##gff-version 3 ##date Wed Jul 24 05:12:03 CEST 2024 ## exported from the transgeneomics system molecule_59049879 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59049879 mpicbg region 9631 32371 . + . Name=dmel-5.43-3L;type=genome;start=10083359;end=10106099;strand=- molecule_59049879 mpicbg region 32372 33326 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2436;strand=+ molecule_59049879 mpicbg region 33327 33433 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3813;end=3919;strand=+ molecule_59049879 mpicbg region 33434 46423 . + . Name=dmel-5.43-3L;type=genome;start=10070369;end=10083358;strand=- molecule_59049879 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59049879 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59049879 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59049879 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59049879 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59049879 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59049879 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59049879 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59049879 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59049879 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59049879 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59049879 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59049879 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59049879 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59049879 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59049879 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59049879 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59049879 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59049879 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59049879 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59049879 coding_transcript gene 21749 23273 . + . id=51443836;ensembl=FBgn0262008;identifier=FBgn0262008;alias=CG6640;Name=CG42826 molecule_59049879 coding_transcript gene 24550 26883 . + . alias=CG6640;alias=anon-WO0140519.30;alias=GH19118;identifier=FBgn0262007;ensembl=FBgn0262007;Name=CG42825;id=51443506 molecule_59049879 coding_transcript gene 27892 29862 . + . id=50664932;identifier=FBgn0052054;alias=CG6645;alias=BcDNA:GM13904;Name=CG32054;ensembl=FBgn0052054 molecule_59049879 coding_transcript gene 30291 33522 . + . identifier=FBgn0052053;id=50664589;ensembl=FBgn0052053;Name=CG32053;alias=CG6645 molecule_59049879 coding_transcript mrna 30291 33522 . + . parent=50664589;Name=FBtr0076315;id=50664595 molecule_59049879 coding_transcript exon 30291 30508 . + . parent=50664595 molecule_59049879 coding_transcript five_prime_utr 30291 30324 . + . parent=50664595 molecule_59049879 coding_transcript cds 30325 30508 . + . parent=50664595 molecule_59049879 coding_transcript intron 30509 30934 . + . parent=50664595 molecule_59049879 coding_transcript exon 30935 31110 . + . parent=50664595 molecule_59049879 coding_transcript cds 30935 31110 . + . parent=50664595 molecule_59049879 coding_transcript intron 31111 31243 . + . parent=50664595 molecule_59049879 coding_transcript exon 31244 33522 . + . parent=50664595 molecule_59049879 coding_transcript cds 31244 33436 . + . parent=50664595 molecule_59049879 CLC cds 32372 32431 . + . Name=2xTY1 molecule_59049879 CLC cds 32438 33154 . + . Name=SGFP molecule_59049879 CLC cds 33161 33202 . + . Name=V5 molecule_59049879 CLC cds 33203 33226 . + . Name=Precision cut site molecule_59049879 CLC cds 33227 33247 . + . Name=TEV molecule_59049879 CLC cds 33248 33319 . + . Name=BLRP molecule_59049879 CLC misc_recomb 33327 33360 . + . Name=FRT molecule_59049879 coding_transcript three_prime_utr 33437 33522 . + . parent=50664595 molecule_59049879 coding_transcript gene 34292 36945 . + . identifier=FBgn0036066;ensembl=FBgn0036066;id=50833016;Name=CG14160 ##FASTA >molecule_59049879 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACAAATTTAACAAAGTGAAATG AGAGCTATATTCCAAAATTTGTTTAATATTTGCAAAAAAAATAAGTAATA TTGTTGGGCTTTGTTTTTTACATAGCATCTGTAAAATCGATACCCTAGCC ATGTATTGATATGGTCATTACACGCAAAAGTTGGCAACATCTTCACATTG