##gff-version 3 ##date Tue Nov 28 10:15:24 CET 2023 ## exported from the transgeneomics system molecule_59050296 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59050296 mpicbg region 9631 25454 . + . Name=dmel-5.43-3R;type=genome;start=3734848;end=3750671;strand=- molecule_59050296 mpicbg region 25455 25527 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59050296 mpicbg region 25528 26516 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59050296 mpicbg region 26517 43871 . + . Name=dmel-5.43-3R;type=genome;start=3717493;end=3734847;strand=- molecule_59050296 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59050296 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59050296 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59050296 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59050296 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59050296 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59050296 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59050296 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59050296 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59050296 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59050296 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59050296 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59050296 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59050296 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59050296 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59050296 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59050296 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59050296 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59050296 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59050296 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59050296 coding_transcript gene 10091 14146 . - . ensembl=FBgn0002542;identifier=FBgn0002542;alias=Fs(3)Hor;Name=lds;id=50661157;alias=transcript A;alias=Female sterile (3) Horka;alias=early-3;alias=early-B;alias=Fs(3)Horka;alias=Horka;alias=DmF2;alias=lod;alias=early-5;alias=lodestar;alias=factor 2;alias=Negative transcription elongation factor 2;alias=Fs(3)Sz11;alias=NTef2;alias=Lds;alias=CG2684;alias=early molecule_59050296 coding_transcript gene 14281 17981 . + . Name=CG10445;identifier=FBgn0037531;id=51501128;ensembl=FBgn0037531 molecule_59050296 coding_transcript gene 18030 20723 . - . identifier=FBgn0014931;Name=CG2678;alias=transcript B;ensembl=FBgn0014931;alias=anon-84Eb;alias=B;id=50384678 molecule_59050296 coding_transcript gene 21303 22563 . + . alias=transcript C;alias=anon-84Ea;Name=CG2846;id=50384734;ensembl=FBgn0014930;alias=C;identifier=FBgn0014930 molecule_59050296 coding_transcript gene 22801 24982 . + . alias=Phosphoribosylamidotransferase;Name=Prat;id=50550502;identifier=FBgn0004901;alias=transcript D;alias=CG2867;ensembl=FBgn0004901 molecule_59050296 coding_transcript gene 24857 28309 . - . alias=TFIID;alias=dTAF[[II]]55;alias=TAF7;alias=TBP-associated factor 7;alias=Taf55;alias=TAF[[II]];alias=anon-84Ec;id=51108803;alias=TBP-associated factor 55kD;alias=CG2670;alias=TAF;alias=E;identifier=FBgn0024909;alias=TBP-associated factor;alias=TAF[[II]]55;Name=Taf7;ensembl=FBgn0024909;alias=TAF55 molecule_59050296 coding_transcript mrna 24857 28309 . - . Name=FBtr0081756;id=51108822;parent=51108803 molecule_59050296 coding_transcript mrna 24857 28002 . - . parent=51108803;id=51108846;Name=FBtr0114520 molecule_59050296 coding_transcript exon 24857 27758 . - . parent=51108822 molecule_59050296 coding_transcript exon 24857 27758 . - . parent=51108846 molecule_59050296 coding_transcript three_prime_utr 24857 25451 . - . parent=51108822 molecule_59050296 coding_transcript three_prime_utr 24857 25451 . - . parent=51108846 molecule_59050296 coding_transcript cds 25452 27758 . - . parent=51108822 molecule_59050296 coding_transcript cds 25452 27758 . - . parent=51108846 molecule_59050296 CLC misc_recomb 25528 25561 . - . Name=FRT molecule_59050296 CLC cds 25569 25640 . - . Name=BLRP molecule_59050296 CLC cds 25641 25661 . - . Name=TEV molecule_59050296 CLC cds 25662 25685 . - . Name=Precision cut site molecule_59050296 CLC cds 25686 25727 . - . Name=V5 molecule_59050296 CLC cds 25734 26450 . - . Name=SGFP molecule_59050296 CLC cds 26457 26516 . - . Name=2xTY1 molecule_59050296 coding_transcript intron 27759 27822 . - . parent=51108822 molecule_59050296 coding_transcript intron 27759 27822 . - . parent=51108846 molecule_59050296 coding_transcript exon 27823 28080 . - . parent=51108822 molecule_59050296 coding_transcript cds 27823 28017 . - . parent=51108822 molecule_59050296 coding_transcript exon 27823 28002 . - . parent=51108846 molecule_59050296 coding_transcript cds 27823 27921 . - . parent=51108846 molecule_59050296 coding_transcript five_prime_utr 27922 28002 . - . parent=51108846 molecule_59050296 coding_transcript five_prime_utr 28018 28080 . - . parent=51108822 molecule_59050296 coding_transcript intron 28081 28144 . - . parent=51108822 molecule_59050296 coding_transcript