##gff-version 3 ##date Fri May 24 03:16:22 CEST 2024 ## exported from the transgeneomics system molecule_59049991 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59049991 mpicbg region 9631 26740 . + . Name=dmel-5.43-3R;type=genome;start=12458661;end=12475770;strand=+ molecule_59049991 mpicbg region 26741 26813 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59049991 mpicbg region 26814 27802 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59049991 mpicbg region 27803 53662 . + . Name=dmel-5.43-3R;type=genome;start=12475771;end=12501630;strand=+ molecule_59049991 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59049991 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59049991 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59049991 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59049991 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59049991 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59049991 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59049991 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59049991 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59049991 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59049991 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59049991 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59049991 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59049991 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59049991 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59049991 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59049991 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59049991 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59049991 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59049991 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59049991 coding_transcript gene 16899 19511 . + . alias=no-on transient A-like;alias=nonA-1;ensembl=FBgn0015520;Name=nonA-l;alias=LD09360;alias=nonA-like;identifier=FBgn0015520;alias=CG10328;alias=Z;alias=PSF;alias=nonA 1;id=50970595;alias=no-on transient A gene;alias=BEST:LD09360;alias=predicted gene Z molecule_59049991 coding_transcript gene 20297 21857 . + . id=50518870;identifier=FBgn0038453;Name=CG10326;ensembl=FBgn0038453 molecule_59049991 coding_transcript gene 21568 23681 . - . identifier=FBgn0038454;id=51050737;ensembl=FBgn0038454;Name=CG10324 molecule_59049991 coding_transcript gene 24281 26670 . + . id=51080186;alias=Cctg;alias=CG8977;alias=Tcp-1-gamma;alias=Tcp-1gamma;alias=CCTgamma-like;ensembl=FBgn0015019;alias=Cctgamma;alias=chaperonin-containing t-complex protein-1 gamma subunit like;alias=Cctgamma;alias=Y;alias=Cctgamma;alias=predicted gene Y;alias=Cct-gamma;identifier=FBgn0015019;alias=geneY;Name=Cctgamma;alias=Cct3;alias=TCPG_DROME molecule_59049991 coding_transcript gene 26673 30061 . - . identifier=FBgn0038455;Name=CG14907;ensembl=FBgn0038455;id=50517824 molecule_59049991 coding_transcript mrna 26673 30061 . - . parent=50517824;id=50517829;Name=FBtr0113242 molecule_59049991 coding_transcript exon 26673 30061 . - . parent=50517829 molecule_59049991 coding_transcript gene 26673 30061 . - . id=51240515;Name=CG14906;identifier=FBgn0015351;alias=open reading frame 2;alias=anon-89Eb;ensembl=FBgn0015351;alias=ORF2 molecule_59049991 coding_transcript mrna 26673 30061 . - . parent=51240515;Name=FBtr0112880;id=51240523 molecule_59049991 coding_transcript exon 26673 30061 . - . parent=51240523 molecule_59049991 coding_transcript three_prime_utr 26673 29308 . - . parent=50517829 molecule_59049991 coding_transcript three_prime_utr 26673 26737 . - . parent=51240523 molecule_59049991 coding_transcript cds 26738 28879 . - . parent=51240523 molecule_59049991 CLC misc_recomb 26814 26847 . - . Name=FRT molecule_59049991 CLC cds 26855 26926 . - . Name=BLRP molecule_59049991 CLC cds 26927 26947 . - . Name=TEV molecule_59049991 CLC cds 26948 26971 . - . Name=Precision cut site molecule_59049991 CLC cds 26972 27013 . - . Name=V5 molecule_59049991 CLC cds 27020 27736 . - . Name=SGFP molecule_59049991 CLC cds 27743 27802 . - . Name=2xTY1 molecule_59049991 coding_transcript five_prime_utr 28880 30061 . - . parent=51240523 molecule_59049991 coding_transcript mrna 28971 30061 . - . parent=50517824;Name=FBtr0083354;id=50517841 molecule_59049991 coding_transcript exon 28971 30061 . - . parent=50517841 molecule_59049991 coding_transcript three_prime_utr 28971 29308 . - . parent=50517841 molecule_59049991 coding_transcript cds 29309 30013 . - . parent=50517829 molecule_59049991 coding_transcript cds 29309 30013 . - . parent=50517841 molecule_59049991 coding_transcript five_prime_utr 30014 30061 . - . parent=50517829 molecule_59049991 coding_transcript five_prime_utr 30014 30061 . - . parent=50517841 molecule_59049991 coding_transcript gene 30200 33521 . - . ensembl=FBgn0051217;alias=SP172;alias=CG17557;alias=Serine protease like 89E;id=50632623;alias=Ldlr;alias=Ser89E;alias=LDL;alias=predicted gene W;alias=CG31217;alias=CG10100;alias=ModSP;alias=modular serine protease;alias=low density lipoprotein receptor-like 'a' repeats;alias=Dm-SP;identifier=FBgn0051217;alias=predicted gene X;alias=W;alias=SP53;Name=modSP;alias=Serine protease-like;alias=X;alias=CT28389 ##FASTA >molecule_59049991 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACCCGATGGGACTGGGAAACCA ATTAAATCACTTGCCTGCTGCCCCAGCGAATGCTACAAACACATGAGCTA AACACATTGAAACATACACACTGATAAGCGGCTTTTCTTTGCCCTAAGTG AGCAGCTCCTCCAAAGTGGCGCCAAAGGGATAATATTTCCAAGGTTGAAG TTTCGTCGGGGCTCAACTGAGGGCAAAGCCAAAACCAAATAATCTTGCAC CCAGAAACCACTGCCTAAACACATACAGTATAAATAAATAAGATCAATGC AGACACTAGTTTTCAGTATCCCCTAGATATATCTAACTAATACAAATGAA AACCCAAAAGACTGATTTTATTTGGAACTGAATTCTTGCTAATCTTGATG CAAAATTCCCCCAAAAAAGGAATTCGCTCAAAAGTCTGTATTCCGATTCG GTTCTATGTAAAATCAAAAGCAAAATTTTATTTTAAAATAATTTTTAAAA TATAAATTTTATTTTAAAAAAATTTTGGGTGTAATGTAAGTATTGCCAAA AAGCTGAAAAACAAAAAAAAAAAAAACAAATCTTAAAGCAATGTATTTCA TGTAAATTTTTCTATGAATCAGATTTTCGTATCAATATGCATTTCACAAG CAGTTGTTTGCATTGCAATTGCAAAAAACTGACTCAGTAGGGCAACGCGC TCAGAATTGGCCCTCGAAATTCAATACGTGATTTAGTCACCAATTGGCAA ACACTAAAAAAAGTTGCTTAGGCTGCGCTTTGCTTGATCTGACCGAAATC GACCAAAACTTCATTCACAAAAACTTCCATTGTTCTATATTGAAATCGAC CAAAACTTCATTCACAAAAACTTCCATTTTTCTATATTGAATGTATTGGT ACTTTAATGGCGTCATGAACTAAGCAAGTGTATAAATTATTCCCATCATT GATTGGCTAAAGTTCTTCGATCCCTCGACCGCCGTGCATATCCAAAGATC