACTTTTCAGTTGATAAATAAATTATTGCCTGACCTCGTCGTTGATA CATTGTATCTACAGCCTTCATTCTTGTTTAATATTATTTACAACATTTTT CCATTGCAACCTATTGTGACCATTTAAGCGGCTACAAATTGTCTCATTTA AACATTGAAACGCTTCTGATTTCACAATTGCAACGTCAATGGCAATTTGC TATGTTGTCAGCTTGTGGAATTGAGATTCTAATGAGTTGATTGAAGGCTG TAAGAGCAGATTACAGTGGGGCGGAGGCCCAAGTCTGGATCTCCCAGGCT ATTTGATTAGTAGACCCCAACTGACCACAATCCACTTCGGCGCAATGTGA AGTGCAACTGAAAACGGCAAACAGAAAACGGCAGCGGCGGCAAATGTCCA TCAAATGTCACGGATCTGCTGCCTGTGCAGATCAATCGTTCGATCGATCG ATGGATCGATTGCTCTGGGTAGGATAATTACCCGGATCACGCAACTGGAA TGGAATGGAGTGGAGTGGAGTGGTGGTGCTGCAATCGTCTAGCCTAGAAG CGTTGGGTGACCTTGCAACCGCATTTCCCACCCCGCCCCTGGGAATTATG ACTGAAAATGAAATTGGCCACTTGGCCAGCTGTTTGTCGGTCCTCTGTCC GTATCCCTGTATTCCTGGCCCTGATCCTCCTGTCAGTGTCAAAGGCGTCG CTTATCCAGGATTAACTTTCCACGCATCCAGCACATGGCTAAGCGGCTCA GGTGCACTAAAGAAAAATTAAAACCGAAAAAAAGGTAACCTTTTGCAAAA GAAAACCATTCTTAGTTCGATACTAATTAGCTGGAGATTTTAGAATCAAC AATTACATCAAACATTACATATAGATAACGATAAGTTCTAATAAATACGA TAGAGCACGACATTTCTCCCAGTGTCTGGGGCGGAAGCACCTCGAGGGGC CTAACATGTGCATCTCTCGGATGCGAAGGTACATTGACAGGTTTGGGCTG CAAAAATTATGTTGCCAGCGTTCTGAGCGAAGTCTCCTGCCGATGTCGGC AATTATTTATTATCCTGTGTGTGCCCGCAGCCATTGCCACTCTTGTCCTG TCCCCTTCCAAGCTCCTTCTCCCTGAAAACCCCCACCCCTTTGTGGGCTC AACCCCTTCTGTCGTTCAAAATCAGTGCCGCCACTTCGTCGTCGTCGCCA TTTAAGTTTGCTTTTTGATTTTTTGTTGTTGTTTGTTGCTTTCCACTTTT GTGTTTCATAAATTGTCGTGGTTGATTTTTGGTTTATTCTTGTTGTTTCT GTTGTTGCCCAGGGCGACGCCTTGCCTTTTGTTGTTGCTGCCACCGCCTG CTGTGACTGAGATTCCTTGTCTCCGCAAGAACGAGATGGCCATACGGCGC AGAGCGAGAGGCAGCGAGGTGTCTCCACCCATATTCCAGATTCCAGTGGC TCACTTCCACTCGCTTTCGGATTTGAGTGGCAATTTGAGTGAGACTGCGA CTGGCTGCAGTCATGGGTCTTTCATGTGAGGCATTTGATTTTTCGGTGGG ATAACATGCGAATGAATGTTTTCAATTGATAAGAGATAAAGTGCAGTGAT TGTGGTGATTTAATAGTTCAATTATACCACAGCAATTGGAGCAAATTCGT CGAAAAGTTTTCTATTCAGTATTTTATAGCTTTAGTAAACTATAAAAAAT AAATAATTTTTAATTCTGTATTTTACATGTATAACAGATATTAAGGAGAT AAATGAAACGTTCTTACGGTATATATATTAGTAATAAATAATTGCTTTTT AAGGATGGATTCTATACAACCCACATTTATAGTTCAAATTACTTTTGATT TCACAGGCCTGAAAACAATTCCTTCGTTATTCCCATCTTGAAACTGAGCA GCCTAAATCATTTTCTTTCTTCTGTTTTGCTTTCAGCACTTTCGCATCAT ATAACATACGCGGCGACCTGCCCCCATTTATTTTCATATAACAGCTCCAT AATTTTCTTAATGAACGATTTTCTGTGTGAAGGTTGCCATTGTCATTGCG TTACAATGTAAAGGGGTCACCAGGGGGGGAGGGGGAGCTTGAGAAGTAGC GGTGGGGGGTAGGATCCCCCCTTTTCAAACAGAACCTTTTAACGTTAGTT TGTTGCGTTGATTTCGAAGCAAATGACAGAATATTGCGGTTGTTGCCAAT TACTCACGCACACCAACGGACTCGAATGCATTGGCCCACACGTACACACA