exon 28145 28309 . - . parent=51108822 molecule_59050296 coding_transcript five_prime_utr 28145 28309 . - . parent=51108822 molecule_59050296 coding_transcript gene 28276 32389 . + . id=51501038;ensembl=FBgn0037530;identifier=FBgn0037530;alias=NEST:bs09f06;Name=CG2943 ##FASTA >molecule_59050296 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACTAATTAACAACTTTTAGTCC TAAGCTTGAGCACTTCGATTCGAAATAATTATTTAACAGCAAGCTATTTG GGAAACGAAAAGATTATCAGATCACTTTATTCAAAATTGTTCTATTTGAG CATACATAAAACATGTGTAATTGATATGAGATTATCAGCCTACAAGATAA TCCCTTTGTACTTTACTCTTTAGAATACATACATTACATCTTTCTTGGGC TGTGCGCTGCTATGTGAAGAAAGCATGCGGTTTATTATTACTTCGTGAGA ACGAGAACTGATCTGGCTGATCTGGAAATAGTGTAGCGTACGTTTCTAAA CATAAGAAAATGATGTTTCCTTAACATTTGAAAAGATTTCTTTTGTACAG TTTGACAAAAACCAAATATGTTATGCTATTCACATTGTAGTGGAATTCGA TTGTATCCGCTTAGACAGAAAACGCAAATAATTAAATTAGGATATTAAAA CATAGTAGAACACATTTCAATTTTAATGGAACTCATTATAAATCACCAAA CAACTTAAATGGTATTCTAGTTAATTTTAATACAAAGCTTTGAAACAAAG AAATGAAAACATTAAACAAAATTTACAATAATCTTGAATAAATATTTCGC TGTAAATAAACATAAAATGGTTATCTATGGAATGCATTTGCAAAACGACA AAAAATAAGTATGGAAGTTGATAAAATACGAAACGTTAAAAGCAAGCTCA CATTCCAAACAAACCTTTAAGGTCATCTATAGTAAGTTTAGAGCTAACTT TGGCGCCTGTAAGGACACCATCGGCAAGATCCAATTTTTTATCTTGCAAT CCTTTGATCCGCTGCTCAACTGTGTCCACGCACATGAACTTATAAATGAT CACGTTCTTTTTTTGGCCAACGCGGTATATACGGTCCTGGGCCTGAGCCT CCAACTGAGGATTCCAGTGCAGATCCAAAAGCAACAGGTGGTTGGCACCA ATCAGGTTCAAACCCACACCGCCAGCAGTAAGGGAAAGCAAGAGAACGCG CTTCTGATTGTTGCGATCGTTGAACTCATTAACAATGTCCTGACGGTTTT TAACCGGAATGGTACCGTTTAATGATAAGGTCGCCACACCATCCTTACTC AAATGGTCGCGAAGAATGTCTAACACTGACGTCCACTGAGATACTACTAT GGCCTTGTCGTCCGAGCTCTTCAGAATCGATGTCTTAAGGATTTGTATCA CCATGTTAATTTTTGAAGAGGGACGATGCAGATTAAATACCGGGTTGCTG CGTTTCAGCAGATTCTTGGAGGCCTTGGCAATGCGGGCTTCATCCGGCAA TAGCGGAGGACCGTCGTCACCTGCATTGGCAACCGATTGCTGACCGTCGG TGGAGGTGTCCGTAATTGCGAGTTTATTGAGCTGGGCCAACAAATCGATT TCGGGTGTATCGCTGTCACTACTGTGGTCTCCCATGGTCTGGGATTCCTC TCCATCCAGCATCTTAAAATAATTTTTTTGGACAATTGAAATTATGGTAA TGGAACTATTTTTTAATCGAACTCACCGCATCAATAAGGCCAGGATGACA GCAAATTTGTCGAAGACGCAGCAGTAACACCAATATATCATGAGATTTTA CCTCCTTTTTGCTTCCAGCCATTCTGGCAAACTTTTCGTGCATTTTGTAA TATGCCCCATTGGGATCTTTAATTTGATTGTAGGTTGGTTTATTGGCATC GCTTCTGTAATTAAAATCAGTTTCTCTCTCGGCGCGCTGATGGAGAAACT GAGCGAACAGTGTCCTGGAATAAGTCATTACAGTTTGGTAAACATTCATC TCCTCCTTGTCCAGCGAGATCTCGATCAGGCGCAGCTCTTTATTGGGCAA GCTGTTCAGCTTGCCGTCCGATTGCAACTGTGCTTTGGTGCGCCTTAGCA TGAGTGACTTCATTAGCAGATTGAGCCGGTTTTGCCCTCCAGCACTCTTG TTGTCAATCCACTTCTTCCACGTGTGTAAATCATCAAAGGGCGAGCAGCG CAAGAACTTGAGCAGGGCATAGACATCCAGTTCCTTGTTTTGAATAGGAG TGCCAGTCAATGCCCAACGATATTTGCCACGTAAATCACACACCGCCAAT GATGACTGCGATTTATGATTGCGCACCACGTGCGCCTCGTCCAAAATGAT CCGCCGCCACTTGACACCAAACACAGCACTCAAGCTCTTGTGCTCCCGCG CCACAATTTGGTAGGTTGTCACCACAATATCGTAGTCTCGAAGGTACTTT CCCTTCGTCTCCCGATTGTTGCCATGGTGCACGCAAACGGTCAGCTTCTG ACGCGAAACCTTCGACTCCACCTCGCTCTCCCACTGACGCAGCAAGCTGG CAGGGCACACCACCAATGTGCCGCCCCTACGCGCTGGAAAATGTAATATA TATTCGCCACTTATATGATGCTATTGAATTTAAGAATATAAAACAGAAAC ACCCTAACTGCGACTTACTATCTTTACGGCCCTTGGATTTCCATCCGGTC ACGCTTTTTCGCTTCTTATTTTTATCATCCTCACTGTCGCTGTCACTGCT CTCATCTTTGCCTTCGGACATTTCTTGGCCATTTTTGCAAGCGAGGACAG ACGAGATCATGGTTAGAGTCTTGCCCAAACCCATATCGTCCGCCAGGATT CCTCCCCGAGGTAGTTTACGTTCACGCCAGGACATCCAGGCTAAGGCGTG CTTTTGGTGGTTCATAAGCGATACCTTCAGGCCAACAGGGTCCTCTGCGA GCACTTCGGGTCCAGGAAGGTCCTCGAGTGAGACGTGGAGGTCCTACAAA AACAACCATTAATTTCTGTGCAAATATATGAAAAAAAAAAAATGCACGAA TCACTTATTCAGTATTCGAGGTTTTAATCATGGCCTGCTCTTGGACAGCC ACCGCACAGTAACTCGTGCCCAGCGACTGCCAAGTATGAGCACGCTTCTC AGATATCCGTTCTGACTCATCACATGGAGTAAGGCAAAAGATAGTCTTTG GTTTTTAGGTACTAGCAATAATTGCATAGGACTTGAAAATACATCCTAAG ACTATATATTAGACGAACTAACTTGACAGCCCTATTAACCTTACCTTTAG CGATTCCAGGGTCAGTGCCTTCTGGTTGTTAAATGTGGCCATTCCTTGGG CACCCGTGTAGACGGGCTTTATTTCATTGACCGCCTCCGACAACTCATCC CAGTCAAGAGTATCGATTGATGGAGCTCTGGGTGGATTTAGTGTTGGCTT AACCACTCTGACGGCAGGCACATTACTCTGCTGAACCCTTAGTGCGCTAA TCCATTGCTCGTCCATTGCGAGCTCACGGCGCAGGGTGTCAATGCGCTTC ATAATCTGGCTGCCCTTATCGGGCAGCTTGTGGGCCACTTTCTCGAAGAG CTTCTCCGCATCGCTTACCTGAACGCGCTTTTCGGCCAGCTTACGCATCT CCTCATCGTAGACCACCTGGCTGACCACCTTCTGGTCCTCGCTCTTAATC CGAGATCGACGTGGAGCGGCAGGAGATGTCTTTTGCTTAAGAACCGCTTG TATTGTTGGCTGACTGAGATTCTTGCTTGTCTTGACCACCGAAGCGCCAG CACTGCTTCTGGGCGACAAAGACTTTGATGGGCGTTCAAACGGCGGGCCG GACATGTTTTCCTTATTGGTGGTGGCATCGTCGTCTGTGCTGGATAGTAT CTCAATAGGTGTCTCCTTGTTGCTGAGTATGAGCACATCACTGCCACTGG AGTCGTCCAAGACCTCAGAATCCGCAGCGCCAATCGTCGAATGGAGGTCG TTCTGTATATTACCAGCAAACTGTGTGGTGTAGCGCGGCACGACCGCTTC GGCAGTGGGTGCCTCCGTGGGTCCCTCCTGCACTTCATCGCTGTACTCGA TCTCGCTGTCGTCATCGCTGAGATCCTGAGGCCGCACTCCAGTGATGCTC ATGCGGGTGCTGGGTGACAAAGCGCGCTGTTCCAGCTCGTCCTCCTCATC CTCGCTATCGGAGGGGATTCCCAAGGGCTTCCTCTTAGTGTTCCTAGCGG ACGGACGAACGCTGTCGTCCTCAGAGTCTTCTGACTCCTGGGAATTTTGC GAGTTGTCGGACTCATCGGACTTTTCGGATTCCGCAGTCTCACTCGACTG GGACTCTTCCTCCTCTGATTGCGTTTCATCTATAACCACGCCAGCGCTGC TGGGGCGCGAGGATTTGCTGAGTCGCGACGATTTGCTGAGCCGCGAGGAT TTCCTTGATCGGCCTGTATTGCATGTTAAGTGAATGACATGAACTGGGCA CCAAACTAAAAGCGATCCAAAAATTACTTACCTAAACTGGAGTTGTTGAC CACCGAGTCTTCCTCCTTGTCACTATAATACTCGCTGTTTTCACTGGACA TTTTTAGCTATAGGTATTTTACAAAAAATGCTTGTAAATCAGCGCCATTT ATTTCAGAATGGAGATGCCACCTGATCAAAACAATGCCACAAACTATCGA TATTTTAGAAAGCAGAAGATCGCGCCGAGTCGTGTGGCAGGCCAAATAGT TTAAACATCAAAAATCGAGCCTACTGCACATATTTTGGTACCATCTGCCC