AGTCATCGATCGCTCGCCATCAGCCGGCATGCTTTGATCATCACCGTAAC CGTAGATGTATATGTATACACCAAGCATAAACTGATAACAAACCACCCAC CCGCTCGATAAATAGTTACCCTCCTCATAGGCATATACATTAGAAACAGT GCGTTTCGAAACTGTGAGGCAAAGTGCGCCGAACAGTTTTGAGTCCGCAC TGTAGAACGGCTATATCATTCGACCGCTCGAATCGTAAGCGCCTTCATAT CGTGCTATCGTTTTCGAAATTTTCAAACTAGTTTTGTTGTAATTACGTGC GATACTCTCCTTTTGCTATTTACTGATCCATACCTCTATCCTTTGTTTCT CGTCACATGCCGAATAATTGTACTTAAAACTACAAAACACAATCCAACCC AACCACATATCGCTCGAAATTGAATCGGTGCACCCAAATATTGAAACAAA AACCAAAACGTTCAGTCGTTCAAGGTAAACAACAGACTCAAAATCCGATT TTAATTTTAAGTTGTTCGGTTTCTTTTGACTTGCATTTTGTTTTGCATCC CCTGCTATTTTAGCTATGCATGAGTTTATTACAAAAAATGTGTAGACCTT TTTTGTAAAATTAGTCCATTGGTTGTTAAAGTCGCGATGCCTTAGGGTCT AAGAATATTTCTTCTGATTTTTATTCACAAATAGTATTTATAGGATGTAC AGCACTAGTTTAAATTTGCAAATGAAGCAAGTGCACATGATACTTTAAAG TTAAAGAGTATTTATCGTATGATGAGTTTACAGAAATTTTACCTAATTAC TTAAGATAAACTTCTATTTTTTGTCGGAGCTTTTATATCCTTGTTTTATT TTTTAAATCATAGTAATGGAAATTATTATGATTCGCTGTAAATTGTTGAA AAATGCACGTAACTCAGTAACATTGTACATAATGGAGCCAAACCGTTTGC CTGTTCTTTGAAAAATGTCTAGAACAATGAAAGATTAAATATAATTCCCT TGTGCTTCATTTCAAACGTTCGTTTGTGGCGGAACAACTCGGGCAATCTG CGTGGAACCCAAATCCCATATTAAACAATATTTAAATTCAATTTTATTCG AAACTTGTCTTCACCAAATCACTTCGAATGAATATTGAACTATTTCTGCT AACACTCCGTTTTAAAAACTGATTTAGTTTATGAACGTAAGTAAACATCA CACCAGCAGACAAAGAACAAAAACCACAACAGTCATCAGTGCAACGCTTT GCTATCAAATTGCCATCCAACCCAACCACCGTGCAAACAATTCAATGATT CGGTAGATTTTCCGTCATTAAATCGCATAAATTCAGCTGTGTTAAGTGAG TCATTAAGCGAGCATTCCCATTGATTCACAACTTAATTGGCCAGCCATCC ATTCCCCCACCCAATATGTGTATAACTGGCTTACATTATAATCGGATATA TTTCCAATTGTTGTATTTTTTTTTCCTAATTCTTTGTACTACTCCCAAAA AAAAAAAAACAATTTATAAGCTTATGCATACCCCTCTTCCATTCACCGTT TATTTATTTATATGCATTTTGTTTTAAGTACTTCAAATAGCATTATGATA TATGTTCATTGTATTAATTTTGCAATCTATCTTGAAGGAGAATGCTGAGA ACGGAGCTCTGCGCAAGTTCTACGAAGTTATAATGGACAATGGTGGAGCA GTTCTGGACGACATCAATAGCCTGACAGAAGTGACCATTTTGGCTCCCAG CAATGAGGCTTGGAACTCCTCGAACATCAACAATGTTTTGCGGTAATGTT GCTCAAATCGGGAAGATAATATTTAATTATCATAATAATAAATAAATACA TCTTACAGAGATCGGAATAAGATGAGGCAGATCCTGAACATGCATATCAT CAAGGACCGCTTAAATGTGGACAAGATCAGGCAGAAAAATGCAAATTTGG TGAGCTTTACATGAGCTTATAATCAAATGGAAATTTTTTACAAATCACCA TTCTTTTCAAAAGATTGCCCAGGTGCCCACTGTCAACAACAACACTTTCC TGTACTTCAACGTTCGCGGTGAGGGATCGGATACCGTGATAACAGTTGAG GGAGGCGGCGTGAATGCCACCGTTATCCAGGCTGATGTGGCCCAGACTAA TGGTTATGTTCACATCATCGACCATGTGCTGGGCGTGCCTTACACTACAG TTCTTGGCAAACTTGAATCCGATCCCATGATGAGGTATGTTCAATTTTAA AGCTTTATTAGTACGCTGTTTAAATTTTATCGTATTCCTTAAGTGACACC TATAAGATGGGAAAATTCTCGCACTTTAATGACCAGCTGAACAACACACA ACGCCGCTTCACCTACTTTGTGCCCAGGGACAAGGGCTGGCAGAAGACCG AGCTGGATTACCCATCGGCTCACAAGAAGCTTTTTATGGCCGACTTTTCC TATCATGTAGGTTTTTCACCCTAAGCCTATTAGGCTTTTCTATTATACTC AAAATGTTTTGTAACCGCAGTCCAAGTCCATTCTGGAGCGTCATTTGGCT ATTTCGGATAAGGAGTACACCATGAAGGATCTGGTTAAGTTTTCGCAAGA ATCGGGCAGCGTAATCCTACCCACGTTCCGCGACTCTTTGAGTATCCGCG TGGAGGAGGAAGCTGGACGTAAGTATAACACATTGGATACCAAGGGCTCA GTTGCTTCTCCTTTCAATTCAAGTCGATTCGTTTCACCTAATTTGATTGA TTCTATTGGTCTTCCCATACCGTGCTGCATTACTAACCGAACCTGTTTTT TTACAACTCTTAAACTAAATTTTTCGCTTTCTGCTTAACTAAATCTAATC GTTGTCCAATCAAAAGATCTCCATGATGAGTATGCTAGTCACGAATGGAC TGGTGAGTGCTGCCGTTTTTCAAACCCACATCGCACCGCCCACAACGAAA TCCTTGACCTGGCCATGTCCACCCATAGCTCGCTCATTGGGCAATCCACT AGCATTAACCACCCATCGATTGCATACCAATTTTCTATTGTCTAGTGGCT ATTAACAACGATTACTTCCATTTGCAGGCTATGTGATCATTTGGAACTAC AAGAAGATCAACGTATACCGGCCCGATGTTGAGTGCACCAACGGAATTAT CCACGTCATCGACTACCCACTCCTGGAGGAAAAGGATGTGGTCGTGGCCG GAGGTAGCTATTTGCCAGAATCAAGCATTTGCATCATCTTGGCCAACCTC ATAATGATAACAGTAGCAAAGTTCTTGAACTAAATGCATCCGATATGTAA AAACAAATCCAATCCAAAGCAAATGCAAATCAAACACAACAACAACAGTC GTCTACAGAACAAGAACCAACAACACTCAGTATCAGACTAACTTAACATC CACATGGATCTAAATAATCAGCACCAGTTTGTTGATACCGATCGAAAACC ACAAGCAACCCAAACAGTATCTGTAATATATACGTCACAAGGAACGATCA TCATTCCAACCCAACATGCCCACGTCCACGCCATCTACATACCCACATAC ACACACTCAGAAAAAAACGCATGCAGAAAACTGCCTGCTAAATTTGCTTT TGCATCGACAGCTTCTCCCAAAATAGCTGGCAAGAGAGACTAAGATAAAG TCGAAGAAACCCCTATGTTTAAGTATTAAACTCGATTTTCCCTCAAACGG CCTTATGTATAATATTGAATATGAAACTTTCTGTAAAACATTTTAATTTT ATGTTCGCCCTATACTGGTAGCTTACGTTCATCAGCTCGCTATGTTTTAA GTTTAGACCCACACTGACATTGGTATCGTACCATGTAACAACTGATTGTG TTTATGATTTTAAGTGTACATTTTTTGTGAATTGCTTGTTTTAGTTAATG GTCTAATTTATGATTTATGAAATGAGTTATCTTAAGTAGAATGCGAATCT CATTGTACATCTCGAAAACGAAGAAGCTAAGCATAAGCAATAAGCGCATC ACACACTCTCATACTCGAGCGCCCACACATTCCCCCTATTCCTATCCATA AATACATACAACATGTAACGAAACAAAGTCATTGTAAGATTTGAAAGTGT GAAATTTGATAATAAACTGAAAGTTTTTCATTTGAACCTTACTATTAAGA GCGGCAGCAATCTTGTCTCGAACCAATCGCGTGACCCCTGTAGGCCTAGA ACTATATCAGTGTCGGACAAGAAATGTGCAACCAACAAACCCAATTATAT GATATGCCATCCTGCACTTAGTTACTAGCCCCGCTATGCATGTGAACCCC CAGAAAAACCCATTCGCCCACACACACCAGCCACTTGGAGCGAGAGTAGC CACTGCAACTAGGTTAGTCCAATGTATAAGTTCCGAAACTGCCGACAACT ACGAAAACTATACAGCATACATACAACTCCCTGTAATCTAAATCACTCAC GGCACACAACTACAACTACAACTACATGTCATCATTGAATGGATTTTGAT ACCGATTTTAACTTGCATATAAACAAAAACAAGAACTAGACAACGTGAAG AGATTTTAAACAAAATTCTCCCTCGGTCGAGCAGTTGCATTTCAAACTTT GTACGTAGTTTAAAACTAGTTTTTAGTCCGACGTAGAACAACCCAATTGC TAACTATATACCAACTTTCTTTCTATTTCTCTCTGTCTCTCCCCCTAATG CTATGTACTTATAGGTTAGACATTGTAACTATTGTAATCAACCCAGTGCG TTAAACCCGAGTGTTAAGTCGAACAGTAACACAGAATTGTACTATCCCCA AATGAATAACTATCAGCCTACCAGTACACTGTCTCAACTCTCACCACCAC CACCACCCACTTAGGAACTCAGTCGAACTTGAACTCGAAATCAAAGATCC AGTTGTGGCAGTCGCTTCACGTAGTTGCTAATTCCCAATTCGAACCGATC CTTTCCGAAAGTCTTATCTTTAGTATAGGTGGTTTAGTTTCATTTGGAGC CGTGCAGTGCCGTAGCAGCTAAGTAAAAATGTATGAAATGAAGATGAACA CGAGATCGAAATCGTACGGAATGATCAGAAATCAGAAATAAATAATGAAT ACGCTAATGAATTGTACAAGTAAGCTTTAAAGAATTGCTGGAGGAGCGCG GATCGGAGAACTTAGAGGAGGGAGAACCGCATTGCAATCGCATTGCAATT TGTGTCGTAGTCAGTAGTTACACGTTAAGCGGCGTCTTAACGTGTAACTA GTGCCTTACTAAAGATAAACGCATTACCTTAACCTTTATACAAATTTACT CAAAACATACTTGTACCCCAAGCATACGTTCCGCTTCGAATGATACCCAG ATATATATACGGAGTTACACCCCAAGAATACAAGTATAACTACAAATGAT ATTGCGCCACACGCTATTTACACCAAATACACCAAACAAATCGAGAAATG CATATTTTTCATATATTTAATTGTCAGAATAATATAACGTATATGTAATA TGTAGTTTATTTACTGTAAAACGCAAGAACCTAACAAGTGGAATTTGAAT CACATACAATTGATGTATATTAGCTATTGAGTTTCTAAGCAAGCGTTAGA CACTGAAATATATGATTCAAATATATACAATATGCGAAACCAAGCAAACT ATGGAAAACTGGAGTGCAAAAGAATATTATTCCATTTTATTTTACGACAA GCGCTTTTTACAAATAAACCGAATCCATTTAAATTACTCGTAAAGAACAG ACAGATTATATTTAGCATTAGTTAAACTAATTATTACATGTACTAGAAAA CCGAATGTCAACCGAGAATCTTCAGCAAGCTTGAGCGAATAATAAAACTT TAAAACTAACTATAAATAAATCGACCGTCCTTTTTTGCACTTAATCATGG GTTATGGGTGTGGAACCTGAATTCGTTTTACTTAAAAAATTTCACAATTA CAAAGCCACCTTCCTGAAACATTTTGGAGTATGAATAATAGAAATTATAA AATGAATAACAACTGGAATGTTGCTTATTGGATATATTATTTATAGATCC TTAGTTACAGTATTGACTTTATTCCGCGAATACCCTTCAAAAACGTGAAA TTTTTTTAATTTGAAAAATTCCGCTCGATAGTTTACTTACCCAATATTAC