GAGGGTCTGGCTAGAAATTGCATTTGGCTGGGAAACGAAACTCTTAGCAA TCAAATTGGGCAAACATCAAGGCGGGCGAGCCAGAACGCAAGACGTAGTT GTCGTACTTCAAAAACTCAAGTCGTGCATATTTATCAAAACATATTCGAT ATATGGAGAGGAAATGGGAAAAAATTGAACGTGCATGCAAGAGCAAACAC GAAGAAATTGTTGGCACTGAAGTCCCTATACACACACACACATAAATATA AAAAATAAGAGAGAGCCAAGACCAGGACGAAGGATACGCCGTTCGCTCTC CATCTGCAGTTGAAGTTGTTGGCGCTTCAGAAATGTGTAAAATATTTTTG CCATCACAGAATATGGCACGCGGAAAGGGCAACCAACAATATGTATTATG GAAAATAGCAGAGAAGGCGTACCTACCTACCGCTCCTACTACACATTGCG CCATTGATTAATGCTCTCCATGCAGACAACATGGCGTGTGCGTAATGTGG CAATGAGATATAAATCGAAGGCAGCGCATTAATGGCCAACTATTAAACTA ATCGCTTTTGTTGCTCAGCGACTGGCAATTATCCTGCGCTCACTCCCCAT TTCCCCAAATCAAGTCATAAAACAAAACAAGGGGAAAAAGCAAAAAGAAC GAGAAACACCGAAAAGTCCTGCCAAATGTCGATCCTGGCTGAAGGAAAAT GGCAGGGCGAAAGTCCGGGACTAAAGCAATTTTACACCTGTCAGCAAATA AAACGTTGATACACAAATAGAAAAATCCGTCTAAGTAGCAAAATTATTGT TGAAGGCACAATGCGACCTGCAAAAAAAAAAAGGGACAGACGTAAAGAGG ACTCGACAAAATCGCTTTTGCTTTCGTTGTTTAAGACAAATACCGCGCAG CAACAAAAGGCCAACTCATTGTTGTTGCTGTTGATTCACCTTTCTGCCAC GCCCCCACTCACCCCGCATCCCTGGCCGCCTACTTCTAACGCTCGTTTTT TTCAACGCTCCTTTCTGCTAAATAAACATTTATAAAAACAGCCAAAAGTT TTTATTCGCTGATGCTGCTTCTGTTGCCACTTTCTGGACCTTTTTTCCGC CCGTCCCTCGATTTTGGCAGGGAATTTCATTTTGAATTTCAACCAAACAT TTCACGGGACTTTGACGCATGGCAAAGTTTATTTCTATATAAATTTATAC GCTTGCCGAGAACAGGCATATTTGATAAGTGGGTGAGTTGGTCTCAGGCA AATATCAGCATACGAAGTGTACCATATGATTATCGTTATCTCTTGGGGGG TTGGCATATAAAATATATGTGGTGATTTAGCTAGAAGCTTCACGCTCTCT AAGACACTTTGCCTAACAAGTTGTTATGCAGTTGTAATGAAAAGTCTAAA ATCAGTTTAGACTATTTAAAATGTACATTATTAGATCAAGATAAGATTTT AAATAAATTAAAAATATTTTTAACACATTTCTTGTAAGGACATCCCTGCA CCGCCATCATCGCGCATTAAACGTTTATTTCCGGTTTGCTCAGTGTGCTA TTTGAAAATTGTTGCCGGCGCTGAAGTTGTACGAATTGGCGTGGGCTGCC AATTTGATGGGTCCGGAATGGAATGGAATAACTGAACACCAGCCGTATGA TATATAAAGCCATATACTGCCGCAAGTCAAACATCTTGGCGAGAGATCTG TGTCGTCCTGAAAATGATAAGACTATGCAAGCAGTGGCGATGGCAATTGG AATAGCTATGCACCACAAACTATGCCCACACAAGTCAAAAGTCCGTGGAA CAGTAGTTATGGCCAAAGTCGGGTGATGGATGGCAGCTGCATTGTTTGCT CTAAGACTTGGCCGATGACTTGGCACTGATAATGGCTTATGAATGCCAGG CAATTGCGTCATGTAAACGAGCATGGTGAGCGTGGTGGCCAGACGCATGA CGCCCATTTTACCACCGCCCTTCGGCCTTTAACATGTGCCGCCCGTCGTT GTCGGGGGCGAGCCACGCCCACTGTGTGTTGCTGCAACGTTGTCGACTGC AGCAAGCTGCAAGGCGTTGAACAACATGACGCTCTGCGATAGCGATAGCG ATTGCGAACTGCTTGCTCCTGCCTCTGTGCCGCCGCATGCCAGCATGCAC TGCGAGAAAGGGGTGAGAAATTAATAAATTTAATTTTATTACAAATTAAA GTCAGCTATCTCTACTCTTCACTACTTACATATACTTACATATTAAGAAT ATTAAGGTTTAAAAATTGAACTGCAGTTCAATCAAATTGTTTGCTATAAT TGAATATATATAATGAACATAACAAGCTTAACAGTAACTTAATAGTTTTT TGCTGTTTAAATACCGTGTAATTCCAGTGTAGTTGGCATACCGCCTTTGA TGAGCCCAGGCCAACGGCATCAGACGAGCTATCAATGTTGTTGTTTGTGG CCCTGCAAGTGTGTGTCACTGTGTGTGTACTTTGCCAAGTTGATGTCTAA TTTAACGCTATCGTAAAGTTGCCAGCGTTTGCTTTCCCACTCACTCACAT CGTCAACTCACTCACTCTTACAGCCGTTACTTCGATGGCATAAGTTTATA TATATGTTGTAATTCATTAGGGCTCTCAGCTAAAAGTACTAGATCTAAGC TTGTTCTAGATAACCAGTCAGACAATGAGGTCATTACTACGTCTTTAAAT CACCTGTAGGTTAGAATAAATCTAAAATAATTTAAATAAATATCTACGTT TCTAGGCAATTGTTTGAAAAGCTTATGTAGGTCACCGTGTTGATATTGTC AAGCGCAGGGTATCTGTTAGCCGAGCAAACTCCTCTTGTCCGTCGTTCTC GTTCAGTGCTGTCAATGTGTCAGGCAGCCCAAAATCGAGACTCGTTCGGG AAATGGTGAAAAACACATGTAACTGCAAATCGTTATCGTCATCGCCGGTA TTGTTGTTGCCACTGGTTTTTCCCCACTCACACACTCTCGCAATAACACA CACACACACACACAGGCAGAGGCGGGCAGACATTGTTTCGGTAGTTAGCA CATGTGTGTGAGTCCTTGTTGCAGGACGTGTAACGAGGAAGTGTAAGTAA AATGTACATAATAGTTGGCATGACTGTTCTGTTTGCCGCAGTGCCACTGA CATAAGATGCAACGATCATTTGTTTGTGCAAGCCTGAAATGAAACCCATC ACTTGTTGTTTGGTTTATCGAAGCGTCTGGTTCCTTAACATCAAAGTATG CCTTAATCGTAAGCAGAACAAACACGAATATAAATGCCATTTAAGTTATT ACTGAAATGGTGCTTTTCGATGGCGTACAAAAGCATTCGAATTAATTGGC AATGAGATAATTGGCATGCTAATATGAATTTTAGGCTTAAGTGTTGGAAT TGCATAAATAGTTACCAAATTGATGGTTCTATCTATTGTAAATGTGCGCA AAGCTATAAATCATTTAACTTCATGCTGATCTGTAAAGTGTTATTTATTT AACAATATTATCAATGGGACTCTATTCATAAGGGCTCCTAACACGTTTTT CCAAATCGGAAAATTCCCATTACCTATGACCGTTGTGATAAAGACCCTTC AGCTTATATAAACTGCGCGCATTGACCCAAGTTCCAGTCCGAAGTTGGCA AGTCAATCCATCACTCCCTAACATTCCCTTTATCGCACGAAAGTCTCAAA AATTTTGCTCCTATGCCTCGGGCAACATTTGTCATCTGCTCAATAATTGT CAACAGACAAAACAAATTTGCATGTTCAAATCTGAGTGTGAGTGTGTGTG TGCGAACTTTGCCCATGTTTGGACTAATGTCTTGCCAAGTGCCCGAAAAT GTTTTTCCATTTATAAGGAAACAGACTCAATTTAATTTCCCGTTGAGTTG ACAGGAGGCAGCAACAACAGCAACCCATACAAAAAGTTGCAGCCATTTGA ACTATATAAATATACGTAGGCTTAGCACGGAAAAACTGTTAATCCTGCAG ACAAACTGACCCAAGGTCCATTTACAGGACCCAAATTTCCCTTGACCCTT