ACAGTGTGAACGCTTCGCAACGAAATGATCGGTTATAATGCACCTTTTAA AATCGATTATCGATTACCCGGTGTTTATTTTAAAAGATTTAATGAATCTT TTAACTTGTCGCTTCGTTTTTTGAGCTTTTAGTTATCAAATGGAATTAGA TCGTAGGTTTTCCGGGAGCATTTACTTTGTTGTTCATCCTAATAGAGTCG TTTTCAGTTCCACGGAGTCCGTGTTCGAGATCGGACTTGCCGCCGTGTTG CAGTTTATCTGTGATCTCAAGCTTAAATAATACCCAATCCAGGTATGGAA GCAGTCCAATATACCCAATGGAATCATCTTCACCATCAGATACAACCGAA ATCCACAAACAATCGTGCAGCATTCAAGACCAGAGCAGCGTCCCCGTGCC GGACAGCTCTGGTGAAATTAACAACTGGATGGAGCCTGAGCCAGTTGACA GTCTCGAATTGTCAGGTGGTAAGAACCTGGAACATGCAATGCCACTTCTT CTTACTTACCTCGACCTTTCCCCAACAGAATATGCCGACAATGAAAGTGC AATTTTTGTCAGTGCTTCGGAGTATAACGAAAAAAAAGCACAGATCGATC AGCTGGTGCAAAAGATACTCACAATGGAGCAGCAGCAGCGGCAACTGGAG GAGAACGCGTCCGAAACCAAGGAGCTTTGCGATTTAAAGTTGCACCTGGA GAAGCTCAATGCCCGCCTGGAGGCGCTGGGCGAATTCCTGGACACTTTGC GTTTGCGGGAGGACCAGCAGGAGATCAAAATCGAAGATAACTCGGAACTG GTGGACCACACCGAGCAGCCCAAGTGGAGCAATTTGTACTCCGGTCTGAA CCGCTATCGACAAAAGGCCAACCACACTGCAGCGCAGTTCTATCAGCACA AGAGCAACATAATCGACAGTCTGAAGGTAAAATACTGACTATTGCACACC AAGGATTAATGGTTTAATAGCCAGGATTAATTGCTTTTATGCTTTTTATT AGTACTTTTATAAATTGTATATTTTTAAATCTTTAAATGCGCCCTATTCT AGACCCTGTATGAGCCCATTCAGCCACGTCCTGCAATCGATGACTTGGAA AAGCAACCCGCTTTGCTGTTAGTGCGCCTGCTAAAGCATCAGCAGTCTTG CTTGAAATGGATGCAATTTCGTGAGCGTCAGAAGATCTCTGGAGGAATCC TTGCCGACGACATGGGCCTTGGAAAAACTCTATCTATGATAGCCCTAATC TTGGCTTCGGAAGAAACTAAGAACAGAAAACGAGAAGAAAAGAAGAAAGC CTTGACGTTAAAGTGGACTCAGGAGTTTAATCGAGTATATTGTAAGGAAA TCCGTAAAATCAGCATGTTTGATGATGAAGAAGAGTCTGGAAAGGAGGAG GAGCAGTACGAGCCGCCGGAGAAGCGCACCTGTCACGTGAAGACTAAAAA AATCAATCAATTTCGAATTTTGGATGATGATGATAATGATGCCGGAGACA AAGCTGTAGTGGAGGATGAACAGAAAGATCTGCTAGCAAAGACTCCCGAA CCAGAGGTTTTCAGTTCGGATGAAGAGGAGGAGCACTTATCAAACGGCCG CTATCCCTCGGCAAACACATTAGTTGTTTGCCCCATGAGCGTTATGTGTC AGTGGGCCCATGAGGTGGCCTCCAAGGTAGCGCAAAATGCCATTAGGGTG CTGACTTTTCACGGACCCAATCGCCATGAAATCGGAATAGAGGCATTCAG GAGCTATGATTTAGTCATTACCTCGTATAATCTCGTAGTAAACGAGCTTA AACGATATGGAAACACTTCTCCACTGTTCGCCGTGTACTGGAACCGCGTG ATCCTCGACGAAGCTCACATCATTCGGAATTCTAAAACCAACTGCTGTAA CTCTGTATGCCAGTTGCGGGCGCATTGTCATTGGGCCCTGACTGGAACGC CTGTCCAGAATCGGGGCGTCGATGTGTTCGCCCTGCTGCGGTTTGTAAAT GTACCAAACTTTCAGGACCTCCAGCAGTGGAAAAAGAACCTAAACGAAAG CATGCTCGGACATCGCCGACTTAACTTTATAATAAAACCACTAATGCTGC GCAGGACAAAGCAAAAGCTACAGGCATCTGGCGACATGCCTGCGCTGCCT TCCCTTAAGATTGAACTTATATGCGTACAGCTATCGAAAACTGAAATGGC CGTGTACCAGATCCTGTCTGCCATATCCAAAAAAATCTTTACACAGTTCC TGCTCCAACGCGAGAAGGGCAACAGTGATTTAAATTATTACTCTCTGGAA AGAACCCCACAGTTTATAGCCGGACATATGTCCGACGAAAGGTACAACGA GATCTACGAAAGATTCCTTAAGTCGCTTGGCTACAATCCAGGGGAAAAGA TCCTTGGTATCTATATCCTGGTGCTACTGCTGCGGCTACGACAGTTTTGT TGCCATCCGGGACTAATGATTGGGGTAAATATATACATATTTTACTTTAT CACCCCACATAATCATACTCAACATCTTTCGTTAGATGCTGCGTGGTGCT TTGACCGCCGAGGACGTCCAGAACGTGAAGGTGGATGCCTCAGACGTGGA GGGCCAGCTCAAGATGGATGTCCTTGCCGAGTTGGATAAGTTTGACGAAA CCGATAGCGAAGATGACTGTTGTGACGAGGAGGACAGTACTAGAAGAGAT GGCAATTTCAAGTTGGAAGTGATAAAAGATGAAATTAAGGAGGAGAATGT GCCATGGGATTCTGGTGATGACCTGCCAACGGCCAGTTCTTTTGAGGATC AACTAGATAGTGCCAGAGCTCTTAAACTGCTCAATCCCCAGAATCCCATC TTTCAGTTCATACGCCCTTCTGCCAAACTAAAGATGGTCATTGATAAGCT AGAGGAACTGCTCACAGGCACCAACGACAAAATCATTGTTACATCTCAGT GGGTAAGCTATCTCGCAATCGTCCGTAAAAGACTGCAGGATCTATCATGG GAAACACTTGACTTTAATGGCCAGCTGACCGCCAAAGAACGCGAGATTGT ACTGCGAGACTTTAACGCGAATAACGAGAAGCGCGTTCTTCTACTCTCCC TCACCGCTGGCGGAGTGGGACTGAATCTGAACGTGGCCAATCATATGCTA ATTGTGGACCTCCACTGGAACCCGCAGCTGGAGCGACAGGCTCAGGACCG CATTTATCGATATGGTCAAACTAAGCCTACCTTCATCTACCGCTACATGT GCCAGGACACTGTAGAGCAACGAATTAAGTCCCTGCAAGATTGCAAGCTA GAAATTGCGAAAGTTGTGCTTCCAGAGGAAGGAGGAGAAGTGACCAAATG TGTTGGCGGTGGTCTCAACCTCGCGGAGCTAAAGAAACTCTTCGAGATGT GAGTCGAAGTATTTTAGTTAGTTTTAAGAAGATTATGTTTTTTTTTGTTT AAATTGTTCGCATACAAAAGCTTTACAATTTCACCAAAGTGTTTTTTAAC GGATTGAATTCGTTTACAATTGTGTATTAATACTACACAGACTACCTTTA ACGTTATACGTTACATTTGATATAGTCGCACGTCCATAAAGCATAAAGCA TATATATTCCCTTTTTTTCTATATTAAGAACAAAACGTACTAATAATAAA GCATACTAGTTGTTTTCATGATGTATGGATCATTCTTTTTGTCTATTTTT CCTTTTGTTCTCGCAAAACCACAACAAAGCTAAAAGAAAAAAGTTTGAAG CTCTAAAGATATATAAGAAGGCATTAAGTAGCATGTGGTAGCAATCAATC GATTGTTTAATTATTTTCAGTATAATAATGTATTGTGAAATATACAATTA AAAGGAAATTTCAATAATATAAATTTAGAGCTTATTCTCAGTATATTTGA GTTTCTGTGAAATATATAATTAAAACGAAACTTAAATAATATTAATTTTG AGCTTATGAAAGTAACAAAAGAATCATATTTAAGAAAATTCAAAGTAAGA ATCAACAACAGAAGTTTAGACCTGCGGTCATTATAATTATAATGAATAAT AAATCGTTTATATTCCTTTCACATATATTAATCTGCTTAATTCAATGGTT GTTTTCCAAGAGTATAACCGGTAGTCACCCGTTTGGACATGATCTTCTCC TACATCGCTATTACGTTGTTGCTGTGAATGCGTTTTTTGTGCTTTCGCAA GTAGTTAACATCTACAAATACCAATGAGCAAAATTCGCAACGAAACAGAT CTCCCATGTGACCACGCTCGTGCCTTTTGAGATGTTTTTCTGTTTTGAAC TCCTCGGAACAATAGGTACATTTTTTAAGATGATGTTGGCGATTGTGAGT AAGCATATGCCGCTTCAAGGCGTAGACACTACTGAACTTCTTTTGGCAAA TATCGCATATCGGTTTCCTGTTGTTAAATAAATAGAAGCAAATGATATTA GTTGATTCGCCTCGACTATCAGATACCCGTTAATCAGCTAGTAAAAGTGC GAGGGTTTTCTATTTCTATAAATTTTACTAAATCTTAGGGATTTAGCTCC TATAGTTAACGGGATCACGGCGTTCTTACGGACACGCAGACGGACGGACA GACTATTGATCCTGTGCAAGATTATTATTTCCTTCTACTAGTAAACCTTT TTATTACTTATCGTGTAACGGGTATACAATTTTAAAGTTTGGTTAAAGTT TGATTATTCAAATTTTCTTCGGCGAAATGGCTATCGCCAAAAATTTAAGT AAAAGAATAAATGAAAACAATAACTTAATGTCCGTTTGTTGGCTTTTTAA AGGTCTGAAACAAACTCAAAACCTTAATTTTCTAGATTTTTAATTCCAGA GATCTCTGCGGACAGACAGACGGAAAAATAGACGAACGGACGGACTGATG AGAACTTATGAACTCGGCTAGTGGTTCCGATTAAGAATATAAAGGGGTCA