AACCATTAAAACATCGATAGTTGTGTGAAAAATCGATTTTCCCGTTTTTC CTATTCTAAAAAGTGTTATACCATCAACATTATCGATTAATGTAACTAAC TATTTTAAGTTTTATCTTTTCAACCCGGATATTTTAGGGGATTAAGGCAG TTGGAATAAACTCCTTTCTGTGCCTGGTAACATTTTTTTTCATACCTGAC AGTTCCTCCAATCGGTGTTTTTTTTTCGCATAGAAAATTGAATTTGGGAA AAAGTATTTTTCGTTTGCCATGGAGGGCGCTGTTAAGAAAAACAGTTTGA ACTCTTCGCCATTGCCACAACGCCAGCAGAGGGGCAATTCGACCAATAAG AACCTGGGCAAGCCAACGCCCCCGAAGCTAAATGCTGCCAGCGACGGTAA TCCTGCCGAGAAAAAGGCAAGACTTGGAGGAAACACCCAGAACGGTGGTG GAGTAGCTGGTGGCGGCGGCACTGGCGGTGGTGGTGGTGGTGGTGGTGCT ACTGGCGGCGTTGAATTTTCCAGAAATCGCAATCGAGGCGGCAACCAAAA TGAAAACCGGCAGGGTTTCCAAGTCGCAAATAATTCACATCAAAAGCAGA TTAACGAATCGCCGAAGCCGGCTGCGGGCAATGTGCCCGCAAAGAACAAT GAACTCTCAGCTGGCGGAGGTGGTCAAAACCAGCCGAACCATAGTAACAA GGGCCAGGGTAACCAAGGCGATCAAGGAGAACAGGGAAACCAAGGACCGA ATTTCAGAGGTCGTGGTGGTGGCCCAAATCAGCCGAATCAGAATGCCAAC CAGGAGCAAAGCAATGGATATCCCGGCAACCAAGGAGACAATAAAGGAGG ACAGGGCCAACGCGGTGCTGGAGGTGGAAAACACCAGCGTGGAAACCGCT CTAGGCGCTCTGGGGGATCTGGAATCATGAACTCATCAATGGGCGGCGGT GGGCAGCGCGGCGAAGACTTTTTCATTGCCCAACGACTGCTCGACATTAG TGGACCCACCCATGAGTTGCCGCCCATTGAGTTACCCACCGATAACAAAT TCGTCGGACGCAACCGCTTATATGTTGGCAACCTCACCAGCGACACAACT GATGACGACCTACGGGAGATGTTCAAGCCATATGGCGAGATCGGCGATAT ATTCTCGAACCCGGAGAAGAACTTTACATTCCTGAGGCTAGACTACTACC AAAATGCTGAGAAGGCCAAACGCGCTTTAGATGGCTCCTTGCGCAAGGGA CGAGTGCTGCGTGTCCGCTTTGCGCCCAACGCCATTGTGCGTGTGACTAA TCTCAACCAGTTCGTGTCCAACGAGCTGCTGCACCAGTCCTTTGAGATCT TTGGACCCATCGAGCGCGCCGTTATCTGCGTAGACGATCGCGGTAAGCAT ACCGGCGAAGGCATTGTTGAGTTCGCCAAGAAGTCCTCGGCCAGCGCCTG TCTGCGCCTGTGCAACGAAAAATGCTTCTTCTTGACTGCTTCATTGCGTC CGTGTCTGGTGGAACCGATGGAGGTGAACAACGACAATGACGGCTTGCCG GATAAGACGTTAAACAAAAAGTCGCTGGAATTCAGACATGAGCGTAGTGT CGGACCGCGTTTCGCTTGTTTAAATTCGTTTGAGCACGAGTATGGATCAC GCTGGAAGCAATTGCACGATCTCTTCAAGAGCAAACAGGACTCACTCAAG CGTGAGTTGAAAATGGAGGAGGACAAGCTGGAGGCCCAGATGGAGTACGC TCGCTACGAACAGGAGACCGAACTGCTGCGCCAGGAGCTGAAGAAGCGCG AGCTGGACAACGAGCGCATGAAACTGGAGTGGGAGATGCGTGAGAAACAA GCCGAGGAGATTCGAAAGCGGGAAGAGGAATACATGCATCGTTATCAAAA CCAATTACTTCGCCATGAGGAGGATATGCGAGCCCGTCAGCAGGAGAACG ATTTGCTAATGCAGGCCAAGAAACTCAACATGATCCTCGATCAGCAGGAG GGATTCGGAGGCAGCAACTCTGGATTCGAACACTTTGATTCCCCTTTTGA AGTATTTGGGAACAACAGCAACAATTCAACAATGGCTGGACCTGGAGGTC CAGATAATAGCGACGGAAACCAACACGGACACATTGATTCATGGGGACAC CGACGCTTCTAGACACTGAAACCTATATAGATAGCGACGAAAACAATAGT GATCTCATTAGTTACGCATAATATCGGACATTTCGCTCGGCTATGCGTGA ACAATAACATAAATAACAAATGGGATCATGCAAGCGAAGATGCATTCATC TCATTATAATATAAATTGAATTTATATAATTAACCAAAAACTGTTAAAAA CGGTCTCAACAACAAATCCACCACGAAATATTAACACAAAAATGACAAAA TCCAAACACGAATGGCAACTTACAAGATGTGCAGTATTTCGAAGAAAAAC ACCTGAACATAACCATCCATCATCCATTAGATATATGTAGAGACTACCTC CTAACACGATTAATTTTTGTCTATCATTCAAATTAAATATTGAATGCGAC TGAAATTACTGATTATTTGGAGTCGAATATAGATAAAGAGCCTAATTTTT ATAATCGTAGATTATACTTTGATTTATGAGTAAATAATCGAAATCGGACT TGCTTTTATTTCAATGTATTTCTCATCCCATCTCTGTCTACTTTTAATAA AAACGGCTCTAACCTAAGGTTTCACTGGGAATTTATGTTGGTAATAAATG TGTTAAAGCGGAAAAGTCGGAAAATGCCATCAGCTCTATTGGGAAATCCG GCAATAAGTTGCAAGGCTGTCCGAAAGGACACATTTCCGCCGGTATCTTC AGTCCCACGACGCTGTCCATATATTAGGTCAAAATGCAATCACTTGTTTA AACAAAAGAATTTATTTGATCAACAGAATGAACTATTGTATGAACCCTCC TCCCATTCACCCAACAATTACACAATTGTATTGTACCGAAGCAATCAAAG ATTTCAGTTCAATTACCCGTGGTATAACCATCAATTTGAATTTCCTCGAG ATGGAAACAGATGGAAACTCTTCATTTTGTCCAAACGTATATATGTATAT ATATATATTTTTTTGTAGCTTCGTTAAAGTTCATGATAGTTAAGTACAAA TTTCTTTTGAAGTAAATTTTTAGCAATAAACTAAAGCTATTCCGTGCCAT TGATATAAGAATTTAAGATCTATATTTACAACATTTTATCTGCATATAAT ACAAGATGTGGTGGCTTTGAGTTCATTATCTAAGTAAGCCGCTGTTGATT TGCTTGATTAACTAGCAAAAGCCAAAATGATGCTTTGCTTTCCATTTTTG TAGTTTCGAATTGAATAGTACGGCAATTTAATTTTTGATTTATGTATTTA TTTTATTAAGCCATTTATGGGCTTTTAGTTCTGCTTATAAAAATCATGAT ATAGTAAATCAATATTTTATGATAGGATGCTGTCAAGATTTTAAACAAAA ATGTAAGCCCAAATGTCAGGTGGCATTAGAATTTAGCATCAGATTTTAGC CAAATCAATACAAGATTTTTAATACAAACTTTTAAAACAGAGTTGTAAAG GGAAAAATTCGATAAGTTCCGATTGAAAGTGCAATCGCTGTTTGAGTGAA ACAACCCCTGAATCAGTCATTTCAAAACGTCGATCAACGGTCACACTGCG ACTTTGGCGACTTAAAAAACACCCAAGAAAATTGATTTTTCGCTCAAACC GAAAGCAACACCTTTGGGCATCAAATAGATTTCTCGGAATTGAACGCGCA CCGCTAGGAAACAAAGAAAAGCCAGCATGGCAGCATCGCAGGTTGACCAG GTGAGCGAAGGGTGGAACTGCCGAAAGCTTTCCGGCCGGAAAACGGCGTC GCCATTGAAGCCCCATTAGTTAATATCATAATGATTCCTCATTTTCCGGC ATTTTCCAGAAACGAGCACTTAACAAATTAAAGCACGACTTGGAGCCTTT CCGGACAGCCATCGTGGGAGCGTACGGCGTGCTAACCTGGGAGAAGCAGT ACTACGCCGGAGTGGTGTTTGGCGTCATCAGCTGCCTGTACCTGGTGCTG TGGTACCTGGACTTGTCGCTGATTACCCTGCTGTCGCTGCTCGGTGTCAT TAGCATTTTGCTGAACTACGCATTCCCCATGGTGTCGCGCCTGATCTTTG GCGGAGTCAACTGGGATGGCGACCAGGAGGCCAAGTTCGAGGACGTGTGC GGCCAGGTGTGCGCCGTCAAGGGCAGCCTGGTGGTCTGGTACGAGTACCT CTTCAACGAGCGGAAGTCCACAGTGGTGAGTAGATGCGGTAGAGACCGTG TGTGTATATGTATATGAAAACAGAGAAGCAGTTTCAGGGCCTAGTATGTG CAGTAGATCTTCTTCTGCAAGCTCAAGTGTAAATAAAAACTTCGGGTTCT ATTATTATTTCATCTCACATTTATTCGTTTTGATTCCAGTTTGTAATCGT CATGAGTTTGGGTCTTTTGGCTATGGCCTGGATTGGAGCCATCATTAACA ATCTACTGCTTATGTACTTGGCCACCCTACTCATCCTCATGTGGCCAGGA CTACAGAACAAGGACATTTTTAAGGCCATCACCCAAAGGGCCTCGAAGAT TATTAACGAGAAGATCCAGTGCGGCAAAAGGAAGCTGCAGTAAAGGAAAG CAACCAGATAAACTCATCACCATTTGACCAAAAATATAAAACATGCCTAA GTCATCTACTTGCCATTATGCACACATCGCATCACTAAATCACACATTAG GCGCATTGAATTTGAAACTATAAATATCTTAAAAGATAAGAGCAGCGCAT ACAGAAAAAAAAAACTCGGAAAACTAGCAAATCCGTGGTTCTGGCCCCAT CACATCTCCTACTATAAGTTTGTAACATGTAAGACAGAAGTATTCTCGAA ACGAGGCGTACGGAGAGAGAAAAAAACGCGCAACAAAAGACAAGGCATTT TTGTGATTATTTTGTGAGTTAATTGAAATTTATGATAATCCCAAGTAAGA TAAAAAAAGGAACTTAAGCGTCTAATGAACTATATTTAAATAAAGATTTC AACTAAATAGATCAATCACTGACGGTCTCTTGACCTTGATCGCGTGCGGG ACCTGACATGCTTGCTCCTCTTGGTCTTCTTTTTGTGCTTGCTGTGGTGA CGACGATGGTTTTCACCGAGGCTGTCATCGCTCTCTAAGCTGGAGTCGTT GTCCGCCTTTCTCGACTTGTTCTTGGACTTCTTTGAGTGTTTTCTTGACT TGTGGCTGGATGATTTCTTCTTGTGCTTCCTGCGTTCATATGCAGAGTCG GAGTCGCTCTCGGTGGACTCTCCCGTATCGTCTGCCTCGTCTGAACTACT CTTTGTTCTTCTGGTGCTTCGGGGACTTTGCGAACGCTTTTGGTCACGGT CTTCCCGCTTCGACTTAGATGGGCTTCTGCCTCTGGGACTCGGCGAACGA CGACGCTCACGTTCCTCGCGTTTAGATACAGAGGAGCTACCACTCCGCAC ATACTTCTTTTCTCGATCCACCTCCTCTTTGTTAGATTTGGCTTCCTTGT ACGATTTTCGCTCGTCTTTGTACGTCCTGCGATGTTCGTCTTTGTACGTT TTTTTGTCTTCATATTTGTAAGACCTTTTATCTTCTTCCTTGCATTTCAT GCGATAGTCTTCTTTACTAGATCTCTGGTCCCCTGGCTTCGAACTCTTTT GATTTTGAGCTTCATCCCGGTCTGATCTAATTTCTTCCCTGCGGTCTCTG TCCCTTCTTCCTGACGGATTTTCCTGCTTCACAATAATCTGGCCATGCTC GTTTTCATTTTTTTTGAATTCTTCGTATTTGGCAGTGTCTGAAAGTAAAT GTAAAAGAAATATAAAAATGTCACAAATATAAAGGATTTGCATTTTCCAG GCTCCACTTACTTATGCACTTGCCATACTGAGAGTACTCCTTGCGGGATA CGGGCTGACAAAGGAACTCGTTGAACGCCTCTTTGGCCCCTCCAATTGCC ATTTTGACAATTACTCGCCCTGCATGGTCATCAAAACCTTGGATTTGGCC ATACTGATCCTTCTGCTTTCCGCCCAGAATGCGCACGTACGCCTGCTTCT