TTTTTTCGGGTTGAGCTGAACGAATCTGCATATTGCCGTGTTAATCCTAC TTGGGAATTTATAAAATAAATTATTTACTTAGGTGGAGTCCAGCAGAAAA ACATCACTGAAAAATAACCCAAACATCAAATGAGAGATGAAAGAAAGGTG CATAGTTTCGAGACCAATGTAAAGTGTCCTAGAGGCTTTAAGTTGAAAGG ACTCCATGAGCCTGCGTAGCCAGTCCAGATCCCGCCGACGTGGCCAAAAT GAATTGCACTTGATTGTGGCAGCACAGGTGGAATTGCCAGTGCAAAGTGC ATCGTTAGCCAGAATTTACGTGGCACGTTAACACACGTCTGCCAAAAGCA AGCCACCTCAGCTAGCATACCCCCAAACCTTAACCCTTAGCCCGCAACCC TTAACCCTTGTCCCGCCACCTGTTCCTCGCACAATTTATGCTTGTGAATT ATGAATGGAAACGGCGTCTTGGCCCTCTTTTTCGCTTTTTTTTGTGGCGA ATTTATTTGATAGTCAGCTGCAGAAAATGCTCCCGCTAGCCGGTGTTTTT TACTTTTATTATTATAAATTCATATGCGTTGTCGATTAATTTTCATTTCC CCCTCATTTCTCAGGGAGGACCCCTGAGTGCCAGTGCCATTACTTATGCT GTTTTTAATTTTCTGGGTTCAATGCACGTGCCACGACCCCGAAACGAATA TTTGGCATAAATACACAAACTACAATGGGAACAGTAATCTAAAAGGGACC CGAAACCGCCCATCCCGAATATTTTTGGGAACCCTTTTGGCCAGATGACG GCAGAAGTCAAAAGGGCTCGGATTATTTACCCCCTTTGAAAAGGGAGTCA GTTTAATGGAATATCCATACGTAGAATGATTTTTAGTTTGGGATCCTTAA GCAGATGAAATAGTATAGCAATAAACTTGAGCCTTATTGGATACCTAATA TTACAAAGATTGTAAGTTCTTTATAGCATTTAATTTGCAGTGCATCATAA ATATTTCTAGTGCTTAACTTTTGAATATATTGCTTCATAGAATATATTCC GCGAGATTAGATAGCCGATGGCCGATTTAATGCAACTCAAGCACGTGCAC TCGACTGCATTAAGCAGTCAACTGTTATCAGGGAACTATGATTCGACGAC ACCCTTGAGTGAATCCCCTTTCCCGGCGGATAATTCAATTCTCGATGGCA TCCCATTTCGGGCATCAATGTAAATGATTATACTCCAGTTATTCTCACTC CTTAGCGCCCCGAGGGCAAACATTCCTCTCGGATTCAAAGCAATTTTCCG TTTGGCTTTCCGCTTTCATTTGAGCAATCAAATAAAAATCCCAATGTAAG CCTTTTTTTTGGCAGACAATCGCAAGAGAGGCGCCTAAATTGGCAAATCC CACTTGAAATACAACAATAACCGTCTCTCCTTCATTTTTTCTAGATTTCA TCTTGTCTGTGTAAATATTGCTACATTTTCTTAGGCGAATTGCCTTCTGT TTTTGGCAAGCGGCTTTTAAATGTTGTCTTTCGCAGAATTTGTGCCCCTT GAGTTATGCGATTGCTCTTCATTAGATTTATCCGAATGTATATGGTCCTT GGAGTAATATCTCACCCAGCTGGATGTATGCATTATCATATTGAGTTCCT TTTACGGCTCGACAGCAAATAAACACGCAACCAGCACCCAGGGACCTCTA CACCGGCTCTTCAAATGAAAAGTCATAAAAAGGCACAAAGGATAATGCGT TTTTAATGGCAATGAGTTTGGCTTTTCAGCCTGACGCGTTTTTCGGCTTT TGACGGGTATAAAATACAAACAAAACAAGCCAAAAGCCGAATAAAAATCC TGAACAAAATGAAACAGAAAAATTTGTTAGGGATATGCAAAAGTCCGCTT TTCTCTTTTCGCTGAGTCCAAAAGTTTACGAGTTTATTTAATTAATTTTT CTTGAGAAAAAATAACCCTGTGTAGGCGTGCATTTTTGCAAGTGGCAGGA GGTTGGGCGCATCCTTTTTTTTCAGAAACCCATGCCTCTCACCATGTGTT GATTAAGCGCATTCACTTGACTTTATTAACACGGAAATAATACTGGCATA AGCTGCGGCCGGCGTCTGGCAGGATGTGCCAGGATGTGCCAGGATGTGCG GGAACAGGTCCTGAAACCACTAAGCGGTACACTGGCACGCATTCACCTTC ACTCATTCATCCAGGCTGCACTCAAATATTAAATGTTTTTAATACATTTT ACAGGAGACCAAAAAAAATATAGAAATATTAATACAAAATGATTATTAAT ATAATAATATAAAATAATATAATAATTCTAGCAATGTGATATCTTTTTCT TCTTAATATAGGGAGTTCATTTATTTTAATTACACCCATTTTTCTATAGT TAAAATTTTTGAAATTATTTTTTTAATTATATATGTATTTTATTGTTATT TTTTATAAGTGAACAAAGCCGTTAGCAGAATCTTGTAATTGTTGTATAAT TATTCAAAATTACGCTGAAAAGTTGGCGTGACTCACTCACATGGCAAAAC AATGCGAGTGAAAGGAGCTGCCGCTGCCCGACAGGCAATGAGTACGATGT ACGTTGGCAACCCGGGCACGTGACTACTCATAAGCCATTAGCCACCGGCA GAGATGACCCGCGACAGACAGCCGCTCCTTCTGGCATTTAGTGCGCCCGT GTCCTGGACGACCCGTCTTCCGTAGCTCAACGCAACTGGCCGATGTCCTG GCCAGTTCGGATTGTCGCTGGTAATTGTTGACTAATTGAGCCGGCCAACG GAATCGAAGACCCGGCGCCGTGTCAGTGATTTAGAGCCCGCTTAGCAGTT CGGACATGTGTCGACTCTGTGGCTGCTAATGAGCTGCAAATCGTGGCCTT GCGTACGTGCACGAGTCCTTTTTGGACGCACATCTCTGCACAGGATGAAG GATGCGTAGGCGTGTCTGAAATGTCATGCACAGCGGACTGATTAACCCAT TCATTTACTCAGCAAAGTTAAGGAGAACTTCTAAAGTTTTAAGAAATTAT CTTGTTACTACAAGATACCATATTTACCATTCTGTAGCTAAATTGTTTGT GGGCAGCTGTAGGTATATTGTTTGAAAGTTGAGAAAACCATAACAATTAA GTGCACCAACTATACAGAAAATTCACATTTATTCAATTTTAATAAAGAAA GTAAAACCCACAGAGCGTGGAAAACTTCAACTTATTAAATATTTATAAAG TAATTAATTTCATAAGTAGGTACAAATATTTTGTCTTGATATAACTTCTC GTTCCACCAGTCAAGACTTATTAAAACTGTAATTCTATAATTTAACCACT TAGAAAGCACTTAAGTTTATCAGCGCATTCCTTCAATTTAAATCGCCAAC TATTAGGGACATTTTTATTGGTTTTTCCAGGGAAAAGCATGGAAAAAACG CCATTTAAACTGAACCCGTATTTAAGTGTGCCAATGGCAATTTCGATGGG TTCTAATTTCAGTTTTAGTTGCTGTCTAGTCCGACATCGAACAAAAACGA AAAAGCCCGCAACTGTTGACCAACGACTGTTTTGGTGGCTTTTGACCGCT TTCACTTTTCGCCGCTCGCTTTTCCACTTTCCGCATTCCACTTTTGATTC GGAAGGGCAGCAGTCGGGATTGTTATGCAAATGGAACGCACTGAAAGAAA ATCAATTAACTAAAGCAAACAAGGGGCGTGGCCGAACACAATGGCCCCCT GCTTCCTACTCTCCGCTGTCCTGCCATCCTGCTGTCAAACGATGTTTTCG GGTGTGGGTCTGAAAATTAATTAAACCTCATTTGATGCAATCTTTCAGCG GGCCTAATTCAGGGGTCCATTGCCAAAATTCGAATTCGAAGCAGCAGCTA GGGCAGCAGCAGCAATTAGGCCCAAAATCCACACGCGTATGGAATTCCTG TCGAAGGATATTCACAGGGAATGGTGATGTTACGTTATGTGTTTGAGTGT GTGCGTGTGTGGGTTAGTGTGTGTATGTGGCGTTATGTATATGGCATGAC