GATACGCTACCTTCGCTCGTCACAAATTTCTCAGCGGTACTAGGGTATAA GTATAACTATCAGGTATAACTATATTACATAAGACTGGTGGAGTTCCAAA CTCACGGCTTTAGCATAGGTGGAATGCTGCACGTGCCATTGAAGGTGTTC TTAGTCCACTTTGGTTTTAGATCCTGCGCTTGATCGCTGTCGTCCGAGTC AGGATCCTTCGTGGACTCCGATTTTGAAGAGCCCGGCCTTTGTTTGTGCT CTCTGCGATGGATTTCCAGCTGAACGTGTTCGATAAATACCGCTGAGCAC TGGCTGCAGGAGAGCGGACCGTCACTGTCGTGGGTGCGCAGGTGCCTTTT AAGGTGATCTTTACGCATGAAAGCCTTCGAGCAGTGGAAACACTTGTGCG CTGGCTTGCTTAGGTGGTTTCGCAAATGCCGCTTGAGGTTCGATTTTTGC ATATAAGTGCGTGGGCAGTAGGGACACCTGTTGCACAGATCGGTGATGTG GGTCCTTAACTGGGTCTGGGAACAAAATCGCTTAGAACAGTGCGGGCAGT TGTAGTAGCCATCGGCATCGCAGATCATTTTGGTACTTCTGAAAATCGGG AATATAATTATTTAAGCTTATTTAAGTTATTTTTAATTATTCATATAAAA GTATAAGTAATCAAAGATGTACCTTCAAATTTTTATAATTTTTCAATTAT TTGTCTATCTTGAGGCTTGATATTTATAACAAATTGCATTACCTTGTAGC TTCCTTTGGGATCATGTCTGCCTGTTCTTCTGTGCGACAAGTCCGCTTAC GAGGATGCAGGGTGAAGGACTCCGGTGGGCCATCAATATTTCCCTCTTGG AGCTTCGCTTGGAGTGTTTGTTTTTGACTAAGATCATCATCTGGTTTCTG CGTTTTTGTCATTTGCTGCGTATCCTGTTGACGATCGCTTTTGAGCTGCA TTTTCTGGTTTATTATCTGGTTCTTATCCCCATTACATGCAGCTAAGTGC ACTTGGTTTTCCGGAGCACCCGACTGGTTTAGGACGCGGAAGAAGTGCTG GTAGCTCTGCTCGCTTTGCCACTTGAACCGGAAAGCATTCTGCACGGCCA GGACGCAGGAAACGCATATGAACTGCGGCAGCAGGTCGCCGCGTTTCACT GGACGTTCGGTACACCTGGCCAGGATGTGCGAGAGGCTCATCTCCGGTTC GTCGAGCACAGGATCCCTTACATTGGCGAATATATCTACCAGGGTGCCGG TCTCGTCCATACAAGTCCGGCACACGTTCTTCGCGCTGTGCATCATCTAA ATCAACAACCAAATGCAATGTTTTTTAATAAAAGAACAGTTTACGACATC TTATGAATTGACCATTGACATTGGCCTTGTTTTGCAAACTAATAATCCCG TTTCGCTGGTTTTACAGTTATTGCTGGTAAATTATATGAATAAACGGCAC ATTTTTTAAAGAGTTCAATTGATTTCTCATTCTACACAAGTGTAAGTGTT CACTTTTTGGAGAATTGGATGATAACTGGAACTGCAAAGAAACCAACCGT CGCACTGATCATTTGTACATTTTTTTTAGTGCTGAATAATACATGTACAC ATGGAAAACAATTATTCAGAATAAAAAAAATTGAGATTGATATGATATGA AAAAATATGTATATATGTATATATATGTATATATGTATGTATATTTGTAT TAATAACACAAATATTTTTCAGGCAAGCTGGCTTTCATTGTAATTTAATT ACGATTTGGTGTTCTATTTATTTTGGGAATAGAGTACTAGTATTTACACA AAACATCTGATGATTCATTTATGAAATAAAAATTCAATATTTTCAATAGA AGCTCTACACAGCAAATAAAAGCTTTTGATGAAAATATGTTTAACCCGCC GCTAAAATTTTAAAATCAATCCAATTACATTAATTCTGCATTACAATATA AACCCAAGCTTTATTGATTAAAACCATACTGTGCGTAATATATACATTTC AGTTTCTTACAATTTAAATATCTAGTAAAAAAAATTCGCTAATTGACAGT ACTATATAACTGAAACAGGTTGGCAGCCCGAAGGCAACAGCTGATTCGCT TTATGAATGCGGAAAATTTGTCTGTGTGTTTATGAATATTATGCCGATCA ATGGAACGAGGAATAGTTATGTGAGTGGCTACGCGGCAATCACAACATAC GTACTCTGTAGAAAACCCCGCTTGACTCCTTGCCAGACTCGATAAATTGG CCCGCAGCGCTTTGCGGTTGCACAGAATACCGCAAATCAACCGCCCATTG GCCCCTGATATTCATTTCAAGCGCCAGCACAGCAGATCTGGGTCAGATTG CAAGGAAATCTGGGAAATGCTGAGCCAACTGCCTCTGTTCGCTGGGGGCG AGATTGTTCGGGGCTTCGGACGCGGCTCCAAAGAGCTGGGCATCCCAACA GGTTGGTGGCGACGTTAGGCGAATTGCGAAGGTCATTTCTAATTGATAAC CAAACCACTTGTTAGCTAACTTTCCGCTGGAGGTGGTGAAATCGCTGCCG GAATCCCTGCCCACTGGCGCGTACTACGGTTGGGCAAACGTGGATAATGG ACCCGTGCACAAGATGGTCCTCAGCATCGGCTGGAATCCCTTCTACAACA ACAAGGAGAAGAGCGTGGAGACGCACATGCTACACGACTTTAACTGTGAC CTTTACGGCCAGACACTCAAGATATGCATTGTAGGCTACCTGCGACCGGA GCGCAGTTTCGACTCCCTGGAGTCACTGATTGCCGCCATCCGCGGGGACA TCGAGCAGGCCAAGGCGTTCCTCGACGAGGCGGACAAGGCCAAGCTGAAG GAGGCTCCGTTCTTTACGGAGAAGCTCTGCTCGTCGAAATAGCGATGGCG TAGGTCAGTCTGGAAAAGGAGGCTTTGCTGAAGGACGCACTACTACTCTT CGCACGGCTTTGAAATAGTTATTCCATCAGTTATCTTATCTCTCAATTTG CGCGATGTGCAAAGCGGAATTCGAATATCGAATCAAGTACTTAAGCTAAA CGTTTTCATTAAATTCCTACTGCTCATAATGACACCAACAAATTGAACCA ATCGCATTTCAGTTTGATACTTATCAAATGTATAAAAGAAACCGTTTTTG TAAAAATGTTCCTACTGTGAATTTTTTCTAATATATTTATCTCTTAGTGG CGTTTTTATTGAGGGATTGCAGTGAACTTATTTTCAATTGTTATACATAT GTAGTTAATTATTATTTATTTATTTCACGAAACATTTTTTATATTTCTGG TTTTAATTGCCTACGTGTTAAAAAAAAAACTGTTAAATATTATATATACG AACATACACATACAATTTTTAATTAATTTTAATTGCGCAAAATAACTTTA ATTCAATTTAAAGCTTATTATTTAGTTTGATTGCGTATATTTTATATAAA CGAATAAAATCAAATTATAATGTGTATATTGTTTTGTGTACTAAATTACA AATTAGGTAAAATTCCAATTTGAAAATACAGACTATAGAATGCTATCGAT CCATCAGCACACCGCACTATCGATATCAGCGACCGATCGATATTGGGCTT GATCTCGACCGATTCGGGAAAAACTGAGCTGCGCGTGCGAGCGTGCGAGG ATTTTTCTTGTATAAAACCGTTGCGTAAATCAGCAGGTAAATCAGATCGG CGTCAACTGCGCCACTGCCTGCAATCAGTTGCCTTCAACCAGCATATTGT ACCGATTTTTCAGCAGCAACATGTCAGCGCCACAGCAACAACAACAGTCG CAGCAGAAGCAACAACAACATGTGCGCGTGGTCGAGCAACAACAGGTGGA ACCAGCTGAGGCGGTGACCTCCAGCATGGAATCGGAATCCATCTCGGCCA GCAAGGAGCTAACCGGTTTGACGCACGAGTGCGGCGTTTTCGGGGCAATC GCTTGCGGAGATTGGCCCACCCAAATGGACATTGCACACGTGATCTGTTT GGGGCTGGTGGCACTGCAGCATCGTGGGCAGGAGTCTGCGGGCATAGCGA CCAGCGAGGGAAAGTGCTCCAAGAACTTCAACGTGCACAAGGGCATGGGT ATGATCAGCACCCTGTTCAACGACGACTCCATGAAGAAGCTTCGTGGCAA CCTGGGCATCGGTCATACACGCTACTCGACCGCTGGCGGATCCGGAGTGG TTAACTGTCAGCCCTTTGAGGTACATACGACACATGGAGCATTGGCCCTG GCCCACAATGGTGAGCTTGTTAACAACGAATCTCTAAGAAGGGAGGTTTT GGCCAGAGGCGTGGGCTTATCCACGCACAGCGACAGTGAGTTGATCGCCC AGTCGTTGTGCTGCGCCCCGGAGGATGTTTCCGAACTGGATGGACCCAAC TGGCCAGCTAGGATCAGGCATTTCATGATGCTGGCGCCACTCTCCTACTC GCTGGTCATCATGCTAAAGGACAAAATCTACGCCGTGAGGGACACCTATG GAAATAGGCCGCTATGCATTGGCAAGATAGTGCCCATCAATGCTGGGCAC GGAAATAACTTAGACACACCTGCCGATGGTTGGGTGGTGTCCAGTGAGAG CTGTGGCTTCCTGTCGATCGGTGCCAGATACGTCCGCGAAGTGGAGCCTG GAGAGATAGTGGAGCTGTCGCGAAGTGGCTACCGCACGGTGGACATTGTG GAAAGACCCGACTTCAAGCGCATGGCCTTTTGTATATTTGAGTACGTTTA CTTCGCCCGCGGAGACAGCATCTTCGAGGGTCAGATGGTGTACACAGTGA GGCTGCAGTGCGGCCGGCAGCTGTGGCGAGAGGCTCCAGTGGAGGCGGAT ATTGTGAGTTCCGTTCCCGAGTCTGGCACAGCGGCGGCGCATGGCTATGC CCGTGAGTCTGGCATTGAATTTGCCGAGGTTCTCTGCAGGAATCGCTACG