TAATCTCCAGTACCTCGTTCTTCTCCGGCTGGACCAGTAGAGCTTTAGGT TTGAGCGCCTTATCTGCTCCCAGGCCCATGCCTTTGGGTCGCAGAAAGGG GGCATCATCGATGGGTCCTGAGCCCTTCTTTTTTGGCGGTGGATCAACCC AGCCCATGCCGCGCAGCATGGCTAGGCCAAATTGTTGTATCGGTATGTTG TCATAGTCATCTAGTGTTGCCTCCTTGGCACCATCGAGAGGCAGTTCGTC TGCGCTTAGGGCGGGCAGGACAAGTTTCTGGTCATCTAGGCCTTCGGCAC CGTTATTTTGGATGGCAGATATCAATTCCCGAGCTGCTCTCTGTTCCAGA CTCTCCGTTGGACCGCCTGCGGTGACCTCTGCTATAGACTGAGCCACTGG AGTCACCTCCTCTGGATCCGGTTCCTCCTCGCCCAGCAGAACTGCCCGCC TCCTCATCAGACTCGCCAAAGCGGACGAAGTCTTCTGCATGCCTATCATT TTGATGGTAAGAGGAGCAGCTTCCACCTTTTCGCTAAATATTACATATGA GTATAAAACTATTTCAAGATATTTTAACTTACTCGACTGGCATGATTTCG TTTCCTTCCAAGCATTTTATCAACTCCACCTTGCTTTCCTCTTTCGGCTG CTTGCTGGGCAGAATGTTTGGTTTCTTGGACAATTTACTAAAGCCAAAAG ATATCTTCTTGGCCTCCATGTTGTCTAGTTAAAAAATTAATAACTATTAA AAACAAATTGAAGCCGAAATGTATCGTAAACAAACAGGCCACAGCTGACT CGCGGTTTGTTATCGATATCGATAATTTATTTAATTTATGAAACGCTTAC ACTACACTTTTAAAGTATTTGCAAAACTTATTTGTTTTTCCATTTATATA TAAAAACTACCATGAAATCCATTTAATACGTTTTGAGCAGTTTTATTGAA TACAGCACAGGATCTTCAAATATTAAAAAGTTCGACGCTGTTTATGTAAC TCATCATTCCAAGTAATCACTTTTCCCCCGTTATATTCAGAATATCCTCC AACATTTTCTTTTTCGAAGGTGATACAATTTTCATAAATTATATTTTAAC TTCTTTTGAGTTTAGTTGGTTAGGCTTTTTAGGCTTCAAAATTTCCACAT TTTAATTATGATGTGATAGAAATATGCTATATAACATAAATTTAAAATCC ATTCGTAATATAAATTAATTTCCAGTATCACTTACACCGTAGAAAATATT ATTTATTGTTACAAGTTTAATGTTTTGATTTCGCTTAAACCTCAGGGTGG AAAATTTAAAACCAAGTTAGGCGCCTTCAAAAAATCGCAGTTATGACGAA TGTAATTCTGTGACATCGATAACAAAAGCTGCATAGTGTAAGTATACTGT TTCTCGATATCGATTCTTAAGAGAGCTGCTGCTTCGAATTGTGGAGAATT TGAATTAAACTTATAAGCGATCGCAAAAGTCAGTTAGCAGTAAGTGAGGA AAGAAAAGAAACTAGAAGAAGGAACTGGCAGAAGTAACTAACAAGCCGGT CCGCTCAATATCCTATCGAACCTTCTCGAATAATGTGTCATCGGCGGTTC TAACCTCACTCATTCTCTTTCAAACAGCGGCAGCGCCAGCACGAGTTCAA TTGTTTTCACGCAGAAATAAATTAAACAGCCAGAAAGATGTTCGGTGGAC AGCAGCCAATACTCGTGTTGAGTGAGTATGAAATTTGCACGTCGTAGAGC CCAATTGCAATCGAATTACCCGCCGACAGGTCAAAACACAAAGAGAGAAT CGGGCCGCAAAGTGCAGTTGGAGAACATCCAAGCCGGAAAGGTATGCGTG ACTCACATGTCTGGGTCTTGGGTTTTTGTGTTCTCGCGTTTTCCGACCAT CTGTTGATTAAAACGTCTTTTTCCAGGCCATCGCCGATGTGATACGCACA TGTCTGGGGCCACAGGCCATGCTGAAGATGCTGATGGACCCAATGGGCGG CATCGTGATGACCAACGATGGCAACGCCATCCTGCGTGAGATCACTGTGC AGCACCCGGCGGCCAAGAGCATGATTGAAATTGCTCGCACACAAGACGAG GAGGTTGGCGATGGTACCACATCGGTCATCGTCCTGGCCGGCGAGATGCT GGCCGCCGCCGAGCCCTTCCTCCAGCAACAGATCCACCCCACTGTTATCA TTCGCGCCTATCGCGAGGCCCTCGAGGACATCGTCGGCCACCTGCAGTCC CAGCTTAGCATCCAGTTGGACGTCAAGGATAAGGCCAAGATGGCCGATGT GGTCAAGGCCTGTGTGGGCACCAAGTTCATTGGCAAGTGGTCCGACCTTG CCGTCAAGATTGCCCTGGACGCAGTCGAGACAGTGACGCTAAGTGAGAAC GGCCGTCTGGAGGTAGACATTAAACGGTAAGAACGAAATTTGTTATGCAT ATTATTTTTGAATAAATAATTTTAACTTTGTTACTTTCACAGCTATGCCA AGGTGGAGAAGATCCCGGGTGGCGCCATCGAGGAGTCGTGTGTTCTTAAG GGCGTGATGATCAACAAAGACGTGACGCATCCCAAGATGCGACGCCTCAT CGAGAATCCCCGCATCGTGCTGCTTGACTGCTCGCTGGAGTACAAGAAGG GCGAGAGCCAAACCAACGTGGAGATAATCGGGGAGCAAGACTTCACCCGC ATGCTGCAGATCGAGGAGGAGTTTGTGCAGCGCATCTGCGCCGACATCAT TGCCGTGAAACCGGATTTGGTATTCACTGAGAAGGGTGTCTCCGATCTCG CCCAGCACTATTTGCTGAAGGCTGGCATCACGGCCATCCGTCGGCTGCGT AAGACTGACAATCTGCGCATCGCCCGCGCCTGTGGTGCCACCATCGTGAA CCGCACTGAGGAGCTAACCGAGAAGGATGTGGGCACGGGAGCTGGACTGT TCGAAGTCAAAAAGATCGGCGATGAGTACTTCACTTTCGTGACGGAGTGC AAGGAGCCCAAGGCCTGCACCATCCTGCTGCGCGGTGCCAGCAAGGACAT CTTGAACGAAACGGAGCGCAACCTGCAGGACGCCCTGCACGTGGCCCGCA ACTTGGTGCTGGAGCCACGCCTGGTGGCTGGCGGCGGAGCCGTTGAGATG GCTGCCTCCCAGCTGCTCACGCGCAAGCAGGTTAAGGGACCATACACGGC GGTGGCCCACGCCCTAGAGATCATACCGCGCACACTGGCTCAGAATTGCG GCGCCAACACGATCCGTGCTCTGACTGCTCTCCGCGCCAAGCACGCCTCC CACACCGGCGATGGTGTCTGCGCCTGGGGCATCGACGGCGAGTCCGGCGA AATCGTGGACATGAACGTGAAGAACATCTGGGAGCCGCTGGCCGTCAAGC TTCAGACCTACAAGACCGCCGTGGAGACGGCCATCCTGCTGCTGCGCATC GATGATATCGTCTCTGGATCAAAGAAACGCGGCGGCAACGAGCCCACCAA TCCGGCGGCCATGGCCCAGGGTCAGGAGTAGTAGCCTGCGATTAACCACG TGTATTAATAATGCTTACTATCCTTTAATACTTAATTTAACACTCAAAAG AAAAAACAAAACAAAATCCCACACACGCCACCCCAAATGTTTAACATTTA GCTTCAGCCAGGCATCGTTGGCTTCTCTGGAAGAAGGAAACCCATCCGCC GGCCGCCTACACACAAAATTCAAATGCATTTGCTCTCATTAACAGTACAC AAATAAAATTGTTAAAACTCATAGCTGCTTATAAATCCCTTATTTAATGA GGTACTTGTAAAAATTAAATACAATAATTAGGCGTAGCTACTTGTCGTCG TCATCCTTGTAGTCAATGTCATGATCTTTATAGTCTCCATCGTGGTCTTT ATAATCTGTCGACGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCCG AGGATCCGCTGCCGCCGGCGTTGCTGCGCCACTCCATCTTCTGGCTATCC AGGATCTGGCGCAGGCTGCTGGCCATGCCCTGGAAGTACAGGTTCTCGGG GCCCTGGAACAGCACCTCCAGGGTGCTATCCAGGCCCAGCAGGGGGTTGG GGATGGGCTTGCCCTCGAGCTTGTACAGCTCATCCATGCCCAGGGTGATG CCGGCGGCGGTCACGAACTCCAGCAGCACCATGTGATCGCGCTTCTCGTT GGGGTCCTTGGACAGCACGCTCTGGGTGCTCAGGTAGTGGTTATCGGGCA GCAGCACTGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGATCGGCC AGCTGCACGGAGCCATCCTCCACATTGTGGCGGATCTTGAAGTTGGCCTT GATGCCGTTCTTCTGCTTATCGGCGGTGATGTACACGTTGTGGCTGTTGA AGTTGTACTCCAGCTTGTGGCCCAGGATGTTGCCATCCTCCTTGAAATCG ATGCCCTTCAGCTCGATGCGGTTCACCAGGGTATCGCCCTCGAACTTCAC CTCGGCGCGGGTCTTGTAGGTGCCGTCATCCTTGAAGCTGATGGTGCGCT CCTGCACGTAGCCCTCGGGCATGGCGCTCTTGAAGAAATCGTGCTGCTTC ATGTGATCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTCAGGGTGGT CACCAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACT TCAGGGTCAGCTTGCCGTTGGTGGCGTCGCCCTCGCCCTCGCCGCGCACG CTGAACTTGTGGCCGTTCACGTCGCCATCCAGCTCCACCAGGATGGGCAC CACGCCGGTGAACAGCTCCTCGCCCTTGGACACCATGAATTCATCAAGTG GATCTTGGTTTGTGTGAACCTCGTCCAGCGGGTCCTGATTGGTATGCACT TCATTTACCTCCTCCTGGTTGCAATGTTCTACTTTACGGACTTCATATAG CCTTTCGTCCATCAGTTTGAGCACTTCTAAGCCAATTGAAGTGAAGTGGG GATGCAGATATCGGGCAAACAGCTCCAGGCAGTTTGGTTCCAGCTGGTCC TTATCCAACAGGAGGTGCTCCCTCAGCCAAGACAGCAGTGGTGGCTTGTG GGAATGCACAATGCTGGGCACGCTGAAGATCAGCTCGGTCTGTTGGATAT CTTTTCCATAGTTTTCAGAAGCATCGGAGCGACAGGCCACGTAGAGCATC TCGTAAGGCTGCTTCTGGGTGAGATCCGACTGCGGGGGAGCAATTAGTTC ATGGTCTGTGCTAAGTTTGTACCATCGGAGCTTGTGGAGCAACCGGAGAT TCCAACTGGGCAGCAGCTGCTGCTCCAGGGCCAACTGATGCAGCGTCGAA TTGGTGCACCAGATGGCCACCAGTGACCGTGGGTGCGTAAGCTTCGAGAG CGGTATGTGCGACAATTGCTCATTGCTCAGCATCGAGTATCCCAGCTCCG GCTTGGCCCGCTTCAGCCTGCGGATGTACTTATTCCGCCACGGAGGATCC AGCACGATGAGATCGTAGGCGGGCAGAAGTTGGTGCAGTAGTGCAGGCAG ATTGTCCACATTGTGGTTGAAGAATCGGGATTGATTGGGAATCAAGTACA CGCCACGGGATCCATCAACTCTCAGAAACCGCTGCATCCGTCCACTTTCG TTGGCTCCATGCAACTGGGGCACGTTGTAGCCATCCTCCCAGTGCCTCTT CATCGGTGAACTGTCCTCCGGTTCAACGGGCTTGCTCAGAAGCTCTAGAT ATTCATTCACTAAGTGTAAATCCTCCAAGGACGACGCATCTTCTACGCCG GCTTTCCTTTTGCGCTTCCTGGTCTTGTCTTCCTCAATGCCTTTGTCCGT CTTTTTGGCATGGAACTGGAACAGTTCGGACTTGAGCTTAAATTCGTCAT ATGCTTCGTTTATAAGTGTCTTGTGATCCAAGAACACTGCGAATTTCGAA TCTTCAGTTTTCTTTTGCAATTTCAACATTTCCGATATTGAAATGTCTAT CTGAAAATCATCCCTGAGTCTATCGATAGTTTTCCCAGTGCGCGAGATAT TACAAAAATATAAAATAATTGAATACCGACTGAGTTATAATTTTACAATT