TGTCATTTGCTTTATGCACACGCCGAGGAAATATTCATGATTGCAGTTAA CAAGGACAATTATGATTGATTTATGGCCCCTGCCACTGCTGTGGGCCATG GCCATTAGTGTGGGCCAGCTTTATGGCAGGTGTGATAAAAGTTATTATCC CAGGATACTACGCCAACTTCGAGTTTGAGTGGCTCGTTAAAAGTGAAAGC CATCGCGACAACTAAGATACGCCGCTAAATTAACATTGTAAATGTCTTGT ATTCCAGCGAAAACACAAAATTTAATTAGATTAGCCATATGAGCGCGTAA AATGGTGTCTCAGCTATCAAAAGAGGCTACCAAACTCATTTACATTTTGT ACATATCTCGCGTTAAGTTTATCAACCTTTATGGCCCAAAGCTTTTGTTA TTGTTATTATTTGAGTTTGTTTAAATGAATCAAGTTCAGGACTTAACCAA AGATCATTGACCTCGAATTGTGCAGCATACTCGCCGCATAAATATTCATT CACTATTCACTCTCTCATTCGAGGGCTGTGAATAATTAAAATCCAAATTG TTTTCAATTATTTTGCGAAAACTATAACGTTCCATTCGGTCGGTTGTGCA ATGCAGCAAATGAAATGCCCCATGGCAGGGGACAAATAAAATATACGATT GCCATCAGGACAGGTGCAACAAAAAGAAGCACTTTGCAAAAAAAAAAAAT TACCAAAATTGTTTGGCACTCTCTGCAAACATAATGCAATTTTAATAGCA AACAATGTTTCGTTTAAGTTCGTACTTACATACAGGTATATTGAGGGATT TTCATTTATATACGAGTATATATAAAATCGAGCAGGACTCATAATTTGCG GCTGGCGAATCCTTTTTGGGCCCGGAAACCATGTCGTTGGCCGCAATCGA TGTCGTTTATCTTCTGATTTGTTGCCAAACGAAGCAAAACAAATCACTTG CTTGAACGGACCGATCCAACAACTAAATTTCAGAGGTCCTGCCGCAAGAA ACTGCAGCTTTCCAAGGCATTTTTCCGCTACTCCGGCTACATTTTTCGGT CTTCCCAGCTCCAGCTGCTGTTGCGAATGAATTGTAGCCATTTTTCAGGC ATCTTTGCCAGACTCGTGACGTCGGACTCGTCGACGTTCCGCTGGAAGGG ACAAAGGCAGAAAAAAAAGCTGGGAATTTGTGACGCCTCCGCCTCGTGTT AACAATGAAAGTGTGCCACGCCCCCGACCCAAACAAAAGGTACAAATGTC GCTGAAATTTATTAGCTTGCATTAAGCGACACAAGGACTCGTCGGGATAT ATACACCATATATTAATATAAGAGCTGTGTGTGCCGCAGCAATTGTTTTG TCTTTCTGGCTTTGGGTAAAGTGCACATTTGTTGTCTTCTTTATTTCGGG CCAGAAGTTAATCAGGATTTGTGACTCATCCTCGCACGCACCGATAAATT AATTTGTGCCCCGGTTTCCTTGACATTTTATTGAAATTTGCATAAACATA ATTTCCGAGAGGCCGTCAGTAAATCTCCAGAAAAAACAAAGCACTACAAG TTGGGTAAACATGCAGTAAGAAAAACTCTATTATTTCACTACATTAACTG GGGATTTATTGCTTATGGCAGGCTGAGGGCCCGAAGGCTATGCGATTCAA TGGACACGAACATCGAACATCGATGGGCCAAAGTCAAAGTTTCTGGGGAA ATATTTACTGAAAAGTTGGCTAAACTTGAAGGAACCCCTTAAGCCAGCAG GTGAGGCCTTGTCCTTGGCAACACTTTTCCTTGCGCGTCCTCAACTTTCC CCTAATTGAATGGGGCTTTGTCTTGGGCCGGCTCATGTGTGTATCCTCTG CAGTCACCGCATCATAAGGCTGTCATAATATGCATTTTAAATTACGTGTG CACACGCGGCGTATGCGCAATATGACGAACAACAGCCGCCGCAAATTTCC TTGCCACACAACCAGTCTGTTTTCTCTCTCATTTTAAAAATTTCGTAGAA GCAGAGAGAATTTACTGCACGATGCGAGCCCACTTGGCTTTTGTTTCTAG CCAAGTTTATGTTATACAATTTTCGTTTCCATTTCCTCTTTTGGCACGGA GCTCGTAAATCTTTGAAAAGGCGGGCGGGAAAAAATGGAAAATTGCCCAT TTTGTGTTGGGCCATAAAATGGCAACAGATCAATATAACATTTATTTATA TTTTCGCCCAAGTGGTCATAAAAGTGTTGCCCCATTCGAATGATCGACGG ATGGGCTTGCTCTAATTAAAATGTGGGTGAAAAATCCAGTCGATGGTAAC GAGACTTCCAAGTATGCCTCGTGAATTTATCGCCTGCAGGCAGCCGGATG TGTCACTTGGCAGTTCCTACGAACTCCAAGGAAACTCCAAAGGATCTCAC AGGCCTCTCTGCCCCCTTGCCAGTCGGTATTTATGTAGCGATAAAATTAA ATTTATTTTAACGCCAGCCAAAGGTGTGCGCACATAGTCAAACACTATCG CCAACTTGCTAGCAAGTTCGGTTCGAAAACTATCCCTTCTTGTCCAGGAA ATCGCTGGAATGGCAGGCACAAATGCCGGGAAAAGCGTCTGCGATAAAAG TTTCTGCGCCATTTTCCACCTTTCTTTATGTAGATGTGGCCGTTTGTGTT TGTGTGCGCCTGAGTGCCTGAGTATTTGTTGCCGGCTTTTTTTTTTTTTT TTGGGTATACGCACGAGTCCGGTGCTCCGGCAGTCGCAAACAGTAATGCA GCCCATAAACCAGGCGGCAAATGCAATGATATTGCCAATGGTCGTGGCCG TGTTTAATCTGCCAGCCGGAGTTAATATGCCTGCCGCAATGCAGTGGCAG ACATACTGCAAATTGGAGACTGGTACTGGGTTTTCCCCATTTTCTTGCCA GTCGGCAGAAATTTTCGCTTAGCCACGAAACTGTTGCCGAAAATTGATGC AAATGTCGCCAGAACATTGTGATATAAGCTGGTAATATTCACTGGGGCAG CTAGGAATTTAAAGTTGAATGTTATCCAATTGAAAACTTAAATAGTAATT AGTAAGTTCAATACGTAAGAATTATAAATCATTACATATATCAATAATAT TTTTGAGCCATAATGTTCAGATAAAAAAGGCAAGATAAGCACGTCAATTG AAATTCGGCAATCAATTAACAAATAAGCGTATTGTCAAATTATTATTTTA TACCTAAGTGTACTTCACAGAATAATTAGAAAACATACTTGCATAAACAA GAGTTATTTTTTATAAAAGAAATAAACAGTTAATTAAATTTAAATAAATA ATTCAAAATTGAGCTTGTTCCCGCAATCTGAAATTACTGCTCATGTGGCT TCTGTGTACAAGTAGATTGATTAGCTCTGCCCAAAAGAAATTATTTACGT AACGTTTCGTAAGCTCAGCTTTTTCGTAATGAAACCCACAAAGTTTCCTT CATCTCTGCCATAACACCCAATTAAATTCAGCAGTATGCCATTATTCTGC AAAGTGACATATCCATATCGCATCTAGCCCCAGACATGTGTGTAAACTAA CCCCCAATTATTTACTACTATAAGCAAAATTTGATTAGCTATCGCTTACA CTCTCCGTCGATGATTTATTTCAGCCGAAATTTTGTTAATTAAAACTCTT CACCTCACTGCGTGGAGAAGCATATTGATTTTTGCTGTTTGGATTGATGG GGTGGTGCTACTGTCGATGACTTTATGGTCACGGCCATAACCACAGTTAT GTTTATGGATGTGCGGTGAGATAAGCTGATAAACGATCCCATCTCGAACC CTTATAAATAGAAGTGGATAGTTTCGACACCGCGTAAATGAATCGGAAAT GTCACCCAAGAAGTGTGAGCCGCCGCCCGAGGATTCGCTTGCGACCACCG AAAAGGCCACCTTTCTTCGTTTGGGCCACAAGAACCACTCCCAATGGACC GCGCTCGGATCAGCATCCTTCATCCTAATCTCTGGAGGAATGAGTTTGGC ATGGGGAGCCGGATTCGCCGTTCACTCCGCCCATCGGGATCAACTTCTGC