TGGGACGGACGTTTATTCAACCCTCTACCCGGCTGCGGCAGTTGGGAGTA GCCAAGAAGTTCGGAGCCCTATCCGAGAACGTGGCTGGCAAGAGATTGGT CCTGATAGACGATTCCATTGTGCGCGGCAACACCATTGGACCAATAATCA AGCTGCTACGGGATGCAGGCGCCCGGGAGGTGCACATCCGCATTGCCAGC CCACCGCTGCAGTACCCATGCTATATGGGTATAAATATTCCAACTCGAGA GGAATTGATTGCCAACAAGCTGAACCCCGACCAACTAGCTAGGCATGTGG GCGCCGACAGTCTGGCTTATCTTAGTGTGGAGGGACTAGTGGAGGCTGTC CAACTAAAGCACCGCGATGCAGGCGATAGTAAATCCAAGGGAACGGGCCA CTGCACCGCCTGTCTCACTGGTGAATATCCCGGTGGGCTGCCCGATGAGT TGAGCTGGTGATACCGATTGAAGCTCATAAGTGCCAAAAGACGAAAAAGG CTTTTGGAAACCAGTTTTGCACGCAATTGCCCACTACGAAATAACAAAAA TTGCAGTATAAATAGCCATAGAGGGCTCGGAATTACTGTCACAAATTTTG CATTTAGTTTATCTAGCATTACAGCCCACCCATTCCTATTTACACTCTAC CTTATTAGATCTTAAGTAAGCAGCCCACGTGCTTCCCCAAGCTAAAAGAC ACCGATTTATGTCTGGTTTTGCCTCTGGAACTTTACTCATAGTACAAAAT ACATAACTCTTTGTTGCCCATCTTGAATATCACTAAAATTTGTTGTTTGC AAATGCCAATAATAAAGACACTTAGACTATTGATTAAACAGACTCTATTT TCTCTCTCTAGCTATCGAAGATATGAAATTACGTGCATGATATCGAGCAG TATGCTCCAAGGTCCGAAGGCCAGTTGCTCTGTGCGGCAATGCACCATTT CCTAAGGAGGTCATGGGTTCCACAAGCACTGGAGGCATTCGGATATGATT CTTTTGAATTTTAGATGATTAATTGGTGATAAGTCCACTGCAATAAATAC TTAAAAACAGATTCAATTGTCGTGCTCTGTTGCTTTGCAAATAATCATTC TTATCAATACTGAGGAAACACTTTAATTTTACACAAATAATGAGTTGACC AATGATATGGCAAAATTTCTTGTCTAAGGTTTACTTTAACAACAGAAACT GGCGTTGAAGTCGTAAATAGTTTGAAGTAACATCCGAATATGTATGTACA TAGTTTTTATTATAACTTATGCTAGTCCACCATTTGTATTATATCTGTAT CTTACTTGTCGTCGTCATCCTTGTAGTCAATGTCATGATCTTTATAGTCT CCATCGTGGTCTTTATAATCTGTCGACGAAGTTCCTATACTTTCTAGAGA ATAGGAACTTCCCGAGGATCCGCTGCCGCCGGCGTTGCTGCGCCACTCCA TCTTCTGGCTATCCAGGATCTGGCGCAGGCTGCTGGCCATGCCCTGGAAG TACAGGTTCTCGGGGCCCTGGAACAGCACCTCCAGGGTGCTATCCAGGCC CAGCAGGGGGTTGGGGATGGGCTTGCCCTCGAGCTTGTACAGCTCATCCA TGCCCAGGGTGATGCCGGCGGCGGTCACGAACTCCAGCAGCACCATGTGA TCGCGCTTCTCGTTGGGGTCCTTGGACAGCACGCTCTGGGTGCTCAGGTA GTGGTTATCGGGCAGCAGCACTGGGCCGTCGCCGATGGGGGTGTTCTGCT GGTAGTGATCGGCCAGCTGCACGGAGCCATCCTCCACATTGTGGCGGATC TTGAAGTTGGCCTTGATGCCGTTCTTCTGCTTATCGGCGGTGATGTACAC GTTGTGGCTGTTGAAGTTGTACTCCAGCTTGTGGCCCAGGATGTTGCCAT CCTCCTTGAAATCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTATCG CCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGGTGCCGTCATCCTTGAA GCTGATGGTGCGCTCCTGCACGTAGCCCTCGGGCATGGCGCTCTTGAAGA AATCGTGCTGCTTCATGTGATCGGGGTAGCGGCTGAAGCACTGCACGCCG TAGGTCAGGGTGGTCACCAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGT GGTGCAGATGAACTTCAGGGTCAGCTTGCCGTTGGTGGCGTCGCCCTCGC CCTCGCCGCGCACGCTGAACTTGTGGCCGTTCACGTCGCCATCCAGCTCC ACCAGGATGGGCACCACGCCGGTGAACAGCTCCTCGCCCTTGGACACCAT GAATTCATCAAGTGGATCTTGGTTTGTGTGAACCTCGTCCAGCGGGTCCT GATTGGTATGCACTTCAGACTCCAGCATATTCTCGAAGTCCTTCAGCTCC AATTCCCTTTCAATAACCTGTGTGTAGAGATTATCAAGCGTTTCCTGCAT TCGTTGTTTGAGTGTGGCATTCTGAATGGAAGCAATTTCCGTTGACTTTT GCACCTGCTGCGCTTTCAGTTCACGAATCTGGCGCGTCAGTTGATTGATC TTCTGCTGGACCTGTTGCTGCGTGTACTGCGGCTGCGGTTCGTCTATGAA TTCCATGTTCTCGAACTCCTCGCGCTTGGCTAGCATTTGGCTATCGTAGA AGCCACTGGGAGCAGCAAGGTTGGAGCTTGATCCGGCGGCGCTGAGCTTA GGACTGCTGGCTTCATGCCCAAACATAGACTTGCTGAACACGTTCTGCTC CATTTTCACTACGCCCGCTCCAGTATTACTGCCACTAGCGCCAAAGAAGT CCGACATTCGTGAATCATCAGCCGAGAGTCGTGAGGATTCCTCCATCACC CGCCGCTGCATGGTGTTATTGCCCCGATCGGGCTCATCCTCGTCATCCGT GCTGGACACTTCCTCGCCGAAGATGTCGTGGACAGCAACTCCCATGTTCG GCGCCCGGTGTGAGGGAAAGTTGCTGGCTTCGTCATCATCGGACTCCACT TGGAGGTGCCGCTGGGAGCTCATTTCCATGATCGTCTTTTCGCTGGCATG CATGGTGCTTTCGTCCTGCAAATCGTCATCCGCATCGTTGTAGGGTTTGA TGTCCGATTGCTCCAGTTCATCCATTGGCTTGTCCTCTTCGTTTATGATT TCATAGTCAACTCTGACAGCCTCGTTGTCAATGCGCAGCAGATGTTTCAC TTCCTTCTCAATCTCGGGAGCTTCGACATTCTTTTTCTTCAGAGTTTTGC GGAATCGTCGTTTTCTCACATTCTTGCACGGCGGTGTGATGCCGTGCGGA AAGAGGTATTTTTTGTCCACCTTGTTGGGGTCCTTCTTTTTGTTCTTGTT GGGCGACTCCTTTTCCGTCTCGTCCTCCCGCTCCTCCTTGCAAATGAGTA TTTGGCAGATGTCTGCCGACTTGTAGAAGCTCTTGTTGTCAATGGTCTTG TAGCTCTCGACGACGGTGGGCAAATCCACGAGTTTCGTGTACAGTATCTG ATCATCTATTCGCACTTCACCGTACCTCAGATCCGGATCCAGTTGGATGG TCAGCCGGTCCTTAATGGTGCCAGCATTTATTGCCTCATGGACCGTGTCC GCCAGTTCCTGCGGAGAATCCGTCAATTTGCACGGCTTGTTGTGATGTTT GTTTGTGCTATGTATGGCTTACCTTCGGCACGCGCATGATAAACTGGCTC TCCAGCTCTACGCCATCATCCCGGGCCTTGTGCTCCGCTTGCTTAACCTT GTCGCTCTTCTTTTCAAACATTTCAATGCGATTTTTCCAGAAAAATACAA CTTCTTTTGAAGACACTAAATGCTCATTAGAGATGGGAGTTAGATGGGGC ACCGCTAGTGATGGCATTCACGTCACAGTTATCGCTGCGAGCACGACGAA TATTTAAAATGGTTCACACTGCAGCCGCATCTGCAGAAATATAAGCCCTG TATACCGCAAAATGGCAAGGCATTTTATTTTTTAATCTTTTTACCAACAA ATTTAATCATAAAGGTGAAGACCGAATGGGTTTGCCGTACGTTGAAAGGG GATGAGCCGCACTGCTTTGAATATCGGATGTGAGTCCGCTGAACTATCGA TAAGGCAATCGTCAGCCAACCCTGCTCCAATTTCGTCTTCTCATCCCTTT TGCCATGACGGAAAACACGAATTGATGTGGATTTCTACTAATTTATAACA TAAAAATACGTCAAAAGTTGAACAATCAGAGATCGAGCTAGTCGAAGGTC AGCAAGCAAGGCGGACGACATGCAGGAGAAGTGGTTACTGCCCGCACTTT CGCTGGCGCTCCTATTGGGCACCTGCTCGGCGCTCTACGAAGACCAGATC AAAAAGTTCGACTGGTGAGTGTGGTACGATATCTGACCATTGACCCGGCG CTAATACGGCGGATATGTGCGGCTTTTGCAGGCGAGGCGTCAATGTGGGA GCACTGAAGCAGTCTCGCGTCGACCTCAACCATTTTCAGCCGCGGATTCT GGTCACCACCTATGAGGGAGTGGTGGCCAGTCTGTGCGTAAAGACCGGCG AATTGGTGTGGCGGCAGGTGCTCGAGCAGAAGCCGCGCGGCGACGTCAAG CTGCTCCAGGTGAGCGGATTCGCCGATGACAGCAGCGACACGGCCGCCGC TCCGATGGGCAGCAACATGGGCTTCGACATGCTCACCGTTCAGGGACACG CTCCTGCTTTGGTGCGCGGCTGGAACACCAATATGGGTGCCCTTGAGTGG GAGTGGTCCATCATGCCCATGAACACGGAGCGGGCCCAGGACGCCATGTG GATCTACAGCAAATCCGTGCTATATCACGTGCTGCCTGCCTGGCGGAGCC