CTCTAAGATGTAAGGTCATTAAAAACAAAGGTCTATATGCACAGTTAAAT AAAGATAAATATCAAAGTTTTAATGTTATACCCACTACTAATAACGGGTC TTATTCCTGCTCAAATTAAAATAATCCTTTATATGGATTAACAAATCAGC ATGGAGTTTTCGATTTCCACGACGGTTATAGTAGCTAAGCTCCTTGCTAG AATTTTCGGCTACAAATCTCAGCATTGTCCACATGTTCAGCTGATATTTG CACCGCAAGGGATTATGCTTTTGGTTTGCCTGGAGGAAGAAGAAGTCGGG TGGCGACTCTACGAGGAACTTTTTGGGATTCTAGATCCATGTATATCCAT CTTGTACAGAAGCACTGACTCCTGTTTCAGTTTATCGGCCAGCCAATCCA GATTTGCCATAAGACTACTATTGACTTCAGCGCCATTTTGCAAGGAGTTG TAGAAGCAAATCGCTATATCATTATCACTGGCGTACATAAGTTCGTTCCA GCTATCAAGGCTTATATTCTCAACCTTGGGATCTCTAGCAGTGGGCTCCT CGGCTATCCCCTTAATCACCTGATCGCAGAAATCCCTTAGACTCTCCAGG TCGGGCAGTTTAGGCCCAGTGAAATCCCCAAAGAAGAATACCTTTCCAGT TGAATTTGCGGCGTATATCAGGGGAAATGAGTCCACTGTACATCCTTCGT CACTCCGAGAGAAGCTGAAGTCATCCTCATTGAAGATGAACGACTGCCAC AGATCGTCCACGAAAAAGTCCATCTCGCCGCCAAGAAACCCAGGGGCAGC TAGTCGGTATACCACATCTATCCATTTGTCTAGCGCACCGATATCATCCG CAAACACATGAAGAACCACGAGGGTCGGTCGCCTGTGGATCTCCCACGAT GATCGCAATTTTCCAAAATTGGGAAGTCGCTGCAGTCGGTCCTTGTATTT TTCGGGAAAAAAGGTTTTGAAGTTCGGCGGCGGCGGGTTGTAGCCGCAGT AATGTGCAGACATGTTTACATCATTCAATTGGCCAACCAAATGAAATTGC GGTGCGGTTGACTCATAATCAGCTGATTAGTCATAATAGTTGATTAAATA CGATTGCAGTGGTGGGCTTGAGTTTCCGACTTATCGATAGGAATTAAGTT CGATTTTTGTTAGCCGGTCAAAATTTGAATCAAATTTCACTTAACCGGTA TTGCTCAATAATTTGGTATTTCAAAATTTATGAAGTATCAATAAACATAA TGTTGAGGATTAGAGGGTAAATAGCTTAGTGTGGCAATTGGCAATTGTCC TTTACAAAGAACTGACTTGAAATAACCTAATACACAATTGCCCTTTGAGA TTCACCCTTCGCAATGTTTCGATAGAAAATAGGTTTGACGACTTAAATAA AATCTCTTAAAATAAATCTATTGTAATCACAATAAGTGCCCGGACTCAGG ACCTAGTTTCCACGCTCCTGTTCATCGCATTCAGGATCATATCCTCGAAG TGCTGGATGTTGGTCATCACGGTCAGGCTGTGGGCACACTGATCTGCATT GGGTGCATTGCTGATCACCCCGAAGAGGAAGTGACGGGCGGTGTTCCAGG TGGAGAAGGCGTTGGTCGGCAGCTCGGAGGTGAATCCACCGCCACTGTCA CCCTGGCAGGCGAGCGACTTGCCCTGCGTGAAGATGCAGAACTTGTCCGC CTGGATGTCCCGCAGATTCCGACGGCACACGGAATTCGACTTGGACACGG CCGGCACAAACTGGAGTTCGTGCTTGTTCTCGATGTTCCAGCCAGCGAAC TTGCCCTGCACATCATCCGTGACGCTCTCCTTCTCTGCAAAGCTGGCGAA GGTAACGCAAATGGGCCGGATTACGTGGCTCAGCTCGAAGGGCTCGTCGA GGGTCAGAAGGGCCAGATCCTGGTAATAGTTTTCCGTCCTTCCTTTGTAG CCACTGCAGGTAATAAACCAGTGCTAAGAAACATGAAGGAGCCAGTTTCT TTTTACTTACGGTGCTATTTCTATGAGCCTCACATCCCGTCGCTTTTCTT CCGGAGTAGTTTCTCCGTAATTGCGATAGAACTTGGCCGCAATCACCCGG AAGGTGTCGTAGCTGTAGGGCAGTCGAGTACCCTCGTCGTATACGCAATG TGCGGCGGTTATGACTAGGTCCGGGGTGAGTAGCGATCCTCCGCACTGAA AGTGGTAGTCCTTCTCGTTGTGCCACACATATCTACACAGGGAATATCAA TGAAATCATCGGGATGGATAGTTAGCAGACTTACAGTCCCACATGCCAGG GCACAACCGTGTTGTTGATCGTATAGCCGCCGGACGAGAACTGTTTTATG GGCGTGGCTAGCTGGCCGCAGTCCTGCTCGCATCGCTGGCGTCCGCGGTT CCAGTATCCTCCCTTCATGCACCGCATTTCTGGCAGTGGGCTCAGGGTCT TGAATCCGGTGGAGCAGACAAACTTCACTTCGGTGCCGGGCGGATGGAAT GGTTTGCGGCATTCCACTTGCTGTCCATTGTGGGTGCACAAGGCCTTCGT GGAGTAGCCATCGAATTCTCCGGCAGTGCTGCAGTATTCTACGGAAAAGC AAGGAGTACATGTGAGAAATTATTACCAGGGAACGGGCAAAACACAGTCA CTCACTCACGCATTTCGGGATTGTGGAAGTACTCCACTTGTTCTTGGCGC AGTAGCTGCTCTCCTCTCCCTCCAGCACATATCCCTGCTTGCAGGAGAAT CGCACTGTTCCCCGGGTGATGGGTCCAGTGAGGACGCGGCTGCCGTCACC CGTCAGGATGGGCCTTTCGTCGCCAAGTGGCAAGGGGCATCCGAGCAGCT CCAGCGGAGTCTCAGTCACCACGGGTGTGGTCACCTTTTTGGTGGTGTTG CATAGCAGTGGTGCCTCATCGGATCCGTCATAGCAGTCGTTTTCCCCATT GCATGACAATGACCCCGAGATGCAGCCACCTGTTCCGCACTTGAAGGAGT ACGCTGGACACTCCATGTGGCCGCACAGTTCCACCGACTCGTCAAAGCCC GTTCCATCCGCACAGTCGTCCTTGCCGTCGCACAGAAAGTTGCTCTTGTC CAGGCAAATTCCGGATGGGCATTTGAACTCATTTTCCCTAAAGGGGAAGA GAAGCAATTAATGTATCCATTCCTAGTCCTCATCCTGTTATCTACATTCT ACATTTCAGTACTCACTTGCAATTGCCTTGAAGCCGTCGGTCGTGCTGCC GTATATCGTCCTCGTTGCCGCATCTCAACCTGGTCTCATCGGAACCATCT GCGCACTCATTGACTCCATTGCACCCAGCTGTCCCGATCACACATGCTCC ATAGGTGCACTGGAAATAGGGCTTGGTGCAGTGCTGCCGCTGGGAGACAC AGGTCAACGCCGTCTCATCGGATCCATCCGGGCAGTTCTTCTCGCCATTG CAGACATCGTACTGCGAAATGCAGCTGCCGTTGTCGCACTCAAACTGTGA GCTGTCACATGCCGCAAATACTTCAAAAATGATCCTTTCGATTATTATAT TATAAGGACAATCGCGTGTTCCTTTACTTAATTGTTCTGATTGCGAAACC ACATATATTGGAATCAAGTTTCATTCATTTAGAGCACTTTTACTTTTGGT TCTTAAATTTTTTAAGAGTAAGAGATTTGTTACTCATATATACTTAATAT ATAAACTACACTTTAAATTTAAGTTTAATGAAAACTTACGTTAAGTAACT TAGTAACTTTTCTCCCTACATTTACAATTTATGCAAATCGGCAGAAAAAT TGATAATCCCTATTGCGCTTTTAATATTCTTTATTTTATTTTATTTTTTT CCTCATTTGATTATTGCGATTGTGTAATGTTGTATAGCTATTTTTCTTAG CATTTGAGTGGGTTAAGCTGCCTGTTAAAACTACCGCAGCTTAACTAAAT TACCGCGTTTTTTATTATTTATTTCCGTAAACATTCTCTCTCCCTTCACA CTTAGTCAGCACCCTGGAGTGTAATAAACAAACTGAAAATCGACAGAGAT AAACAGATCGCGATTTCAAGATGAACCGGCTCAAATCGTGTTCTGAGAAT CTCTCTTCGAGAACAACGCATTTACATATGTACATATGTACAGAAAGTGT TTATTTTCGTTCCATTTGTATTATCATTTTGAACTTTACTCACTTGTTCT GAATTTCAATAAAAGCGCGCAGAAGAACAATGGATTTGATAAAAACGATA TTAGTTGCATAATCCTTATTTCTGATGCACTGTTATGCACTCGATCCAGG TGCACAAGGCAATCACATAGGTATGCCTAAAACAAGTGCGTGCTGATTAA AGTCGTCTGGAAAGCACTTGCCGCCGAGCTAAGAACGACTCCGACCGAGC TTACAAAGCGAACTGAGCTCCAATGTGTTCAAGCCGAATCTCATACCAAT CTGAAAACACGTTTTAAGAGCACCTCATCAGTATCGATTGGAGTGCTTAG AGCTGCAGTTCATAATATAAGTCGAGTGAGTGTAGTATTTATATCTCATT TCATTCATCAATATCTATCGATATCGCAGAAAAATAAAATATGAAATTTC GTGTTCGCACTTCCACTAGTTGAGTATTGGGTATCTGATTGTCGGGGAAG TCGACTATAGCATTCTCTCGTGTATTAAACTTTTACCAAATTCATTTTGG AGACTTTTCTCTCAATGGTTTGAGTCCGCGCTAAAAGTGGGCGTTTAGCT AAATTCTTTTGAAAGAATTTAAGGAAATTAATTGAAAAATCAATTTCTTT TATTTTTAAAGAAGTAGTTTTCGAAATGTACCGATATCATTTTTTACATA AAAAGTCAGTCGTAAAAATTTATTCAATTAATAAAAACGCTTAAATAAAA ATGACAATCTTATAAACACCAAAAAAAAATTTTACGTTTTTTTTAAATTC TCAATTTTTTTGGAAATTAAATTTTTTGACGCTAGTGCTGCCAGATCTTC GAAATAAGGATTGGCTTCCCCGTAATCTTTTTCAGATCGATATTCATTTC CATCCGTTCTACGCATAGCGTAAGATGTAGAAACTACGAAGTCTACATTA CACGTGTGTAAAATATACCTTTACATTTGTATGGTTTGAATTTCCACTGA AAATTTTATTCCTGGATAGCACGGCAAGAAAAACTTAACGTTTTATTGGC TTTCTTGGAACAAGATACTTCCTAAGCCAAGAAAGTATGGCGCCAAATGG AGAATATTGCTATTAAAAATGTAGAACGAAGGACTGCTATTTTAAGAGTA CCGCAAAACTATCCTTTCGAATTACCTACAATTCCGAAACCAACTATTTC ACATTAATAATCCAAAGGCATCTTTTAAATTATTTAAATCGTTTTGTTTA ATTTATTTGTTTCATTTTCCACATTCTCACTGGTTGCTGTTTGTTTTGTG TTTGTTCTTTTTACGTGTAGTTTATATTGATAATTTACAACTTACGGAGC TAACATAGAATGGCATTAAATTAGAGTTACATCGATTAAGTATGAACGGA GCCTGCGGGTCCAATCTTCGATCGCGGGGAGGGGAAATTACAAGTAGAAA ATGTAACCGCAAAGTATCTGTAGGTCTGATCTGATCGGATGAAGTAGGTA TATAGGAAAAGTAGTAGTCTCTTATGGATAGGCCTGCTCGGCCGAGGGTC AGAGAGTTTAAAGTAAAAGCCACTAGCAAATGTACAAGTAAGTAGCGATT ATTTAACTATTTACTACGAATGCACTGGTAAGTAAGTAGTAGGTAAGTGG TCGGATGCAGTACTGTATGCAAGACCTCACCGAATCGTCTTCCTTTTACG TATATCTGTTGCTACGATAATCCACGTTTAAATATTTATGTATTGTATTT TAGCGTCTATTCTTGGTTTGCGGTGGCGGGGACATCCCATTCGATCCACG CATATGCGTTTAAAATCTATAACATTTAACTTATTCTTATTTACGTATTT GCATCTGCCTTCGTTCCGTTCCGCAGAATTACTCTCTTATTGTTTGTCCA TTTCGACTCGATCCCCACATACATAAGTACATAAATATATATCAAGATTT ATAAATATAATATATCTATAATCGAATCTTAGGCGGTAGTACGTATACAT