GGACCGTGCACATGCAAATCGCCTGGTATGCAACTGCAGTGCTTGGAGCC CTTTTTGGAGCATTTTATACTCACCGACTGCCACAGCAGCCCATTTATGT GAGTATACCGGGGAAAAATATTTAAAGGGAACTTCTTAAGAAACTTTTGT TTATACATTAAGCTGATAAGCTAGTTAATATGAACACGCTTGCCATTGCA GATTTTTAGCTCCATCTTGGTTATTGCATCCGGAATACTGTTCCTGGCTT GGCCAGAGTGTCCAGGTGCCATTATAGCCGCCCGGTATCTAGATGGATTG GCCAATGGTCTGGTATTTGTTCCCGCCCTAAGTACTGTGGGTGAGATTTC TGTTAACGAGATCCGTGGACTTTTGGCCTCCACGGTGGAGCAGCTCAGCT TCAACACCGGCATCCTGTTGCAGCTAATCTACACGGCCGTGTGGCAAGTG GACTGGAACGTGGCCATTGTGGCGGATCAGGTGCATGGAGTGCTATCCAT AGTCTACGGAGTTATAGCCCTGGCTTTGGCCCTAACCCTCTGTGTGGAGT CACCTGTCCACCTGTTGATGCGATCCAGTGAACAGAGGGCGTTGGTTGCC CTGAGACACCTTCAAAGGCCATATATGGTGACCAGTGAAATGCTACTGAG ATTGGATGAACACAAACAGTATGTGGCCGACAACAGGGAAATGTGTTTAG GATCGAGTCTGCAGAAAGGGTATCCATCGGTTCTTAAGCTTTTGGCCCTT CGATTGTTGGGAGTCCTGTCCCTGAACTCCATCATATGCAGTGCTCTCTA TGAAACCGGTAATCAGTTGGTCAGCTGCTTGTATGCATGGCCTTTTGTGG TTTTCGGGCTGCTCCGGTGGGGCGGATGCTTTTTTGCGGTGCTTTTGATG GACACCACAGGCCGTAAGAAACCGACCCTTTTCGGAATCTTTTCCACCGG AGCCTTTGCCATCGCATATGCCAACTTATTTGGCCGAACTCCTCATATGA TCACCGCCCTGGTGATGCTTTTCAGTCTCCAATTCTTCGAGGGACTGGGA CAATGTGCATCGGCGGTTTACCTCACTGAAGGCTTTCCTCTACTAATGAA ACCACATATGGTGGCTGTGGTATACATAATGGAACAAGCCGCACGACTGC TCCTCTGTAGCTTTTTACCATCGATCGCAGAAATAACAGCATACTTTCAC TCCATGGGAGCACTTTCCATGGTGTGTTTTCTTCTCGGAATCTTCTGCCT GCCCGAAACTAGACTAGTTACTTTGGCAGAAGCACAGCTCAAGTTTTCAA AGTGGTTCAACAAGGATTTTTAGGTATAAGTGGGTAGGGGGAAAATAAAT GTTTATATGTAACAACAATTAAGAATGTATTTTGTTAAAGCGCATTAAAG TAGTAGTAGTTTATTTGTAATTTTTGATACGATATTTTTAATCAGGTGCG ATAATGCCCAATTACATAAACTATTTGCACAGCCGCTGAGTGTTGATTGG TTGAGTGGTTTAGTATTGATCACAAACAAATGAGGATATATGTAGAAGTA CAATATCCATGAGTCGAATGGACCCAAAAAAAATCTGACAGAATCTATGA CCACAGTTTCAGGAAGTAAAACAAATTGAGGCCAAGCACCTGGGAATCAG GTTGGTGATTCCCGAAACAATAATCTTATCTAGACTGGTCGAAACGTGGT AATTCAGGCTAAACATTCTGGCTTATTTCTGAATTCTGAATTTGGAATAT CTTCATGATATGCTTCAATACTACTGGCAGACGAAGCCGCAATAATTTTC TAAAAACAAAAAAAAAGTGACCTTGACCTTGAGCCAGAAAAAACAATACA GGTGTGCCTTTCTGGTGATTCAATAAAAGATATAATGATAAAGAAAACAA ATCACGCTGATAATATACCTTATAATGACTTATTTTTTCTTAATTACTTC CTTTTTAGTATTGCCAACAAATAAAACCAAAAATAAATTCCCAGAAACAA TCAATATCAGCAAATACATATTTATATGATATTATACGACAAATGTATGG CATTAAGTACTCAACAAAAGTGGGAAATAAAGGATATAAAAAAATTATAC CTTATCTTTTCTTTATTTTTTCCGTTTTATCTTTTTATTAATTAAAAATT AATCCATGAACTTTAAATAGAAAATATTCTCTTAAAATTCTTATCTGAGC AATTAAACCACTTTTTAATAACTATATGGCGAGTATAAAAAGTATGAATC AGGCCTAATAACTATGATCAGTCATACCAACAGAAAAAGCAGGGGAAGAC CCGTTCTCCGGTTCTTTAATTACGTCGAATGAATCAAAAGGGCTGTGATC TGTAGAGAGTTTTATATACCACATATGTACATCATAAAGTATTATTCACA AACATTGCGATAATCGTCCTTATCGGGCACGCGTATATTAAGTTTTGAAG CATTTACTGAAATAGATGCCGCCCCCTAGTGATAAGGGATTGAATCCGCA CTTGATTATCAGTTGGGCAAGGCTCGATAGCAGTGCACATAAATATCATT TGGCCAGCCCCCGTATTAGCCAGTTTCAAATCGACCTCTACCGGAGCAGT TTGTCTTCGCAATAGAGTGAAATAGATATAAAGCGATCGGAAATTCAGAA CGATAAGTTTGCCCCACCGCCGTTGGCCATGCAAAACGACAAGTATCCAG CGCCAATAGGCTTTTATCCACCACAAGGACAGCCGGGATATCCACAACCA GCGTCACAGCCAGGATACCCTCAGCCAGGGCAGCCGCAACACATCACACC GGCGGAGACATACGGACCACAACCACCGCCAATGCCACCGCGGGATCCAC ACACCAGAGTGGATCCACCAGGAGGATGCTTTCAGCGCAACCAAAAGAAC AAACCTCAATCCAATGCTGTGGGCGCAGGTGAGTTCAGTTCATTAGATCG ATCAGCTTAGTCACCTACTGATGAGTAGTTGTTCACCACGAGGTTAATCT AATCTCGAGTGTTGGAAGTATGAATCTTTTTCTAGAGCCCAAGTAGATTA TGATGACGATGACGTAAGTGCTAGTAGCCAAGCATTCGAATTTAATTATT TTAGTACTACGATAATCGAACGGCTTATACCAGTGACTTATGTTTCCATT AAAACCATTTGTGAAGATGTTGTACAACCCTAATCGATTGAAAATACTTA GGTATATTTTTACAACTAAATAGATTCGTTAAAAATTTAATAAAAATTAG TTTCGTAGTTGTAGTTTATAAAAAAAAGTTTCGACCCGAAAAATATGTAC TTTCTAGTTCAAGATCAGAACCTGTCCGTATAAACGTCGTGATCTCAGGA AGATTGTAAAGACGCCTACTTATTTTGGCCAAAACGGCAACGTGGTTATG AATATTTAACTGAAAAGATTAAAATTTGACACCAATCCTTCGACAGACTT AAATCTATATATTTGATACTCTTTCAGCTGGTCTCATCTTTATCTCTGGA GGTATGAACATAGCGTGGGCGATTGGCTTCCAAGGACCAATCTATTACCA AACCACCAAGCACAATTACATTGCCTGGTTCATAGGCGCCATTATTGGAG CTTTGGTTACGATGGCGCTGACCAACAAGGTGGCCAAAAAATATATTCTG GTAAGCGGAGGAAGCCTGTTGGCACTTTAAGTTTTTATTAATCAATTCCT TTTACGCACAGCAATTTTCTTCAGTGTTGGTGACCGTCGGTGGATTGGTT ATTGCCTGCACCCACAATAATGGAGCTGGAACCACGGCAGCTTGTTACCT AGATGGTATTGCCAATGGTCTGGTATTTGCCCCATTTATGGCGTTGGTCG GAGAGATCTCGGTTCCCTATTTGAGGGGCAAGGCCAGTGCCACCTTGGAG CAATTGTGCTTTGGAACCGGTATACTTCTTCAGATCCTTTATGTGTCAAA TTGGACATATTCTTCGTATATGACATACAATGATTTTACGTCCGAGAATA TGAAAGGAGTGCTGAGCACAATCTACGGCGTTTTGGCCCTTATTATGGGC