ACCTCGAGGTGACGGCGTATTTCGCCAGCTCGGGCCACAGCACTGGCAGC ACCAGCAAGGTAATAGCTCCTTGGATCACCTCAGAGAGCTGCACCCTTAG CGGCACCTTCTACGTTTGTACGGACGGAAAGCAGTTGATTAGTTTGGATC TCGTTTCCAAAAGCGGTCAAGTAATCCGTACTTCGCTCGAGGCGGAGCCG AAGGGAAAAACTCAGGCCTTGACGGTGAGGAAAAAACTTTGCTATTGCTT TTATTGAAAGTGAAGTAATAGATTGTTGTAAGTGAAGTTATAATTCGTCC AAACATTTCTATAGGGTCTGAATGGTGTTGTGATTGTGGATGGGAAGCCA ATTAGTGTCAACAAGGACCAATCGATCTGCGGTGATCTGCGAAGCTCCAG CTTCGCCGTGGGCAGCTTTAACTATCGCAAAGTCTTGGCCTATGCAGATC TGTCCTCTGGAGTACGTTTAAACTTATATTTACTGTTCTATTCTACTATT TCTATGTGAAAACTAATTGTTTCTTTCCCTGTGCGTATGAACAGATCCTC AGGATCAATGCTCTGTATTTGGATAACTGTGCACCGGCAGCGGAGTTGGA GCAGAGTCTGCCATTCCCCGAGCATTTTGGCACTCCGTCGCTGAGCAACT TCGACTGTAAGCAGAAGCGCAATGGCGAGGGCAAGAACTGTCTGTTTTTG TTTAGCAGCACCTCGGAGTCCATCGTGGCAGTGCAGCATGGACGCGTTCG TTGGTCGCGCGAGGAGTCGCTGGCAAATGTGATCGACTCGCAGTTTGTGG ATCTACCGCTTGCCGATACTGAGGGCACATTGGAGAACGAGATGAAGGGC AAGGCCGGTGAGTGTACTTGACTTATGCACTACTTTAAGGTGAACTCATA AAATTTATTATTGAAAATTCATACCAAAAGGGGATTTCACAAGTTTTGAG AGTAAGTGAACGTTCACAGCAAACTAATCATGCAATATTGTTTGTTACAT GTTTATCACTTTTAATTTTGTGTTTTTTTTTTTAATGTTTATTGAACGTA CCACTAATCTAAAAACGAATGTTTACTAACAAATTCAAGCATGCTTCGCT AGTTTAAAGCTAAGTGTATTACTTTTACTTTTTTACTGTCCAATAATTAA TTTCCAATGTAAACTAAAATATGAAATATCTTTGGTATATCGTTAATGTT TAAAGATCATATTAAATTGTTCTTTACTAATATTTATGTTTTCACCACGT AAACAGGAGACATTGCCAGTGCCTTTTTGCGTCGCATCACCACTCAAGCT GTTCAGATTCGGAGCTTGTTCCTTCATGTTATCGGACTGGGTCCTCCACC TACAGACACCCAGCGAGCCGGCTTGGTCAGAGACTCCTTTGGCCTCCACA AGATGCTGGTTTTACTGACGCGTGCTGGAAAGATTTTTGGCATTGACAAT GTCTCTGGGAAACATCACTGGCAGCTGCATCTTCCCAATGTTATTGGATT CGCTAACGACGAACAGATGCGTCTGATTGTCCAGCGCTCGGCCAAACACT TTCCACTTCAGCCGTTGTGCACTATTTTGGGCAAGAATGCTGTAGGTCTG ACTGACAAATCGCATAGTTCCCACGCTAATTCTAATCGTTTATAGGTCAG CGGCAATGGTGTGCTCTATCGTTTTAATCCTATTACCGGCAAAGTAGCCG AAGGTGGCCTTGTTCAGCTGGACTACAGAATTAAGCAGCTTTCGTTGCTG GGAGAAACGGAAAAGGACTTTCTGAAGGGCATTCTGTTACTGGATGCTTC GAATAAGGTACATGTTTATCCCGAACATGCGGCCCCACTGGTAAGATATA AAATTCTATGATATATCAATAGAGTTGAAAATCTTTACATGCACGTACAG GCTGATGGCATGTATCTGTACACCGCCGATTTGAAAACTGCAGAGCTGGC CGGCTACTTTGTTAAATATGCGGGCGGGGTAAGTAATGCAGCCTTTTAAT ATGAAAGCACTTAACTTATTAAACCATTTCCGTTAGCAACTGTCCAGCAC GCACATCTGGAATGCTCGCCTGGGCGGCCACAATTCCGAGCAGCAGATTA TCGGCGTTGCCGGCAAGAATCCCATCGAGCATGTCCACTCCCAGGGACGT GTGCTGGGCGATCGATCGGTGCTGTACAAGTACATCAACCCTAATCTAGT GGCTTTCGTCACACAGGCACCGGATTCCACACACAAATGTGAGTCTGCAT GCGCTTCGTGTAATTAAGCATTCATTTAAATGGCACTTACTCCATAGCCG TGCTAAATTTGTATCTGGTTGATGTGGTCTCCGGCTCTGTGGTTTTCACC ATGACGCATCGTAAGGTCCGTGCACCACTGAGCATTGTCCACTCCGAAAA CTGGCTTGCCTACTCCTACTTCAACGAGAAATTGCGTCGCACAGAGATTA GTAAGTTACAACAGCGATAGCCATTGACAAGTACCTATATTTACTAAACT TTATTTACTTGCTACAGCCACAATCGAACTGTACGAGGGCAAGAGTCAGG CAAACAGCAGTGTTTGGAGTTCCTTGCAAGCTCCGCCAATGCCCCTCGTG GAGCGCCAGTCTTATATACTGCCCACAATAGTTGAGGCTCTGCGGGAAAC TATCACGGAGCGCGGAATCACCAACAAGCATGTGCTTAGTGAGCATTAAC GAAAGTAATTTGAACGCCAAATAGGATGCTAACCATTTGTCATTAATTCT AGTCGGCACTGCCAGTGGTTCCATTGTGGAAATGCCGTGGCATTTGCTGG ATCCCCGACGTCCTATCGCATCCACGACTCAGGGACGTGAAGAAGGAGCC ATCCCCTACATACCCGAGCTGCCTTTGCCAACAGAGAGCCACATAAATTA CAACCAGACGGTTGCCCGTCTGCGTAATATTTACACCGCGCCCAGTGGCT TGGAGAGTACCTGTCTAGTCGTTGCTACGGGCTTAGGTAAGGGAGATTTA TCAAACGCGATTTTGGTTAAAGCACTGTAAACCATTTTTATTTGACAGAT TTGTTCGTTACGCGCGTGGCGCCATCAAAGACGTTCGACTTGCTGAAGGA GGACTTTGATTATATTCTCATTTCCATAGTGCTAGTCGCGCTCACATCAG GCTCGTTGATTGTTAAGCATTTAGCGTCGCGTAAATTGCTCAAGCAGGCG TGGAAATAGGCTTGGCATTATTATTAAATAATTGCTTTAAATATATATAA ATTGTACTGCGACCAAATACCACAAGGGAGGATGGAATGATGATGAGAGA ATGTAAATCGGCGAGATACTATTGATATATATAACAGAATTCTGATAGCT GCATTACATCCCACAATGCGAATAAAACCTTTTATCAACGCTAAGCCTAG GCAATTATTTATAACTAATTATATAGCGTTAAACATCAAATAACTATAAT TAGCTGTTGAAAGGTTTTCATTGCATGTTCTGTTCCTTTGATTTGTGTTC GTTTAAATTTCCATTTGAAAATATCAGCATTGAAAGAGTGTTTAAAAAGT ATAGTCAATAAAAGCATTTGTAAAGGTGGACAACGGTAAAGTAAATAAAC AATTTTTTCATCAGAATTAACTGATTGTTGGGATTAATTAGGAGGTGGAT TCAAAAAATTTTTGATAATTAAAACAAAAAATATAAATAATAAAAATACA ATTAAATCAAAAATTCATAGCGTCTATTACCTGATTTATTTAGGACAATT TTTTTTAGAATTTCCTGTAAAGTATAAAAGGAATTATTATTATAATACTT ATCTCAAAAATGAAGTAATTTTCACCGTCTTATAACATTGTAAGAAAGTT GTGGTTTTATAGCTTAATAAATTAAAAATACAAATAAAAAAATTTTTAAA TGGGCGCCAAAAATCAGCTGAAAGCTTGTGTGTTTTCCAACACCGACCAT CCAACTTTAACCGACTGAAACATATGTTTATTCTCTTCTTCTTCCGCAAA ATTGAAAGGATGGCACTGCGTGTTTTTGGCTTAAATATAGTAAAAAATAA CAGGAATCTGCTGCAAAATGCATGCAAATCCAGGGCACCGATGCCATGCT ACATGGTTGGTACAATAGTCAAGTCAATAGACTTGACACTTTTCACTGTT CCCAATTGTGAGACCAAACGTTTGCATAACCTTTCAGGCAGCGGCTCCAT TTGCCACCGATGTGACCGTCCAGGCTGCTCCGGCGGCTGTCCAGAAGCAA AGGGTGAGCAAGGCCATGCGGGCGTACCTGAAAAGAGCCACCGAACACGA CGAGTTCATGAAGACCCAGCACCTGGAGTTCCAGATCGGAAAGCGGCACC TGGCCAACATGATGGGCGCCGATGCGGAGACGTTTACCCAGGAGGACATA GACGTGAGATATTTGGCTATGAAAATTTTAAGGGGCTATTTTACCTCATT ATCAATTACAGGAGGCGATATCCTATCTGTTCCCTTCCGGATTGTACGAC CAAAAGGCCCGGCCGGCTATGAAGTCACCCGAGGTTGTCTTCCCCGCCCG CAAGGCTGCGGAATTCGATGAGACGGGCAGACCATTCCACAGCATGTTCT ACACCGGCAAACCCAACTTCTTCCAACTGCTTCATGTGAGTAATTGCGCA ACTTGGGAACTTCATTACTTAAGAAAGAAGAATGATGAATTAATTTTAAG TGGTTTGGTAGAAAGGTATTAACTACTTTTCCTTTTTAATTACCAGGACA TTGTAGAAGAAACTAACAAGCTGGCGGATCTGGAGGAGCGCATGCTACGG CGCGGCAATAAACCCGATGAGAACCAAAAACTGTAAACAAGCTATGCATT TTTTGAAAATTAAGTACTTTGACCTTGTTTTATATATTTTATTTTAGTGA GATTGCCGGCTTTCAGCTGCTGCCCAAGGACCAGTTGGAACTTTTGCTAG