CTTCTGCAGGACCTCGTTACGAACGGCCCCAACTGGGACCACCATGGAAA CTCAACTGAAGGATCAATTATCGGGACACACACACGGAGCGCCTTGTGGC TTGAGTCGAGCACAGCTCGTTGGATCCACTAAACTATATATATGGTATTG GTATCGGTATGGTATCGTTATAGCTAATCGGTATGGGTATCTCTATAGAG CGTACAACTCACGATCAATTAACGGCTCAAAACGAGATCAAAAGCAATTT CGCATGCAAGCGGGTAGCCCGCGAAGACTCTCTCAAACAACTCAGGCTCT AATTACACTGGGAGAACGGAAAATCGCAATGGCAGAACTAAAATAATAAC ACAACAATCGGATTCGATTTCTCATTGTTTTTTTTTTTTGTTTTCTTTAG ATTTTTTCAAAACCAATAATTTATTTGCGTTTGCCGGGGCAAACGGTTTG TCGCACTCCTCTTCTCGCCGCTTCTGTCGGATAATCTCATAAACGCTTGT CATTAAACTAAACATAATAATAATAAAATTAGGCATTAATTTAATTTAAA AAGTAAACACACTACACATTACTTAAAGAAACAGCTTCACTCTAGTCGTT TGGGCGAGAACTAAACAAATTCGTTTACAAATAAACAGAGTTAACTAAAA TTGCATTATTTTATTTAATAAGCACAAACTATACACATTCAAATATTCGA TACTCCCGAAAACGTTTGTTCTTCGTGTCGTAATATGTTTACTTGGCTAA CAAATTCTATTTATATTTAAGTTAAAGTTTAATAGTTTTCATTTTGTTTT TGCATCCTTCGTTACGTATCTTAAATTGGTTTAGAACATGTTTTTACCAA AAATTCATATCAACAGAATTTTGCTCGCATTCAACATTATAATGGTATAC TTTCATTTTTTGTTTTCTTTGTGTTTCAATTTTTGAGTATTTTTCGCGAA ATTAATTTAAACATAGCAGTAAGCAACAAAGGGGCAGGACAGAGGTTTCC ATTTCGAGCGAATCCTCTTGAATTTTTTTTTCGTTTGGAACTAAATTAAA ATTGTTTGTTTTGCTCATTTAATTCTAAGTAGGTTTATAATCTGCGCTCC TTCCACTACTTTTATTTACTTAGCCTAGTTAATTAGTTTGTAGTTTTGTT TCATTTACGTATTTTCGGTTGCTGCTCAAACGCTTGAAATAATTCCATTA GGTTCGATTTAGGTTAAGTTTCGTATTCGCACAAGTACCATCAAAATATT TAAATATTATTCATTTAAGTAAATAGTTCATTTGTTACAATATAGTTGCT TTGTATCTGTCTCCGCGTCATTTCGCCCAATCCCACATACACCCTACGGA TCTAAGGATCTAAGGATCTAAGGATCTACTGATCTAAGTGTCCACCTTGG ACCGCCGCCGCCGCAGCCGCTGCCGCCGCCGCCTTCTGGGCCTGCGCCTG CTTCTCCTGTTCGTTCAGCTCCTTGATCGCCTGGATCTCCTTCTTCAGCT TCATTCGCCGGTTCTGGAACCAGATCTTGATCTGCCGCTCCGTCAGGCAT AGCGCGTGCGCCATCTCGATTCTCCGTCTGCGGGTCAGATAATGATTCGT GTGGAACTCCTTCTCCAGCTCGAGCGTCTGGTAGCGGGTGTATGTCTGTC GGCCGCGTCTTCGCAGACCATTTGTACCTGTAGATCGGAATGGGAAAGCA TTTGTAAGTAACCAGATTATTAAACTTTTAATATTATTCATTTTGGACCT GCATCGACGAAATACATACATTTCATTTTGCAATCAAAAATATGTGTCTC ATAACAGCAGCTACAAAATGCAGATATGTGTTAGGAAAACATTGACAAAG TGACTAAGTAGATATATATCTTTATCGATTTATTGGCCTAATTATTTATA TAAATCGCCACAAAAGTGATTTAATTGGTTATATTAACGTTTAGGAGAAC ATGAGGACATCAAAATTTGAGTCATATTGAGCAGCAGTGACAGAGTGTTT TCGGGTATTTATATTTTGGCCTTTCATCGGGCAAATTAAATTGAAAAATT GCAACGAGCAACTCAACATTTGTTTGCTGTTCGCCGTTGTTATTTGGCCA AGTCGTAAATATAAATTCTCCTTTTTGCCAGCGATCATCAAGCAGCTCGA ACGTAGGCCGCAATTGCCTGCAAAGGGGCCCAAATCGAAAGGAAAGGGGA TCTCAGCGCAAAAAATACATTTCATCTTTACGAGTATCGCCGAGTATTTG CCAGTTTGCCAGTTTGCAGTTGCGGTTTTTGTTTCTGCGGCGCGATCGTT ACTTTAAATTGATCGTTTGCCGCTGCACCGCCAATGTTGCTGCCGTGCTG TCATTGCATCCAGATTCGCAGTTCCACAGTTCCTCAGATACAAAGATACA CAGATCCGCAGATGCAGCCACATTAAAATGAAAAGGAGAAACGTGCGAGC ACTCGGTTGTGGCATTGCACTGGGGATATGGCGAATGTGGCTACTTAAAT TGCAGTTATGCCAGATAATGCCCGTTTAATTGGCAACCTGAGAGACGAGA TGGGGCAGGAGGAGCAGGGGAATCCAGGGGAATCCGGGGGAAGCCAGGGG AGCCGGGGCAGCCAGAAGTCGCATCAACATGTTGCAACAATGCCGTGTTT AATCTCTGATTTTAAATATTTATGAAGTTTAATTTGCCTTCAAGTGCAAT AACTCAATTTCGTGTGTGTGCAAATGCACTGCAGCTGTCTCTGGCCCATC TCCCATCGAAGAAGAGGCCCAGACAATGTCTGATATTATCGAAATCAACC CATACCAAATCATACCACACCATATCAACCAACCAACCCACCCATTCGAC CATGTTAACTTGGCATTTTGGAGACCAGGTCTTTCTCCTGGGCCCGAGCA CAATGTTAAGTTAAATATTATGAGCATTTATTATGTTATAAATTTGGCCT AAAGGTATTAACAAATTTATGCCGACACGAAAGTCATAAAGTGAAAACGC ATTTATCTTTCACTCACACAAGCACACACATGTGCAGCGTACGTAGCGAT TGCAATTGTGTGGGTGGTGGAAATAAATGGCGAAAAAATTTTATAGACAA TAAAAATGATATGGAAATAAAATGGCCAGGATGCAACAAAGAAATTATCA TCTATATGGACTCGCTCATGCATGCTGATAAATTTCCTTAATGTGGCTTT ATTTTTAAACTGCCTTGCGAGAATTATAAAGACCCATTTAATGTGCCAGA AAATTGGCCAGTGACAGGTCACAAGATTTGCGATGCGTCAGTTTATGGCA ATTTGTCGGCCATATCTCTCAGAAAGTCTTAACGAAATGGTAGCAAAAAT ACAGGATCCTATTTTGGTAAATCCTCGCAGATTATTTGTTTAAAGTGCTG TTGGAATTTCAATTAAACAAAGAAGCTGACTCGTCGAAGAATTCCCAAGT AATTTCCGCGCCCTTCGCGGCCAAATAAGCAGCGCAAAAGGCTGTATACT CGTAAATAAATTTATTTGGCTCTAAACCTGTTTGCTGATTAACTTAAATC CCCGGCAGTCGTGCCAGCTTCGTGGCCTGGAAAATACATCACGCTGAGGC TTAGCAAAAGTTTCATTTTATTTAGGAGTTGCCGGCGAAGTAGGAGATTT TGCTTGAGGAGTACGTGAGCTTTGCTCGGCAATTCTAAATGGAATTTGTC ACTCGGCGACCGACTATTTTATCGCAACTTACCGCCCCACAAAAAAAAAA AGGAGCTACGTACGCGTACGTACATATATGCAAAAATAAACTTTTTACGA AACTTTGCTTTGCCGCGATTTTTTTTCCCGACCACCCCTCCGAGTTTTCC TCACCCGTTTTAGAATTTTTTTTTCCAGTACTGGCCAAGTTTCCAAATTT ATTATGCGAAAAAGTGCGAAATTCATTTTGCTGGCTCGCTTCTTTGCTTC TTCTTCTTCATCTGCGTCCTGCTGTGCTGTGCCATTTTCTTTTGTAGACT TTTGGAAAATTTTTGTGTATTTCTAAGTACATAATTTAAATGCTGGTATG TGCGGGCGAGGGGGTGGCACAATAAAACTTGGTATGGCAAGGCGCGAAAT TTCTTGTAGATAATTTAAACGAGAGCGGTGGGTGAAGTGGAGTGGAGTGG GGTCGGGGAGTCGGGGTGTGAGTCTAGGAAATCTTTTTTCAGAATATTTA TTCGGTTCCAGTCGGTTTTCCATGGGGCCTTTCCATGGCTTTTCCTTGGT CGCCCCGAAGATACATTTTCAAGGTTTTGTCGACTACGTCTTCGTGTGTT TTTTCTTATTTTTGCTTTTTTGGGGCAGCACAGCTGCGCCTGGGTCCCCA GTACGTGTTATATTTTTTAACTTAAATTCCTCAGGGATTTAAAGTTTTGA CAGTTTACGTGTTTCCCATTTGCAGCGAACTTTGAACCGAAACGAAACGG AGCGATATCTATGCCCGTCCCGTTTTCGCCGCATATATCCGTCTCTTTCC GCCCAAGGGGAAGTGACTCACCCCCGGAGTAGGAGCGTTGCCAGCGGCCA TAAATCTCCAGGTGACGGCGACTCCATGTTGCATGCGGCACATCGTGTGA TCTATGCTTCTATTATAACTATTTATATACACAGATGCGGATACACGCCA CACTACTACATTCACTACTTATACTTAATTCGATTTGGTTTTTCAGCCTT ATCTTACTCTTACTCTTTCTAATTTATGCTTTGTTTTTGTCATCGTCACG TGCTATCTGAGTTGAGATTTTACCAGAAATTGGGGAGCTGTCCTCGGGTC TGATAAGCTGGAACTCGGATGGGGACATTCCTGGTATCTCATCGATACAA TACTTAGATTACGGAGAATTGCTGAAGAAATGGGACTCGCTGCTGCCATT TATAACGTCTCAGGCCCAACCGGAAATTAATTGCCTCTATTTTTTCCCAG CAACAAGCCGTAAGGACACGCGGAAGGAACCCTTTTTGGAGGGAAAAATG GCCAAAAGGCGAGAAGAGCCATCGGTTGGCCATCGATTAATTGGATGGCT TGGCACACATGTGTCGCCCGCCCCATCCACTCCGTTCCGTTCTATGGCAC GCATTTTATTCGCAATTTAATTAAATCTATTTTCGTGCGTGTTTGTCAGG GGCGTGTTCCACCTTGCTTATATGATGTACGAACCCACACACACAACTCA CACACCCACCGACAGCTGCTAGATATATAGGGAGATATATAGGTGGATAG GTGGGTAGGGGGGTTCAGTACATAGATTCTCCCCGGATTCGAATTCGAGT GTCTATAAAACAATTAAATGCGTCTCAGCTCCGGCTGAGGTTGACTGCGA GACGGAAAACTAATTTTCCGCACTGCCAATCGAGGACCACTAAATCTGTC AATTAAATTGGCCGCAGGGAGTACGAGGCTCTGGGGACGGGGCTGGGAAT GGGGGCGTGGCTGCCTTGAAACGCTCGGTGTTCAGACGTGATTATGGCCC CCATCGAATGACTACGCCTATGCCACATATTGATGCTTGCGGTGGCAAAT GCGCAATTGAGTTGCAATTGCCAGCACAAACACGAACGCAATCCAAGTTG CAAGCAGCAAGTTGCAGGTTGCAGATACTTGCAACTGCAGCTGCCGGTGC GGTGCGGTTATCAAATTTTGAGATACACGTTTAGGGTGTGTGCACCCCCA ACTTGGCCCAGTATCTTATGGCTGTCGCAGCCAGGAACTGAATTTTCAAT TTTTCCCCAAAAAGCCAAATCCAAACTCACAAGGCAATCAGAGTTTTTAA TTGCTTTACGGTGGGTAAGGACAGGCTTGAACCAAAACTGAATCTGCATC TGAAAGTCCTAGTTGCTGGTAATTGAGATTTTCCCTGGGCTCTTGCCGAA AAATGATGTGCCAAGTGCCGTTGGGATCGCTTCGATACGGATCGCGGAAT TTGTGGCGCGTACAGCCTACAAAATTGCGATGCCATGGCGTAATTGCGGC CGAAAAGAAAGGGCACCTTTTGGTGAAATTTTTGGCGAACCGCCGATAAA ATCCGCTTAAAGCAAGGGCTTATGCCTCACGCACCTTTTTGGTTTTATTT TACCTTTTTCAATTTTTGCTTCATGTGTCTCCCTTTATCTCAGTAATTTT GGCTTGCAAGCGCAACTCTCAATGGCCGCCTGATGATCTGAGAAGTGGAA