TCATTTTTTACCATCGAATCGCCGGTTCTAATGCTGGCCAATAACGAAGA ACAGGCGGCCATTGACGCACTGCGTCGGCTACAAAAGCCTGCGGTGCTAA CCGAGGAAACTTACGAGCTTCTGGCGGAGCACAAACGCTACTTGGCCTAC AACAAGAATATGTCAAAGAGTGAAAGCATTTCCAAAGCGCTGCCCACCTT CATGCGACTTGCATACCTGCGCGCCCTGAATGCTATGAGCATCTCCAGCT TTGTGATCATCACTTATGTCGTTGCGATCTTAGTCTCCAATGATTTAAGA AATGCGAGCTCCTGGTACATAGGATTAGCCTTTTGCCGTTGGTTGGGATC CCTAATCCCATCCTTTTGCATGGAGTCCTTGGGCCGAAAGAAGCCTGCGG TCTTTGGCCTGCTCGTAAGCTGCGGCTTGTCGTTTGCCGTGGGTTCACAG TACAATGTATATACGTATATGAGCCAAGTGACCGTCTTGATAATGATTTT CGAGTTCTTTGCCGGTATGGCCTTCTCATCCAACTCGGCCTACCTGACGG AGGCATATCCCATGGGAGTTAAGCAACACTTTATCGGTTTAACTTTCATC ACCGAAATATTTGTCTTCCTCATCATAAATGTTTGTGACTTCAATTTTGG ACAAGGCTACAACTACTTCTACATCATGGGAGCCATGTACCTGGCGGGAG TGATTCTCGGAGTCCTTACACTGCCGGAGACAAGGAGGATGACCTTGCAA GGTGCCCAGGAGCAGTTCAATAAATTCGTTAACTTCCGCTTTTAATGTTC AAAGGAATTATAGATTAATAAATCTACTATTAAAGTGCAAGAGGTCTAAG GCCTCTGTATTCCTCCACATAACGATACTCACTGTTTTTTAATCATTCAT AATATAAAATTATTAAGTATAAATTATTCGGCGCCCAACTTGTTTTTTCG CTTTTATATTTTTCAACCTAAGTTATAATGCTTTACAACAGCCATATAAA TAGTTATTATCTTAATACTACCGTATGATAAGGTGATGAGACATTCAAAA CATATTTTTGTGGAAGCGTAATAAATTTCAAGCATATTAACATTGGTAAT AAAATAGAATCACAATTGGGAAGCACCTTAGAAACGTATGTTTACCTGAT TAAACTGTTATAAAAACAAACCAAATCCGTTCAATGCTTCTTTTAGTGGC AATAAAACCAACGAATATGCTTTGATACGACGCTCTGCTAATATCGCCAT TTGCAGCTTATCAATAACGTATTGATTTGGTATTGACTATATGGCTTTCT ATTTGAAGGGAATTTCCAACGAACTGTTATTTGCTCCTATATGACAAACA ATCATTACATTAAATATCATTACAATATTTTGAAAGCAAATAATTTTTTA CTCCTGTTAAAGTTCAAACAATCCCAATTTTTTTAAATCTTATCTTCATA TAACTTTATTTATAACTATTTAATTGGCGTTCAAATGGTTTTCCCGCCTT TTAAAATTACTATCTTACTACCGTCTAAAGTGAGAATGAAATAATTACCA CCCTTTTCTCGAGGAAAGTGCCCTTTACCATCATTGCAATTAGTTGCATC GATGAAATATACATGAAATCCCCCGAAAACTGTTAAGCCCGTAGTAATGT ATGATTAAACTGATTAAAAATGAGCTAAGTCCGTGGGAGGCACCTTTTAG TGGTCAATAAAATGCACGACCACGCTTTGATAAGAACCCCCGCTATTATC GCTGGCCATTTGCAGCTTATCAATAGAGAAGTGATAAGCTGTGTAGCACT CAATTATATTTTTGGTCCCATGGCAAATAGGTAATTCTACAGTTACAGAC ATTCCGTCAACCAGTTCGAAATTGACCATTTACTAGGACGGTCGAGCCAC GAACGAAAAAATGGGAAACGACAATTTTTCACAACAGAATCCTCCGCCGA TGGGTTTCGCAACTGCACCACCACAGCAGGGATATCCACGGCAAGGATAT CCACATACCGAATTTCCCCAGCCAGGGTTTCCACAACCAGGACACCACCA ATCGGGATATCCTCAGCCGGGACATTCGTGGAACCCTCCGCCACCACAGT TTGGATTTTCAGGGTACCCACCGCCACCTCAACAAGGATATCCCCCACAG TTTTACGGTCCACCACCAGGATACGGATTACCACAAGCAACACTACCTCC TAATCCGCCCCAGCAAACCATCACGGTAAATAACAGCTGGTACAGTCGTA ATCAGAAGAACAAGCCACAATCGAATGCTGTTGGAGCAGGTGAGTCAAAG AAAAAAGATTTTTAAGTTTTGACATTTTAAAGTAATATTATATATATATG CATTGTAACTACCAAATTAAATATAGTACAATTTTACACTTAGCGAACTA ACCACTGTTTAATCTCCAGCGGGTCTCATTTTCGTCTCTGGCGGTATGAA TATTGCGTGGAGCATTGGATTCAGAGGAGTACTCCACTATAAAACCACTG AGCATAATTTTGCAGCCTGGTTCATTGGTGGCATTATCGGAGCTGTGATC AGCTGGTTTCTCATAAACAATGTGGCCAAGAAGTATGTCTTGGTAAGTAA CATAATAAAATATAAAATACTTCAACAATTACTTCATTAACTAGACCATT GCAAACAGATCTTCAGTTCGTTTCTGGTGATGATTGGCGGAATACTGACT ACCAGTACAAAGAATAGTGGCGATGCCACGTTGGCGGCTTCCTATCTGGA TGGAATCGCCAATGGACTGGTGTTTGCTCCATTCATGGCCTTGGCCGGAG AGGTCTCAGTGTCTTATATGAGAGGAATGGTCTCAGCCAGCATCGAACAG ATGTGCTTTGGATTGGGAATCTTTCTGCAGATCATATACACCTCCACGTG GAACTCAACGGCTTACCCTTCGTATAACTCCTTCTCGGCGGAGAATATGA AAGGAGTGCTGAGTATTATATATGGATTTTTGGCCCTGATTATAGGCTCT CTACTGTGCATCGAGTCTCCGGTAATCATGCTGGCCAAGAACAATGACGA ACAGGGAGCTATTGACGCACTGAGACGACTCCAGAGGCCGTATACCTTGA CCAACGAAACCTTCGAGCAGCTGGCGGAGCACAAGAAGTATTTGGCCCAG AACAAGGAACTTTCCATGGGTCAGAGCATCGGACAGGCGCTGCCCACCTT CATCCGACTCGTTTTCCTTCGCGGTCTCAATGCCATGAGCATTTCCAAAT TTGTAATGATCGGCTTTGTTTATTCATTTGCCAGTCCGTATGGATATGTA TCGCCTTCGGTGGGTTGGTTCATTGGATTCGGCGTTTGCCGCTGGATGGG AAACTTTATAGCCACGTTCTGCATGGAATCCTGTGGTCGCAAGAAGCCCA CACTTCTAGGACTCATCGTTTGCAGTGTCATGTCCTTTGTGGTGGCAGGC CAGTTCAATATCTTTACTTATAATACCGGCAACAACATAATGTTGTTGGT CTTTGAACTGTTTGCCGGTATCGCCTTTACAGCCACATCGCCTTACCTTT CGGAGGCCTTCCCGCTGGAAGTTAAGCAGCATTTTATATCCTTTACTTTC ATTGGAGAGATGCTGGTATTCTTGGTGTTGACTTTGATCAGATGGAGCTC TTCTGGCGGAGCCAACTACTTCTATGTCATGGGAGGACTCTATCTCTTTG GCTTCTTCTTTGGCCTCGTTTGCCTGCCGGAAACCAGAAGGACCACTTTA AGGGAGGCCCAGGATAAGTTCAGTAAATTCATCAGCATGGGTTTCTAGTT GGTGAAATACTTCTTTTACCGCTTTAGTCATTCCAAAGATAATAAATATT TATCGCTAAGCGAGCACTCCAGGCGTTGTACTTCCCAATCGTAATTTTCT TCAGCTATTGATATCATTTTCGAACTGTCAACAAAACAATTCTCATTGAT ATGTTGGACAATGGAAAACCGAATTGCTTCTTTCTCGTAAACTAATGAAA GAGGGTTTGGCCAACTAAAAGAGATTGAGAGTTGAAAAGCGAGAGACCGA