TTGAGAGCATTGCCGATATCGAATACTCCAACTTTACCAACTCCATGGAT CGCCTGATCGCATCGCCATATGCTTACAAGAGCAAAGCATTCATCGAGCG ATACATGAAACCGCTGATGGACCAGTCCAAGCAGCTGGAGGTGCCCAAAC CAAGGATCGATGAAGAGGGTCGCCAGTACATCACCACCTACGAGTGCCTG CGCAAAACTGCTAGAGCCGATGTCACAGTGCGGCTACCCGGAACAGGAAA AATCAGCATTAATGGAAAGGATATCTCATACTTTGAGGACGAAAACTGCA GAGAACAGGTGAGTGAAGTCATGTACAGCTTAAGCTTCTGCTGAGGATAG GTTCCTTGTTGAAATATGAATTCACAACTGCAGTTAAGAGCAATTGAAAA TCCTATTGAATTAATATTACGAAAAGTTTATTCTTGAGACTTTATTCAAT TGAAATGATATATTATAAAATTTATATCAGTTTATATCAGTTACCTTGAC ATCGCTCAATTTGGCCGACAGCTGCAAATAAGAACGTCTCTTTTCATAAC AATAGATATATAGCATATACTTTATTAAGAGTAATAATTTGCATTAAATT ACTATATAAACGATTCTCTGACGACAACGCCAAAACAACAAAGACACAGC CTGGAACCAGCCACAAATCAATCCTGCCAACTGCTCGCCTCTAGTTCAAC TAAACGCTAGTTATAGTATTTGTATCAATAGTGTAGTGTATGTAGGATAT ATGGCTATATAGCGTATGCATATTGCGCCTGGCGCATCGATATCAAAATT GGTTTAACTACAACTCGCTGCTACGATAATATCAACAATGTTCTGGATTC TTTGGGGCCTACACGACCCCCTTACGTCTAAAAAAGGTCAAACTGTGATC TATAAATATTCCGAATGGGGTGCAGTAAATGCTCCTGCTACTTGCGCAGA TTCTGTTTCTGCTGATTGGAGATCACAATCAGCAGCTTGTCGATCACCTT GCTGGCTTGCTGTTGCTGCGAGATGAGCGCCTGCTTTAGCTCCTGGATCT CCTGGGTGAGGAACTCGATCCGATCAGCATTGTCATCGATCTTTGTGGTT AGTGTGGTGAATTGCCCGGCATCCGGGTCCGAATCGGGTAGTACATATCC GGTCGTGGCGCCATTATTGTTGTTATACTTGTTCTTGTACGACAAATAGT TTTCGGCTGAGTTCTTTGACGAGATAGTATGACCGAAATGCTTGCGCATT TTTCCTACTTCATAAGCCTTCATTAGGATTTCCCGGGGCAAGCGTTTCTC GCTGGGATTCAGTGGCTTGACGCACAGAACCACTCTATAAGCTTGGGGAG AGACCAGCGCGGTGTAATGGAGCAAGTTGCGCAGCCATGTCGGAAGGTAG CCGTTGAATAGCGCCGACTCTATGTAGCTTATCAGCTTCGTTTGACGCAC GAGCTTAGACAACCCCGCCGTCTTCTTCAATCCTTGGATATCATGCACTG CAATGCCCACGAGCAGGTTCATCAGAATGATGGTCACGAACAGCAGGAAC AGAACAAAAGTGATTTGTGCGCTGACTTCTAGCAGGAAAGGTGGATCCTT GCCTTCGGGATCGTTGATGAGCAGCGATAAATCCTGTTCACCAATCATCA TCACCAGCACTGTTATGAAGCCCATAAACGGATTGGCAAACGACGACGAC GATGGGAAGATAACACAGAAACTGATGGTAAAACCAATCAGCATGCAGGA ATAGGCCATAAATAGCTTTGCGAATTCCCCCTGGACTCTCGTGTACATGG CCACATAGACATCGAAGACCGGCAGCTGACCTATCATCAACATGAGATTT GTCCAACCGAGCAGCACGGCGAAGGCGCCTATGTGGTTTTGAAACGTGTA CGTCTTGTTGGTGTAGATGTAGGATATAACAAACACGCTGGTTATCACGA ACCACTCCATTATGTTCTCCACTTGCGTTACGTAGTGCCGAAATGAGGAG TAGCCCGTAATGCCATATAGCTTTCGAAAAATCTCCACTATGGTGATGGC AACCAGAACCCACCATTGCATCTCCATCACAAAGGGGTTGTTTCTGAGCA TATCTCCCAGGATGGATTGCTTCTGGCACAACTCCTGCGCTGGAATGGTC GTGTTGTCGTTCTTGCTCCCATTGTAGCAGTTGTGGGCCAAAGCAGTCAG CACGTAAAGCGTGAGGAAAAGCACGAAGCTGAAGCAGAAGATGAGCCTGC CAATGTAGTACTTGCGGATCTTGCCCCACTTGATGTACAGAAACGAGGAG CAGAGCGGGTGCTCCAGTATCTCCTTCTGACCCTCGTCGACGAACGTGTT TAGGTAGCTGATCTCGCGCGGATGACAGTGCTGTAGCAGCTGACGGAAGT CCAGCTCCAATTCCACCTCACGGTTCACGGGGTCCTGTTAGGGAGATAAA GGAAGGGATAATATGCGGAATTCCAATGGGAAAAGAAATAAGACTATTTA CCTGCGAGTGGTGCAGCGTAATAGCTGCGTCCAGTTTCTGTCTGATCATG GCCACTGAAGCCGGGGTCTTCCGGGTGATAACGTTCAACGCGGAGGTACC TTTCTTCGATTTGGTGGTCACATCCGCTCCGTGGAATATCAGCATCTCGA CGCACTGCACCAGCCCATCCAACGCAGCCAGGTGAAGAGCTGTAAACCCG TAAATGTCCTTATGATTGACATTGGCACCCCACTGGATGAGCGTTTCCAT GATGTCATAGGCGTTCTCCGATTTTCCCACCGCCGCGTGAAGCGGAGTAC GGTGATCGAAGTCCTCGGCATTGGCGTCGGCATTGCCATTCCTCAGCAAC GATTCTACGCAGTCCAGACTGGAAGTTCTAGCTGCCAGGTGGAGCGGTGT GAAACCGCGATGGTTCTTCAACTTCGCATCAGCACCTTTGGCCAGGAGTA AGTCCACACACTCCACGTTGCCCTCATCTGCTGCCAGATGCAAGGCTGTG GACTCCTTTTCGCGGATGCAGATACGCACATTGGCATCTGCATTGGGAGC ATTCAGTAAGGCTTCCAGACACTGAATATTGCCCAGATCAGCTGCCAGGT GAATGGCATTGGTGCCATTCGGTTTGAGCGAGTTGACGTCGGCGCCTTCG GCAATGAAGATCTGCAGACACTCCAGGGCATTGGAACGCACGGCGCAGTG CAGCAGGCTCTCCTCGCAGTTTGGCTTGCTGGTGTCCTTGGATATGTCCG CCCCATTGTTGATCAGTAGCTTTGCTGCCTCCGCAGCATTTCCAAAGGCT GCGCAGTGCAGAGGGGTGTAGCACTTGGACTGCAGATTGACATTCAAACC CTTGGCGACCAGAAGGCCCAAGGTGGCCAAGCAGCCACTGAAGGCGCTAA GGTGCAAGGCTGATATTCCGTTCTGATCGCAGAAGTGCAGGTCGGCTCCC GCCTCCAGCAGACTCTCGATCAGATCCCAGCGCTTGAGGTACGCGGCCCA CAGGTAGCAGAGATTCTTCTCCAGCTTTGAGGCGGACTCAAAGTGCGTCC GTATGCCCTCGGCCACCACGTTGCTCTGCTCGATGTCCTCGAAGAGCTTG ACGCGCCCCGCTGCGCTCTTCATCTGGTCGATCAGGCTTATCCGCAGCGT ATCGTTGCATATCTGGACGCTCAGCTCGCTGGTCGGCTCCTCGAAGCTGT CGTACATGCTCGGCGCACTCTCCGCCGGCGGCGACGGTCCACACTCCATG TATTCGAATTCTCCAGCGGTCGGGTACTGGGCTTCGATCATGGCGTCAGT GTTGTTCCGCCATCGCACCATCAAGTTGGGTGGAATCGATTTGAAGCTGT GGAGATGCAAACCGATTAGCGGATGAGTATTAGCGCATTGAAAGATGTCC GGATGTTATACGGTTGGATAATTTCTAACAAAAACTTTGTTTTATTCAAG CTTCCCATGGTATGAACATGGAGTACTTTTTTTTTACCACCGACCAGTAC AGTCGAACGTCTATGTGCGTTTCTATGCGTTTAACATTAAAAAAGTAATA TTGACCCTAGTTATTTATAGTTTCAGTCATTTGGTTATAAGTTGGTCAAG TAAGTTATTAAGGCTAGGCTTTTATAGTTATTTACTTAAAATGTGCAACT TTTCACAGGGTATCCTAAGATAAATGTAAATTTCTTTATTTTTATTCACC ATTGTTAGTCTTTTTGAACAGCGTTTTATCAATTTTGCTTATTTTCAATC ACTTTTATTTTATTTCGAGTTGCACGTTGATTAATGATTAGTGGAAAATT TCCATTGCCTTTCGGTTTTCCAAATGATACAACATTTAATTCGAATAAAA TTTATTTGTAGTATTTTTTTAGTTTATTTGAATAATTCGGAGAAAGAACA TCTATACTTTTCAATGCTAATTCTTTAATTTTAAACAGGTTTTCGTGGGT TTGAGGTGATTTCGATTCGACTGTGAATCAGTTTTTATGGCACTCAAATA ATTTGTCAGTGATTAGAGAACATTTTTATATCAGTGGAAGTTTTCTAAAT TTAGTTAATGCAGTTAATATATGCCTTGGCTTTGAAATCAACGCATTGAT GGACTTGTGTTCGGTGATCATGGATTTAAATTGCGTAGTCATCATGGGAA AACATCACGTCTAGACGATTTACAACTTCAAACTGCGTTGCCTTTTAGTA TTTAACTAGTTGACGATTTATGAGAAACTTGTAATTACTATGAAGCTAGA ACTCGTAAACAATTTGAAGCTATTCAGCGTTGTTGGGATCGCCCATTCGG CGAACTAAGTTGGCTAAATATATGAAACAAAGCCATTAGATAGACTCGCA CTTCTCTTTGTCCAAACTATACTCTCAACTCGCACAGATCACCTTTTTAT GGATCTGTACACACATAATCCCCATCGCTCAAATGGCACTGAACAGCGGA