CGGCCTGGGAAACTGGTTCCACTCGCACGGGATCTGGGCATGGCGGCGTA TCTTTTTACGCATGCCCAGGATCAAACGAAAGGGGCATCTCTCTCGTCAT TAAAATAATTCATTGCAAGTTGCTCGCGGTAGCTGCCGGTGCAACAGGTA GCAGGTCGACTCGACTCAGGGCCACTGACCAGCAATCCATATTCCGATCC CCGAACGCCGGTTATGTGGCATCTTCCAGGTTTTGAGTTACGACTGGCCC TGTTGAGCTTGCAATTTAGCAGTAACAGTCTTACTTTCAGGGGGAAAACG CAGGACAAAGAGGGAGCTTCGAATAGTGACGAATGCTGGTGTTATAAATA ACGAATTTGGCTTAGTTTTCTCTATCCATTCAATCCATCTACTAAACTAC TGTGTATTTAGAAGAGTCTGAAATTTTCCAATTCTCCCTAATTAGGGCTT TCCCTTTCACGTTTGCGCTAGGCGTTACTTGTGGGCCGGCATGTCATGCC AATTAAAAGCCAATTTGTGTATGAATGAATAAATTCAACTGTTTATTGTC TATATTCAATGTGTTAGTTGTATAATAATGCCATCATCATTGGCACACCG AATCAAACCAAAAGATGGCTGAGTGACCCAGTGCCCCAAGCTCAGCCGTC TGGAGCTCAAAAACCCATGGCGCGTCGAAGCTGAACGCGGAATTTGATGT GGGTTTATCTTAATAGCTCAATTAATGAGCGATGTGAACGCCGCGGCACC CCTGTAGCCCGTTGTCCCTCCAAAAAAGAGGAAAAATATATGTGAACGCG ACACGCCATTTCCATATTCACATAGACCCAAACCATCTAGGGTCCGCTAG ATATACATATATGTACGTACGTACATATATACCCCAGCCAAGTGTGTGAG TGCGGAACGCCTTCCCATCGTGCTTTAACCTCGGCGTCATCATTAAAATA ATCAACGACTCTATTTTGGCTCCGTTTCAAGTTCTATTTCCATTTCCAGT TTCATCTTCATAGACAGACAGATACGGATACAGCCACAGATACAGTCGCA GATACAGATACAAAGCAGCGACAGCTGGCGGAACGCATCGATGGGGATTG AGGAATAGAGATACGGATACTCAGACCAAAGTTTAACAGTTCAAATGCGA AGCACAAGCACAGGCATTTGTGGAAGATGCGAGCAAAGCGTGACCACGAA GATGAAGCTGTTCAATGGGGGATTTCGATTCAGTTTCAGTCCGGCAAAAT CCCAAGACAGCCGACAAACAACAGTCTTGGACGTCGGAATAAATAAATAA GTGGCACGATGTCAAGCTGTTTCATATCTGCGGCGAACATCGTTCTGCCG GGCAATATATTCCCGATTTCAGAGCTCATTAGACGGAAACTAAAAACGCA CAACTCACAAAATTCGCATAGAGCCACTCATCTGACGTCACCTCGAGTCC CCGATAATTATCGATGGGAGTTATGGCGCTGCTTGTGGAACGGAAATGTG CAACATTTCCGCTACTCACCCGAAAAACGGGCCAATAAAAATCAGCGCCA AGTGTCAAATCTAAATAATGACTCCCAAATAGGGAAAATGGCTGCCAACC CCGATAAGACTCGGATTGTTTATGCTTCGTTTTTTTTTTTTTTTTGGGTG GTGGGGCAGGCGGAAGGTTCTTCAAGATACAAATCGGACGACGGCGGCAG CGCCATTTATGTATCTGAGTATCTTTTAATTGCGCGAGAGTGCGCCATTC TGATCCGACACGCCCTCTCGTTTGCGATTCTGCTTTGGGGCGGCCTCTTT CTTCTTCGATATCGGTTGAGAAATCGACTCGAATGCGTTTTTAATTGCAT TTTTTCGTAATCAGTTAGGGGTTTATTTTATGCCCCATTATATATGTCTT GTTGGTTGTGCTCTGTATACAACTGCTTACATAAATTAAAAAACATTGAA TTACTGCTAGCTTTCTGTAAAATAAGGATTTGAATGGTGTAACTTACATT TAAAGTTACCAGCACAAAAATCACAGGTAAGAGTGTGTTCATTAAGGATG TCACAAGGTTCGTCTTCGTCTAGTCAAATTTCGCCAGCGTACCTTTGCCT AATTAATTATCGCAGATTCCGGTTTCGCCCAACACCTTTCCGTTTCGCAT TACACGCCCAAAATCACGCCCCTTCACCCACTCACGCACACTAACTTACA CATATGTGTCTATGAAAGGGGAGAAAGGTCAGGTGGGGCAGAAGAAACTT CATTAAGGGCGCATAAAAGTAAACAAGCGAAAAGTGTCGGAATTTCACAC ATAATTGGCACTTGAAGTTTTTATTTTTATTTGCCCCCCCTCAACTAAAC GACAAACTTATGGTCCAAAAACTGTGCAAGTGAGATGGCTGGATTGGGGG AAGAGAGACGGAGATGAACATGGTGGTGCCATTCGGCGTGGTGTCGAATT CGGGTTTTGGGTTCGGTCTTTTGGGGTCACACCAGCTGCTCCCCGCCTGC TTTTTCTTTCTTTTCCACCGTCTGACAGAAAAAAGTGAAAGTTAAGAGCA ACAATTTCTTTCTTTTTGCCCCCCGTACTGTTTGTTGTTTTTCAAGTCCT CGCTGCTAGAACGTGTGAAACTAACAGTTAATTTCAAAGTTGCAGTTGCC CACCAACATCCAACATTCCATATCCCGGAGTCCTGGATCCTTACCCTGCA CCTATTCCTATTCCGATTCCGATTTCGATTCCTGCCGCGTCCATTGCGAG AGTTGCACTCTGTTGTATGTGTGTGTGTGTGTGTGTTAGTGGGGGTGTGT GTGTGAGGCTGCGAGTTTGTCGTTGGGAAGATTTATGCTCAAATTGCTTT TGCGCAAAATCGACAAAAACATCCAAAGGTGCAGAGGGCCAGTGAAGTGA AGACAGTGGGTTAAGTAAATATAGTAATACAGTTGACCGTAAGAAAAATC CTAACATTTGAAGATTTTAAAGTTGTGTTGGTTGAATTGAAAACCAGTTT CATATAAGATATTGTCCCAAAATTCTAGGGTGGTATAAAACTTCCTTACA ATTTTTTTCTCCCCACTTATCAATTCATCCCATTGTACCTCGCACTGGGG ATGCAGTTGGTCGATGCCGGGTGCCGCAGTTGTTGCCGTCCCGTTTCGTA ATCAATAACATTTTCGCAAGTGAATTACTCGCCATTGTTTTGCCCATCCC TCAGACAAAGAATTTACGGCCCAACCGGGAGCGGGAAGATGGAAAAGAGG GGGTGGGGTTCAAGTGAAAATGGGAAGGCGCAAAGAAAGAAAGTGCTAAG GTTGAAAATTTTCATTTCCATTGTGAGTCGTCGCCTGGCTCTATGCTCCT TCATAGATTTATGATGGTTTATAATGAACTTGTAAAGTAATTATGCGCTG CGACGCATCCGTGTGTATGCGCCACCTTGCCCCACCGGAGAAACCGGAGA GCCAGCACTTCCTCTTCCACTTTCACCACCACCGCCATAAGTCAGCGCAA CCCTTTTCAAAAAATGTCTCCTGTCGTGTGATTTTTGGTCCACCACCCAC ACAGCGTTTACGCTTGTAATTACACGCTTCATTGTTGAAAGGGCGCAGGT TCAGAAAGGAGCTCCCAAGATGGCCATGGACGTGCGGCGAAATAGTTTTA GGGGGGCTTAGGAAATCATTATAGAATGCAAAGTATTCATACAAAATTTG AAATTGGACACTCTGCTCATAGTTTTCCTTTTTTAAGCTTTAATATTGAT TAAAGATAAGGAATAGGAGTATGTAAGTATTCTTTTAATATAGAGTGAAT ATAATGAATACAATTTATAATGATGCACATCACGTTCTCTGAACGGCCGA CTACGCCCCTGGACATGGAAGATGGTTCCGCTGGCATCGAGGGTCTCCAT TTTCCGTGTTGTTTCGTCGCCTCGCTCTGGTGTCGTATATCTCCGTTCTA ATTGGGTTTCGTTGTGCGCCGTGCCCGCTAATGTCAACCCGGCTTGTTGT TTCCGTCCCAGCCACCCATTCTGTCGTCCTCGCATGCGTGCTCCTCGGAG GAAAGTCCTTGTCCCTGTCCTTTACCCCACTGCCCACCCGATTCTCGTAG CTTGCACATGCAAAAGACGATCCCCAAACTGCCGAAAACTGAACTCAGGG CCATTAAAAGTGGGCGTTGTGTGGGAGGATGTTTGGAGTGCTGTTTGAGG AAACGGAAACGTTGAGCTTCGTCGCTTCTTGGGATTCCTTCCCTATTGCG TGAGTGTGTGTGTGTGTGTGTGAGAGTGTTGGGCTCCAAGGAGCTGGCGT CGGGTGAATTATGTTGCATGCTTTTAGGTGATTTAGCCCACGTTTGTATG CACAAACGTCTGCAGGGTTTTGGTTTATGTTTTGTTTAACTAATATTTTG TGAAATCTTCTTGGGAAATTATGAACTTGGCAGGCTGCTGGATGGCTGAC TGGCTGGCCACAACTGCAAACTTTACCCACCCATCCCCCAGTCTGGACAA AAGTTTTTCATTTTGCCCTTTGCCAATTTCACACTCTGCCAAACGCTGCA GGGCGGACCATAACTTTTTTGCCAATAGCCTGCTTAGGAATGAGAGGTGT GCTGAGGGTCCGAATTTGGGGAAAATATTGTGACATTTCTTGCAGTTTAT TTAAAGCAGTCGAGGTGAAAAATGCACTCCCCACAAAATTGGCATATGTT TGTGAATAATAGTCCAAGGTGCCTGATTGTTTATGTTGTTTCTTCAAGGC ACATATTTGTATTAAATTGGTATTTGAAAAATTACATTTTTTCCCGACTA TCCGTCCATTTTATCGCCGATAATAACGGCCTGATAAGCTTTCCTTTCAG AATGAATGGAGCTCCTTCCGCCAGGCACGCTTATTAACTTAAGCGAATGG CGGCCGGCTGTCTGTCGTAAATCAGACCCCCCAGCCCACTTCAATGCGCC TGCTCGCCTGGATTTATCCGCCATCCAAACTGCGACATTTTCCCGGGCGG CGTTTCAAGTCTCTTCTCACATATTAAAAATAAGCAGAGCAAAACCAAAA CAGAGAAAAAATCCCAACAACGTTTTGCATAAAAAATAAAGCACCGAGTC ATGTGTGTGTGACATCATATCGTATATTGTCGCATGAATTTACGTGACCA TATGTTGTCGCCGAAGCGCATAAATTGCAAGTGGGGCGCAGACGGCTTCT GGGCCTCAAGAGCTGCCCTAACCCTTTGCCACGCCCCCAAAGCCCCCATC CAATCTCCTCCAGATGGACCAGGACCGGGGGACCAGGCCAAGTGTTGATA TTTCGTTCGATGGTCGTTTGACTTCTGCAAGTGCGAGGCGACAAAAAATG CGGATAAAAAATATGGGTGAAAAATTTATTGAATTTAATTTGAATGCGCC CAATGGCCCCCGCAACAGCTGGCACTTGATGGGGACTCACTATCAGTGTC AGTATCTGTATCTGTATCTAAATGTATATCTGCTACTCCATCCGTATCTG CATCTGCACATCCGCACATCGTATCTCATTCCGCCTTAGAGCCGAAAGCC TGGATCATATGAATATTTAAGCTGGCAGGCAGCCACCGCCTTCAAAATTT ACCAGCCGCCATTCGAAATCGCCTAATGAAGCCGCGCAAAATTCGTTTTT AATTGCCATCGCAAAATCCCGAAGATGGCGGCGGGTAGAAAAATTTCGTT TTAATTACTGCCCCGGAATCCCGCCGGATCGCCGAGACCGAGAATCGAGC AGAAATATTGCCACTTGTGTTTTTTAGCCCAAGCTCGAGGAAGTCGAAAA AGAGACGTGAAAGAAAAAACTCGATTTTCCAGCTAATGGATGAAGGCAGA ATTGTTGCTTTCGGAAGAGCAGGACCAGACCAGACCAGACCAGGACTGGT ACTCGCACTGATACTGCAAAACCGAGAATGGGAATGAGGATAAAGACTGG GCCGGTACTCCGCGCTCGAGAGTTCGACATCGGCACAGCAGCCAATTAAA GGCATGACATAAATCCAGCTGTGACTTGTATTGGGTGTTTCCGCCTGCGG CCCACATTCTCCATTCCCACTGCTCAGTCCCCAGTCTCAGTTCCAGTCCC CAGTTTCCAGCTCCAGCTCCAGCTACCCATACCCAATCCCAATACAATTC