AGGTAATGGTTGGCAATCGTAGTTTTACCTGCCAATGTGAGCAAACACAC AAATCCCACAGAACACATGCTCGTTTCACAGGCATTTGTATGCTAAGAAG CTATCTAAAAGATAGGGAAACCCAAAAAATCAAACCACCCACTTATCAAT CAATACCCGATAAGATTAGTTGACCGCCGATAGATAAACCAGGGACCTAT TCAACACGCTCACCTACAAGAACCGAAAAACACGGCGTGTAGTCATCACC GTGAGTTCGACCACAAAAGGTCCGATGCAGACCGAACGGCCATCTCCAGA CGATGGATTCCATGTCGTACCCATCCATAGTGATGCGGAACAGCACATCC ACAGGAACTCCGATCGCCAGCGGGAGCTGATCCTGCAAAACTCACAGACA AGTCCATGCTGCAATCGGGATCTCCGCAATCAGCCGCAGGCTAATGCAGT TGGAGCTGGTAAGAGAAATGCCACTTCCTGAGTATTCATAGTACTTCCCA GTAAAATGCAATTACATGTACAATAATACTCTTCAATGTTGATAAATTGT TTTTTGGCAGTAATAAATCATAATATATCTATGAATTTGCCTATCTTCCT ATTCTTGTGGTAAATACACGTCCCATCATTTTGGATAGGGTGAAGTCCAA GTCAGAAATGATTCATTCTTCAGTGTCAGCAAAAAAATACAAAATACAAC AATTCAAAATAATAGATAATAGAATTATGTGTACTCCATGACCCCAAATA TAACACTGAAGTTCAAAATATCATCCAAGCTGTCAAGAAACCTCTTATCT TTAGTAAAAATGTTTAGAAATCTTAACTATATAGGTTCTGCATTTCAAAT GTGTAATATATGTTAATAATTAGTTTTTTTACAGCTGCCCTTATATTCCT GACCGGTGGAGTTCACATAGCATGGAGCATTGGTTTTGACAGTTCGCTTT CCGAACTTGAAGTTACTAACCATGTTCAAATTTGCTGGTTTATTGGGGCC ATTATTGGGGCCCTGCTCGGTGGATTTTTTAGCAGATGGTTTCCCTACAA AACATTAATGGTAAGAAAGAAGGTCTTGTTTTTCAATATATCGGCTTTTG TGCCGATAAAAATATATAATACATATATTTGCTTCAATATATCTAGATGA CTAGATGCACTGCTGTAAATGAAATTATTGTTTATCCCTTCAGGAGTTCT GTTCGCTGATCACTATCACAGGTGGAATAGTGATGGCGGTGAACCGAATG GACTTGGACGCCCTGCTGGCAGGGAGATATATGAATGGATTGGCCAACGG ACTGGCCATCGCACCCACTTTGGCCATGGCAGGTGAACTGTCGGTGTTCT ACAAGAGGGGAACCACCACGTCTGCGGCTGAGCAGTGGCCTACAACGATT GGCATCTTTGTGCAGATCGTGTGCAGTCATAGTTGGGATGTTCAGAGTGA TTTTACGGAGGAGCAATTCCAGGGAGTGCTCAGTGGAGTCCTGGGCTCCA TAGCCCTGCTGCTCGCCTTCCTGCTATCCATCGAATCCCCGGTGGACCTG CTGGAGCAGGGCAATGAACAGGGTGCCGTTCAAGCTTTGAGCAGGCTTCA AAGACCACGAGCTGTGACTGCTGAGACCTACGACCAAGTGAGGGATCATC GCACCTATGTCGAACATCACAGATCAATGGGTTGGCGCCACGCCCTCCCC GCCCTCGTGCGCCTGTCGGTGCTAAGGGCTTTATACGCTCTCAGCTTGAG CGTGATGGTGGCCTTCACATTGGCATGGACGAGCACGGAGGTGTACGGCG ATAGTTCTGGTCCATATGTGCTATTTGGTTTCCTGCGACTGATGGGCAGC TTCACGACCTCCTTTGCCCTGGACTCCTTGGGCAGGAAGATTCCGCTGCT TCTGGGACTGGTCATTTCGGGATGCCTGGCCTGTGGACTAGCCAGCAGAT TCGCGGGAAGCCATCCACTAACATTCTCGGGCAATCGGATGGCCCTGTGG CTGCTGCTCATCTACCAATTATTTGCCGGCATAGCCTTCGCTCCCAGCTC ATCCTATCTCTCGGAGGCTTTCCCACGTCGCATCAAAAGGCCTTGCATTG CAATCACCTATATTCTGGAGATAATTGTCCAGCTGCTCCTCCGCCAAATG GATTTCGCAGCAATTGGCAGTGATAGCAGTTATGTGGCACTGTACTTCTT TATCCTGGGAGGCTTACTATTAGCAGGATTTCTCTTCAGTGTTTGGTACA TGCCCGAAACGAAGGATACCACTCTCCTACAAGCGCAATTTAAGTTCCAG GAATTCGTAATTCCACCAGCCGAAGTGCATACCAATCAGGACCCGCTGGA CGAGGTTCACACAAACCAAGATCCACTTGATGAATTCATGGTGTCCAAGG GCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGTGGAGCTGGATGGC GACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGGGCGAGGGCGACGC CACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCTGC CCGTGCCCTGGCCCACCCTGGTGACCACCCTGACCTACGGCGTGCAGTGC TTCAGCCGCTACCCCGATCACATGAAGCAGCACGATTTCTTCAAGAGCGC CATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGCTTCAAGGATGACG GCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGATACCCTGGTG AACCGCATCGAGCTGAAGGGCATCGATTTCAAGGAGGATGGCAACATCCT GGGCCACAAGCTGGAGTACAACTTCAACAGCCACAACGTGTACATCACCG CCGATAAGCAGAAGAACGGCATCAAGGCCAACTTCAAGATCCGCCACAAT GTGGAGGATGGCTCCGTGCAGCTGGCCGATCACTACCAGCAGAACACCCC CATCGGCGACGGCCCAGTGCTGCTGCCCGATAACCACTACCTGAGCACCC AGAGCGTGCTGTCCAAGGACCCCAACGAGAAGCGCGATCACATGGTGCTG CTGGAGTTCGTGACCGCCGCCGGCATCACCCTGGGCATGGATGAGCTGTA CAAGCTCGAGGGCAAGCCCATCCCCAACCCCCTGCTGGGCCTGGATAGCA CCCTGGAGGTGCTGTTCCAGGGCCCCGAGAACCTGTACTTCCAGGGCATG GCCAGCAGCCTGCGCCAGATCCTGGATAGCCAGAAGATGGAGTGGCGCAG CAACGCCGGCGGCAGCGGATCCTCGGGAAGTTCCTATTCTCTAGAAAGTA TAGGAACTTCGTCGACAGATTATAAAGACCACGATGGAGACTATAAAGAT CATGACATTGACTACAAGGATGACGACGACAAGTGAAAGTAGGCACCTCG AACCTAGCCAGTAAATAGAAGCACATATGTATATAATCGTAAGATAACGC TAGCAAAATAAATCTGAAATCCTAATAAGAAACCGTGGGAGTGTGACGTT GTCTTATCGGCGCTAAAGTGACTGGACAGATTTGGTTAGCTATTGGCTGC ACTCTTTTGTGCCGATCATCATGGAGCTAATGGTTATAATACTTATGGGG AACACCATGGTATAAACTTCACAGATAAGCACGGCGAGCCAAAAGACTTA CTTCCAAACGGCAATTAAAGCGGTTCCCATACATCTTTGATAAGATTCGG GCCTCATATATGTTTGCTGGACTTTATATAGATCAAATAAACCCTATTTA GAATGGGAACTAGTTCAAGTTTCAAGATTGTGAATCCGAAATTAATTCAA TTTAATAAATATAATAATTACGTGCTATTTTATATATGATTTATTTATCA TACAGAGGATACTTTTTCCATTTATAATAAAAAATAGTATTTAAAGGCAT AAATATTATGAAACTTGTAGAAATTTCTTAAAACTTAATATTTTTAAACC