TGTACATATATTCATGGAGTCTAAATGTGCGTGTGAGCCATACCCCACCG CCCACCGCCCCCCGCCCATAACCCTGCGATCTTGCCTTTTGTTGAATGCA TTTTCAATGGCATTTGTGATTCGCAATTGGCTTGTAATTGCTATATTTAG CGTAATGGCAGTCAAGAACCAAGCATTATGTATTACGGAAAAAGTATCTA AGGCCAAACCGCCCACACTCACCCGTACAGTGAAGCCCACACGAACAAGT GGGCTCTTCCTCTTGAGACTTTCGGTTTTCATATCATTAAAGCGGAAAAC TGGGTTACATTCCTTGCATTCGCATGAGGATCGACTGCAGCCATTAACCT CTAGTTTAAGCTCGAATCTGTTGGCCATAAATCACACTCTTCGACAAATA TTTGTGCCAAAATCCATACGTTTTCAGAGAAAAGTATCAAAAAAGTATAA AAACACAAATCCACTGGCCGCAGGAACCTGTCCCTCGAAAGCTGCGCCTT CAAGGCTTGACAACAGCTTCTGGGCAAGAACAAAGGAAGGTAAGAAATCG GTAAAACGAATTTTCCATACTCTACATTATTCCAAACGTCAACCAATTAA ACTATCTCCTTTATGTTTTATTTTTACGTATTCCAAATTTTTCGAAGTTT TCTCGGTTAAGTATGCAATAAAGTTTAGTTATGGATGCTTTTCACTTTAG GTTTTTAATTGGGCCATTTTGCTATCGTATCATTATTGAGGTTTTGGGAC ATTCACAACAGTTAATTAGATTAGTTTACTGTCTTTGATTATCAGCAATT TGAATATTACTTACTACCAACTACTATTACTATTACTACCAACTTGGCAA AGATTGATCTACAGCCCGAACATGTGTACAAAGTGTGTGTGTAAGCCGAG CTCAGATGCCCATTTGCAGTGCTAAGGGCATCGCAAACAACAAATACTCA ACACATGTCCTGTGCCTCCGGACAGTGGGATTGGTACTGCTATTGGATTG GAGTGGTATCTGATGGGATGGGATTACGATTGCCGGGCCAACAAGCGCCA GTCCCCAGTGGAGTTGCGCCTGGGACACTGGCGCGGCTTTTCGCCTTGTT TACGCTAAGATGGCGTATTGTATAACATCATTATGTGGACTTCGTTCATG TTCATGTCATAATTTTGCACAGTTCAGGCCGAGGAGTCAGCACCAAAGTC AGCAGTGCATTCCAGTCCTGCTCCCCCTTCCCCTTCGCCGTCACCATCCG CAGTCTTCTTGTCCAGGCGCAGTCACAGTCTCATCTCCAGCCGCGTCCTC GATCTCCAGATTTCCAGGCTACAGGCTGCAGGCTATAGGATTGAAACTTG GATTCGTGAATAGAATCGGCATCGTTCTGGGCATTGGCATCAGAATGTGG CGGTCGCTGTTTGTGTCATGTTTGGGGCTGCGTAATTAAAAATAAATTTT CGCCCTGCGAGGAGACAGGAGCGGATTTATTAATATTGAAACGTGGGTAT ATACTATATAATCCTTAAAAAACTCTTGCCAATTTATACTCCGTTATTAA GAAATCTCTTCTTATTCAAGAAAAAAGTAAACTGTAGTTAAATATTGTTC CATTTATTCTACCTATTTTCTAGATAAGCTACCATATATTTTTTAATTTT TAAGATAATTTTTTGACGTATGTAGTAACTAAGTAACTAACTAACTAAAA TATAAGAAATAATTAACTGATCCTGCGCCCAAATGCTTTTTCAGCCCCCT GGCAGCTGCGTTCCTGTTTGCCATCGGCTGCTACAACACTTTTCGTTACT TTTTAATTTAATGAATATTGTGGGACAATTTATTAGCGAACATATTGATT TCAGCGTTTGCCGTGTTCCACCGATGTCTCGTGTGCATATGTTGTTGTTG CTAAGTTTATACGGTAGTTACCAACATAAATAGCAGCAATTTGGCCAGAC ACCAACAGCAGAGGCATAGCGCTGCGAAAGAGGGTCCCATATGGAGGATC AGTACAATCTGTACGATTTGGTCGATCTGTGGCACTGGATTCGATCCGGA CGCAATCGCCGCTTGCTGAACAAGCGTACAATTAATATGCCCAGGCTGCC GCCGTCGCCGCCTTCGCCACAGGAGGTCCCCCGCAGCTGGGGCACAGGTC CCCAGTTCTCTCCACATATGCCCACGGTTACCCGCAGACGCCTGCGGATC CCAATCCTGGTGAGAGACTCTTCGACTTTCCGAA