TGCAGTTGGGCCGGCAAAAGACAGCGCCAAAATGTTCAAGATTGTTGCAG GCCCAAACAAAACGGAGAGCGGAAAAAAACGTGGCAAAGGAAAACTTTGC CCAACCAACCCATGCCGTTCGCTTTTCCATGCTCACGCCCGTTGTTTCAT TTTACAATGTTGCCTCTTTATACCCTTACAAAGGGTGTATTGCGATTGAT TCGATGTTTGTAGTCAGAATCATATCTTAACAGCAAACCAAAAGTATATA TAACTAAAAACTATTTAGAAGCTGTGTATTTCACATATTTTCCATCATAA CATTCCATAACATTTTACAATGGAATTATTGGAGAAATTAATTTAATTTA AGAGCATTTAAATTTCCACTTTTCCCACTTTCTTTTTCAGATGGGTTTGG TTTGCTTTTCAGTGTTTTTGCTGTCTGTTTTTTGTTGTATTATTACATTG TACGAGTATTTTTCTACTTGACTTGGCACCGACGCCCTCGTTGGCGTTTC AATTGTTGTACGCTTTCCTCTGCCAGTGCTTTTCCTTTTGCTTTTCCCCA GGAAAACATGCACTTCGGCACAACTGGCGAAAGAAACCGCAGCTTATGCT ACCCCTCTTCCTACCAAAAAATAGGCAAATAAAATGTCAGTTCCCCGCGG GAATCCACATTAAAATTCTTGGGCGAAACACCCGCCAATTGCGAACTGCG AGTCCAAGTTAACTAATTTATGTCGCAGGACTTGGAATTAATGAATAAAT GGCTAAGGCCTTAGATGGATGGTGTGGGCTGGAAAAATGCAAATGAGTTT GCAAAAAGCCCACCAAGGTAAATAAAAACAGTAAACATTTCAGAGCGGCG AATCGAATCGAATCGAAACGGAGAAGACAGAAGAAAAAGAAACATTGCCA CACGCAATCTTGGGTGGAGGGCAATGAAAACTTTAGCTTACAAAGTGAAA ATTCCGCCCCAATTCGTCGTGAGCAGCTGCCAATGCTCGCCCAGAGGCAT TGGGCAAAAGCGAAACTTTTCAAAAAAAAAAAAAAAAAAAACTTACGAAA AGTTTTCAAGTTATGAGAGTGATGCCATAGAAGTGACATCATGAATATGG TAAATAGACCATCAAATTAAATATATACTTTTATAATTGGGGGGGTGATT GCCCTGAAGTTGGGGTGGAAATTATTTCCGTATTCATTTAACAAGCAGAG AAAATTAAGCTGGATTTGCTGGTGAATATTTTATAGTCCTCTGTTATCCT TGTCACTTTTTAAAACGAGTGAAATTAGTATTCATATGACAGTTTGAAAA ACTGTACACAATAATTCATATTTATATACAGCTATAATGAATGAATACAG CTCTTGAATAGATCTTATAAAAACTCCGGATTAAAGTTATTTAAGAAGAT TGGCATGAGCACCCTACTCAGTTGCAGATGGGTAGCCAATAAAATGAACA ATCATAATTAATAATCACAATTAATATGATTTGTTTGCCGTTGCGAGGGG CGCAATATTATTTGCTGAGCATTAATCGTGGAGAGGAGGGTTCGGGTTCA GGTTCGGGTTCGGAATTTGGGTTCGAGAGATTCACTGGTTTCTCCAGAGC CCGCATTGGCAGTTCCCGCTCCCCCAAGAAAAGTTGGGCAATTAAAATGG TCCAGCACATGACGCCAATTGAATTGGAGTAGGGGAAAACTCGGTGGCCG ATAAACGAAGAGAGAAGAAGCCAGTGGCAGCTTGGCATTATCTTTCGGCA AACAGACATGACAACGAGGAACAAATAAATCGCATAAAATATAATTATGG AATTTGTAGCTCTCAGCGGAGGGAGATTTCCGCACTTGATGGCGCGGGGG TGGCGGTGGTGTGGGCGCCTTTGTGGGTGGTGGCAATGCGGTTGCAGTGC CTTGAGTTAATACGCGAGTGTAATTAACTTGTGATTTATTGGTTTAAGTT TTAAGTAGCGGTCTCTGCCGCGTCTGCTGGTCCGCTTCATTTACTTTTCT TTTATTTTCTATTCATGCCATTGGTTTTATTCTTTCCCAGGAATTTTCCT TTTGCCACTTTATCCTGCACTTGTCCCCCGGTCCGGTGGTTCATTTTGTA AACTTTCTCCTGCCTGCTTTATTCGCAACAAAATGTCTTGGAGAATAAGG CTAATTTATAAGGAGTCCGCCTCTCCGAGTTATTCCGCCCGTCTGGCCAC CGCATCCGCCCACCTTTAATATTAAATGTTACACCAGGGACACATTTCGA TGAAATATTTCGTAAAAAGTGTCTACGAGAGAAAAATTTGCTCTCTTTCT GCTCCTTTCGCCGCCCGCCCGCCAAAGACTTTCCCATCCCCTTGCCCAAC GCCCGTTTTTCCTACGGCTACGACTTCACCTTTTTCGGCCAGAGTTTCCT ACCAGAATTTCCCTGGGCCATGCGTCTTGCTCAAGTTGCTGGCACAAAAC TTTCTCCTTTCCTTCAGGGCGTCCTGCCACGCCTCTCGCGCCCCCCTTCT CACGCACGTGGCAAGAGGAAGAGGAAGAAGAGAGCAGCAGCCAAAAGATG CTGCCTTTTGTTTTACTCGAAAGGCGGCGCGCCAGTGGGTGGGTTTTTCG GGCCTGGCACACAGGCCAAGAATTATTACCGACCAAATAAGCGATATTTC TCGAGGGATGAATGTGCTTTGGTGCGTGTTTTATTTTATTTCGTTGAGTT ACAATCCACCATCTAACGGTACACGCTTTTCCCTTCCGCCCCCTCGAAGG GTGGTGCTCGCCGGTTCAGTGGGCGGGGTTGTTTTGGATGGGGTGGTGCT GTGCGCATGGCCGCCACCGAACGGAGGTGCAAGGGAAAATGTCGAATGCG AAATTAAGAAAACATGGCAGTAAAATTGGGCAATAAATCATTGGGGGGCC TCAAAGTGTTACTTCCACAATGTACACAGTTGGAATTTGTTTAGCTACAA ATTGTATAGATTTTGCAACACACTGCGACATATGCCGTTGGAGGAAATGG CGTGGAAAACTGATTGGCTTTATTTATAACCGGGAAAAATTGACTTTGCG GGAAAATGCGGTTCAAACGGCGGTAGTTAATTAAAATCAAAATAATTCAT TGTATTTTTTTACAGGTGCTAAAAATGTTATATATGTTGTTGTTTTTTTT TTTAGCTTAACAAGGACTTTTGGCCTTCTCCATTCACAGCTTGTAAGTCT TGTGGCTCCACTGGTCAATCGAAAGGCAATCCCCGTAATCCCATATCGCT CACAGCTTTCCCATCCTCCGATGCGTGTGTGAGTGTGATTAAAATGGCGA TATGAATGCATAATAATACGAAAGTTATGACCCAGCCAGACCCCGCCGTC CAGTCCGCTTCCCTGCCCGCCCGCTCGCCTCCTAAATCGGCGCATAAAAC TGCAGCAAACTAAAGTCCTTCAGCACCCCCAAAATCCCCCATTCCCGGCC ATCATCGCCGGGTGAGTAAGTGTGCTGAACTTTGATGCCGCCACATTCTA TTCGCATTTGCGCTCCAACTACCTATAGCCATATATCTTAGTCGGCCGTC CCAGGAATATGTGTGCTGTGCACTGCGAAAAAATGTTGAAAGAACTTTCA AGAAATATTTTGAAAGTGAATGATACTTCAATATATGTAATATGTATAAA TAATATTACAAAATTGGGAAAACGTTCCCTAAATCCGGCTCATTGCCAGC CCAATTTCTTTGAGTGTACCACAAGGACTAGGACTAGCAACGACTCGCTT CAGCGCCAGCGGGCCGCCTGATATTTTTTTGTCCGTTTGCATTTTGAGCG AGTCAACGCCGAGTACGAAGCCGAAAAGCCGTAAAGCCTTTGCCTGGAGA GTTTTCCGAGGGGCTGGGCCACGATGGGGTTTAGGCGCAGTGGCAAAGAG TGCCGCCCTGGAAGATTTATGCAGTTCATATTCACATTTTCCAAACGCCG CATACCAGAGACCCAGCATTCGAAACGCACACGGCTGCAGGGTGCCAGGG GCGGCGGGGTTTGGGGCAGTGGCAAGGGCAGGGGCAGGGGCAGGGGCAGG GGCATGGACAGGGTCCACCACGGACACTGCAATGTGCATATGTGTTCGCT AGGCCAGCCTACATGTGTGTGTGTGTGCGTTTAGGGGGAAAGAGTAAGTC CAGCCGCAATTGTTGGTGCTTTTTTGGGCGCAAAATGGGCGCTGAGCATT GCAGTTTGCAGTTTTTGTTGCTGTTAAGGTTTTGGTACAGTGGATGTGAA ACGGTTTTGGGGGTCAAATAATTAACTATATAAAAATACCACCGATTAGA TGGTAAAACTGTTGAAAATGTCCTTAACCAATCTTCAAGTAGAAAGACTG ACAAATAATAACAAAATCCTTCTATTTCGGAGAATTTTAGCAATCAATAA TTATATAATAATATAATTATAATAATTAGACAAGATACAATTTTTAATGG CGTAAATAACAATTTTAGATATAGTATCATTAAATAGGTCAAATTTGTTT TTCATTTGGCTCATAAAAAAATAATAAAATACTAAGAAGACACTGGATAG TATGTCCCACAAATGCGTTATTATAGACAGTTTGTTTAAAAAAACAGATA GTAACTTATCTATTGTAGCCTCTGATGCTGTAAATTGATGGCTTCCCAAT CGGATGAGTATCCCACAGTGCCTGGTCGAGATCAAAGCCTGGCAGATGGG ATGGCGCTTGGCCAGAGGAGTCAGAGTCGGGTCGGAGTCGAAATCGGAGT AGGAGTAGTAGTCTGGATGCCGGCTTTGGCTTTGGTGGATGACTGCAGGC CTGGCCTGGGCCGCCGCTCGTGCAAGTGCCGGAGCACACTGCATATTAAG TTATTGTATATTAGGTGTTAAATCAGATAAATTTTCGCATAATACCGCAT ACAGCACTCGGATTTTCAAAGATTAACGTGGCGCACACACTCACATGCAT GCAGGGAGTCAGTTGTTGTGGCCGCTGGTTGGTGTATGGCGTATTCTGGA TACTGGATACTGGATTGTGTATGGTTTCGGCCTGGCCAGAACCAAACCGA GCTAAACTGGGCTGTGGCTGCAGCATTTCGGAGCTGTTTTAATCATTTGA ATGCTGCACATTGTTTTCAGGCGGGTTAGAGGGGTGCACTGCAGTGCAGT CTCTAAACAGTGTTGCAGTTTATTTGCATCGTGGACGATGGTTGTTTGTG GGCCTGTGCAGTCATTGATAAACTTTTTGCTCCGACTTTCCACATTTTCC CTGGTTGCATGCGAGCGCATCGGCTTTGTTTTCGTAGTTAACAGATTATT AAAGCGCACATAAATTTATGCAAATTATTAATTGCAAAAATCGCTCGCAA AAAATATACTCGAAAATCGAAGCCCATGAAATTGTCTGTTCGGGCTTCAT TAAGGTTGGTTGGTTGTCGATGTTGATGTTGATGTTGTTGCACCCGGCGT TATTTAAAAAAAATAAATCGCAGCGTTATTAAACAAAAGCTATTGTGTTT TATGAAAAGCGCATAAATAAAAAAGGCAAAAGCCAGCTCTAGCTGCACAA TTTATTATGACAAGTTGCCCTGGCACTTTTATCTCTGCACACACAAATTT CTGCAGTCAGCTAGCAGCACATACACACAACATATAACATATAAACGTAT ATATTTTTTGGCATTTATGCTGCTGTTGCTGTTGTTGTTCTTGCCCTCGC TCGTATTATACAAAATATATGCAATATAATGGTCACAAAACAAACCGTGC CCCAAAATGCCGGATGCTTCGGCAGAAAAACTAACTGGAGAACACAAACA CACACTTGTGTGTAGATACCACTATCTGGCAGCAGCAAAAACTTGACCAT GGCCAAGTGGATTTGACAAATAAGTTGGCAAAAATAATTCGCACGCACAG GCGGCCATTTGAGTTTAGTTTTAATTAGTTGAGCGTTCGAGGCTGCGGGC AAAAGCCATTATTTCAATGGTAGAGATGACTGAGAAAAGCACAGCAATTT ATTCGATTTTAAATGTAATGTTCTTTTCAGATCGAGCTTATGTGATAATA AATGGCAAACAGTCTGAATTGAATTTATGGTCCATGCTGATAATCTGTCA GATGTCAAAAGATACCTGCTGGAAAATACTATACGTGCAAGCAACAACAT AATTTGCAAATC