GTTCGAGATCTGTTGACTTTTCGAGCATGCATATTTTTAAATAATTATTG TGTGTTATTTTGCATTGGGAGTTATGCTAAGTTGGCCGTTTTGATTGAAT CGGTTTTCATATTTCACTGCTCAGTATTCACTGTTCACTGTTATCGTACG TTGATGGTTTCACCGACTGCGCCGGCAGACTTTGTTTTGTTTTCTTGGTC GCCAACTTGGGGCTGCTCAGCATAGTTGCCCGCTGCATAATTTCAGACCT CGTCCATGGTCAGAAGCTGGTGCACTTGTTGTGCAACCAAAGCACTTCGA CTGCCCACTACCCACTCACTGCCCAGTGCCACTGCTTTTGTTGGCCACTT AAGCCGGGGATCTCGGCAACCAAGCGACTGGGACCACTGAATACGTACAC CGTTTGCAGCCATATCCACGGATGATGCCAATTCGACAGTGAGCTGTTTT CAATTTCTAATTTCATTTCTGAAATACATGGGAGAGCCCGGCGCGCCAGC CGACCGATCCGCCAAATTCGAAATACTGACTACGGATCGGATGGGATCCG ATCGGATCGCACTGGATTGGTTGGGGTCAGATGGGATGAGATGGGATGGG ATGGGATGGGATGGGGTCGGAACGGGACAAGTGCCTCACAATTAAGGCCT TTTGTGGGAGCCCAGACAATCGCGTCTAACGGGCGGAAAATGCTAAATGT TGTGTGAAAAAACGCGAATTTTTCACTTCCGTTTTGTTGTTGCCGTCGAC GGACGTTTTTTCGGACGTTATTTCAGCGTTTATTCCTATTGTTTCTACAC CGACGACGATCACTTCGAACGCGTTCTAGCCGTATTTTGTGGCTGCTATT TCGCTGCTTCCGCACTCTTTTGGCCAGCTACAAACGCGTCCGCCTGCATT GTTGTTTCGAAACCGACTGAGCTCGATGAAAATCGGCAAGCGTTGGTTAA GTCGTCGATCGAGATTTAAAGAGAGGTTATCTAGAGAGCGTGGAGATACG CGTACAGGTAGGGTTAAAATAATAGATCTAGGAACGCGAGGTTAAACATT TTTCCAAGTATATGATTGATGATTTGATTTTCAGTCTGCCTCTTATTATT ATGTAAGGCTATTTATGATCATTGTCAGTTTTTGATTTTGCCTTAAAAAT TGAATATATAAGGTGTCATTTTTAAGTGCCACTATTTTTACCGGAGGTGT AAATAGTATTTGGAGAGGGAGATACTTTAGCGAGTGTGAGAAATCTCCAA AAAGTCTGCAATTTCAACGCGAGTGGGAGTGAAAATCTTTGGTACATCTC ACTTTTCAGTATTTATAATTTTTTGTAGGCTTAGTTCTTTCAATGAGATA TTGTAAAGATATAAAAATGGCGGCTTAATATGATATTTTAATCAATGAAG AATGCCGTGACCTTTAAAAAGCATTTTAAACTCCCAAAGGCCGTAACTTT TAAATTATAAATACACGAATATGTATAAAATAGTTTATACAAAAGTATAC AATCTGTAAAGTAATCCAAATTACACTTGGCAAAAAGGAAGCTGTTCCTT ATCATTTTGAAGATTGCGTTGCAATATGATATTTGTGATAATTTCAAGTA TTTTATATTCTTTAGCCAAACCTCATATTATTAGCTATCACATGGCTGAA AAGCTTTTTTTCTAACAATTATTATTATTACATTTTTTTGTATTTTCTTT ACTACACATAAGGTTTTAACCACCATCCGAAAAATAAATTGTTTGTGTCT TCCTATAATTCTATGCAATTAGCTTTTTACTGCGAAAATCAATTATCAGA TGTAGTTATCCCATTTTTTTATGAGTATTACAATACACCCCACACAAAAA CTGGCTGACTATTCCTCAAATTTGATAAGCACACATTATATAAATATGAC ATTGTTGATTTTACGAATAACATGCTGGTTTTCTGGCTGGCAATTCATTT GTCACATAAATCACGGATTTGCTTCCGCGTCTTTGCCTTTTGGGCCCGGC AATCACGCCTATATCTGTGTATATTTTGAGTGTGTTTTATTGTGGCCAGA AATTTCTGCAACTGCAACAGCAACAGGCAACTGAAAACTGGCAACTCCAA CTGGCACTTACCGGTTATTTGCATTATTCTCCGTGAGCGGCTGTTCCACT TCGGTCTTGGTAACGACGCTGATCGAACGTGTCATGCGGCGGGGCTTGGT GCTGCCCTCCTTATAGCCAAGATTCTCCATGGTGACGGCCAGAAGTTGCT GCTGCAGTCGTCGTCGCCTCCGCCGCCGGTGTCAATGCTGCTGCTTTCGT GGTTGTGGCAATTAAAACGCGCAAATATGCACAAAAACCTCGGTGCAATG CAACTTCGTTTTTTTGTCACTGCCTGCAATCGGCAAATAAGTATGCGAAA AAGTTACTTTCCAATATCACACGCCAGCGGAGCGCCAATTTATAGCCCAA TTTCAGCGACTGATTGACATTTTCAAAGGCCTGCAAAGATAGTTCGATGT GAAGTTTATCGACTGCAACTTTCTACGAGGCATCTATGCTATCAATCGCT CTGAGCTATCCCGAGCCAACTGGACCCAACTGACTGGCTAACTTTCCCAA CTGCCTGGATGGATGAACTCCGCCAAAGATAGCCAGTCGTGCGTTGGATG CGACACTCGTGGTCCCAGTTATCAGTTATCTAAGCGTCTTCCTTTTGACG CAGCGATAAGACAGCATCATCACAATCACCAGCATTATCGCCAGACTATC CGGGGATTTATCTTGGAGTGCTACTGGTTCTGACTGCTCATCCCAAGGGG GTTTAAGAAACTACTATCGTTGAGATACATACATATCACTTGAATTAGTA GGGGAATTATGTAATTAATGTGAGTCCAAACTCGATGGGCCTCTTCATGA TAGGAGCTATTTTTGGGATAGACAAGTCTATTTGCCACACCCCCCCCTTT GCGATACTCCCATGTTTTATTTGTTTATTTTATTATTTTGATTTTGTTTG TGCATATTATTTACAATTTATGTCAACGTCAGAAGTGGAAGTACTCATTC GTTTAGTATGTAAGCAGATTCCAACGTTCAGGAGCGGTTTACTTCAAAAT TCATCTTCTTTATCTTTAGTATAATTTGCCTTGTTATTTTTATAATTTCT ATAATGAATTAAAAAAATATGCCAATTTGTTGTTCAGCTGACAGATTTAA TTTATTAAAAAAATACATTAAAATGGATTTCAGCTATCGTCTCCCTCTTT TTTTTCGAATTTATTTTATCCTATTATTTTATTTGGCATTCGCTATTAAT CTTATTTTGTTTATTTCTGATTTGCTCATCACATCTGTTTGATTGCAAAA ATGCAAGTTCTGTGTTTTTCCAGCTTTTTCCCCAGATTATGTAACTTCAG GCAATCGACTGCCAGGAATCCAGAGAGTTACGATGTCACATTAGACTAAA TTAGCTAGCGAAGCGTTAAGCTTGTTTAGGTTTTATTTGTTGCATTACTT TCGGCATCGCATTACTGTAAACAATTCTCGAACGATTCTGGGAATCTTTC AAACTTGTTTGCAAAACATAAACAAAAGTTAATAGGAAACGCAAAAAAAG CCTGTGTTTGCCTGACGACAACGCATAAAAAACTTTCTTTGATTAGGCAA ACCAAAAATCCGCTGACTGATTAAACATATAGGGCGATAAACAAGGGCCG GCAACAAAAACGGCGGCCAAAATTGAGTTGGCTAAAATATGCGAGCAAAT TAATCAAAATCTGTGCGTAGTTGAGAAACCAGTTTTTGGATTTTTGAGCT GTGATGCACAGAAAGATTTTGGATTTTGCAGAATGTTGGAATAGTTTTGC GTTATTGTAAAACTTTACAAATTTAGAGGAATTTTAGTCTACGCCTTGTC TTGGGTAATATGAATATTTCAAATATTTTATAAATATATATTCTGAGATC ACTTTATTTCTCGCCGTGTGTGGTTTGTGGGTTGGTGTCTGGAGTCTACG AGGCCCCAAAACTCGCTAACACACTGAGCAAATATTGGCTTAAAAACGCC CCCGTGTGATTACAAATGTGCTGCCACTTTTGGCGCACTGTGTGAATTGC TGGAAATCGGGCAATCAATTAATACGTTCCAATACCTTTTGCAGGTGCAA AAAGTGCTAGATTTTAAGTAGATAGCTGGCTGGCTGGCTTTCGTTAAACT CGAAGGCCCGGAAGTGGCGTATGGCGTATGATTACCCGTTACGACAGACC GCCGCCGGCCATCTTGGAAAACTGCGACGCCATGGAGCCGTGGAAATCGC CGATGGCCGACGGCCGATCGGCCGAACGATCTTCGGGATCGTTCGTTGGC GGGTATCGCTCGGGTGTTTCTTTGCCGCCCGCTGATTCAATTATAATTGA GAGCAATTCGGAGCCTTTTCTTCACTCGCTCGCGCCTTTGTGGGGAACTT AAGGGGGTTATTATCTGAGCGAACGCATTGGGCTTAGTTGGGTTGTACAT ATTTTTGCGTTGCCACAATGCCCTTGAACCTGAAGCGCATGCCCATTCCC CACACTGCGCCGTACACTAGCTGATTACTAGATCCGAGCTATATTATATA TAGTTTTCGTGCGCCTATGCAGTTGCAATTGAATCCGAGAGTCAGAGTGC GCGAATTAAAGGATAATGCAGTCGCCAAATGCCGTGCACCGAGTGTAAAC AAACCTCAATTGCTATTCATATGTAAGTTGCACTCGGTTATAGAAATCGT TGATTGTTCACTTGGCTGATTTTGTAAGAGAAAACTTCTAGATACCGCTG ATGTGATCCCCCCACTTGTACTTAGGCACTTTGGGGCTATGATTAATGCT AATTTTTTTTTTAGTATTTGCGGATTTAGTTTCGATTCTGCTTGGGGTCT TCAGGTTTCTATCGTCATAGTATCGTAGTCAAGGAAAAAGTTTATTATGA TTATAGTATTAAAAGTTCTTA