CAAGAATTAATGTAACTCACAATTGGCGCATCTCTAACAAATCAACTTTC GCTCTTTGCGTCAATAGTGTTCATAGTTGTCTGGCTCATATACACACACA CATGTGATTTTTTGCCTTCATACAAATTCAAATTTAATTAATTTATTTAT ATCCAGTAATCAGAGCGATAAGTAGGTTGGCAAAAGGTTTCGGCCCACTG TTATCTTATCGAAAGTGCTGGCCAAATCGAGGTGCTCGCTCAATAACCGC TCGATGCTCCTTCATTTATCAAGCGGCGTCTGAACAGTCGGTTAACTTGA TTCGTCGCGTTCGCGAGTTGGCTGTCCGACAAGTGTGAGTTTTGCTTTTT AGCCAAATAGCACTGTGACCACAAAGTGCAAAAATAATGACATACTCAAG AAGACAAACAAGCCAGCAGCGGTTCCAATGAAAAAGTCTCGAGTAAACAA TCAACAAATCAACTGGACAAATAATTAAAAAACGGAAACGTCGCCAAAAA TTGTTAAGTCCCTAGGCTTTTATTGCGTTACGCGTTGTTGTTGTGATTAA AGTAAAATGCCAATGCTGCCTACAATTGAGGAGGAGGCCAAGTTGTCCTG GATCCGGCTAATGTGGAAATACCGCCTTCAGTTCCAGTCCATGGCCTCGG GTAAAAGTGAAGAAAACCCTAGAGTATCCAGTTCTTTAACCTTCATTTTC AATCACCAACAGCGTCGATTGTTTTCGTGGGCTGTGGAATGCGTTTGGCC TGGTCAATTTTCGATACTCCTGCTGGCAAATTCTTAAACAACCATAATAC CCACAATCTGATGATGAGCTGGTTTATTGGAGCTGCCGTAGGCGCCCTAT TGGCAGCCCTATTTGTTCAGCGTGTCACCAAAAATGTGGCATATGTAAGT AGTTTTATAACTTCCTATAAATCACAACCTACACTGTCCGCTGCCAATCA ACATCTCCACCCAGTTTTGCCCTTTTCTATGCCACCAATAATTGATTCTG CGACCATTAGCACACTTAACCATTAGGGGCTTATCAATCCAATAAACTGA TAACGCGATCAACCGCGTTCAACCTGCATTGGTCATTAAGTGGCGATAGT CACTGGGCGGTGAGCGAGGGCTGATCGATCGGTTGTTGGGATTTCCGAAG TGCTAAATCAGGTTACACAAAAGAATAATTATTCGCAATTAATGCGCTAC AAAAATTGGAGTGGTAGAAAAATATTTGTTTTGCTGATTATATGGATGTT ATATATAATAAATCGCTTTTAAGATTCATTAGATAATTTTTTTTTTTTTC AATATCTAAGTGTTATCTTTTTATAAAATTAGTTTTTATTAGTTTTCTGT TTAATATCGTTTTGTATTTGACAGACCTCCAGTGGCTTCCTGATGATTAT AGCTGGCATTCTGAATGTAGTTCTTCCCCAGCATTTTCTGGCCGCCTGCT ACAGTAGCGTCAGTGTTGGTGCAGCCTATGGGCTAACCCAGATTCAGGCA CTGGTCACTGGATCCGAGGTGGCACACAAATCGATTCGAGGAATGCTCCT CAGCTGTGAGAAGATATTCCTGTGGCTGGGGGTATGCATGCAGGTGTTCT ACACTCGCGTGTGGCACAATTTGAGGCCACTGGATACGCAAGGATACGAG ATGCACATTGATCAGTTGCATGGAATGGTGTTGGCCGGCCTGGGGCTGGG AGCTGTTATCCTGGCACTAGCTCATCGCCTGGAGTCACCATTACTTCTGC TGCATCAGGAACGAGATATGGCTGTGGGTGAGACCCTGAAAGCTCTACAC GGACAATCCACCACCGAGTTGGTAAGATTACGGGAAGACTGCAGGCAACT GCACAGCGCTCGAGATTGGGAGCGTTTTGTTGAGGAGCCGGAAGAATCGG TGGCCGATTGGAGAGTCTGGGCCCGACGTATCCTGCCCTTTTTCAAGGTC CTGCTACTCAGATGCTTTGCTACCCTCGCCGTGTCCTTGAGCTATAATCG AGCATTTGTGGTCGTCAGTTGGCATGGCCTCGAATGCGATATGAACTGCA TGTACTGGCTGGCATTCGCTGGCCTTATAGGCAGTGTCCTGGGAGCCTTC GTAGTGGATTGGCAGGGACGCAGAAAAGTGTGTTCCTTATCACTTTTCCT GGCAGGCGTTGTCATCGTGATGGTGGGTGGAGTGTTCGATCACTTAGAAT CTGTTAAGAGATCCTTCTATGACATTAATTTACTGGTCATTGCCCTTCTA ATGCTGCTATTCGAAGTGATAGTAGCTGGGGGCGTGGCTGTGCCCGCCCT AGTCTACACAGCCGAGGCCTTTAGCATAGCCCACAAGGCAAGATGCTTAG CTGGCATCCTAATCGTAGAGCAATTGCTCCAGTTGGGTCTGCTTTTGGCC ACCTTTGAGCACTACATCACTGTTTCTGTGTTCTTTTTTACGATCGGTGT TTTTAGTTTTATTGTCGGCTTGACCGTATTTATGTTTATGCCAGAAACCA GGCAACTGACACTCTACGAGTGCCTGTTGAAGTTCAAGAAAGTTCCTTAA AGCGCCGCCGTATCTCTAAGTGCTAAGTATCTCTTATCTGTACCTATCTG TTATCTATTTTTAAATATTATATATTCTATTCATTCGAGTGATTGCTCGT GTGCATATCATTATCTTTCATATACTTTCCCTTGACGTTCTGGTAACCTC ATAGAATAAGTGAACATTTCAACAAACTGTGTTTGTATCTAAATATTATA TTGTAGTATCAAAAAATTTGGCATTTATACTAAGCAAAAATGAAGTTAAT ATCCGATAATTGTGAGTAGTCTTAGTCTTATTAAATCCTATAAATAATAT TTATTTGAGGCAAAAGATACTTTGCAGCTAACGAATTTATGTACATTTCT ATAAGGTTTTCCGGCATTTAAAATAAACTTACCATGTCTGGAAAGAAAAC CTGAGCCTTGTCTCTAATTTATTGGTTAGTAGTATTATTGTCTATAACAT TATTAATACTCATAGTAATAATATTATAATTATAATCAACATAATTTTTG GGTTAAATGTGACGATATCAGCCAAGCATTAGCGTTTTTGACATTCTACA ATGGATTTTTGGTATGGTTCGTTGCCAAGCTAAAGCTTTCAACTGTTGTA AACTGTGCCCACCAGCTTTTTGCCATAACTCTGGAAAAACTGTTACCATT ATTTGCTTTCCAAAGCTTTTCCTGTAGGCCAGGCCAAGAAAAAGCATTCG CATTCGCTGTTCTATGTAAACAAAGCGTTTTTACGATTTCCCTAGCCGGC AAATGAAAGCTCTTTGGCTCATTCATAAAGGTTAACACAACCCCGTCTCA TCCTTCCACGCATCCTGGCACTTTTCTGAATTTAATGCTGATTTTAGAGC GGAAAAAGGACGAAAGACGGCGGAGAGCGAAATCGAGTTGATTAATATGG CGTGTGATGAATATGCATCGGCTACCAAAAAGCCGAAAGGGAAATGCGAA CCAGCTCCCCAGCTGGCCATCTAATGATGTGGAAAATTCGCTTGGCTCTT TATTTTTTCGTATATTTTTTTTTTTTGTGCAGATACCAGATACTTTTACT ACTTATCGATATGCAGTTTTTGTGTTCCACAGTCCGCTCAGCCAGACAAT AGCACTTCGGGAAGCTAATGCCCAAAAGTGGCTGCTTTGCCATTCTGTAG TTTGTACTCCATATTAGTTTGGAGATGGTTTTGTTTGATCGTGTGGATGT GAGTGGATGTGGCCAGGATTCTGCGGTTGCTTTGTTACTCAATTGCATCA GGCCGCAATTAGCAATTCTGGCCAACACTTGCCGGTCATTCAATAACAAC ATGCGGTCAGCAACCAAACTCGAGGCTCTGGCCCAATTGAAACCAGTTAA AAGTTATTTAATTTTTAATTGACTTAATTAGTGGCAGTGCAATTTCTTTG TTTATGCAGCAGCAACAAAATGAGGGCAAATAACAAACAGAAGTACAGAA AGAGAATATTTTTGGAGTAAAGTCTGTTTAAGAGTTTAATACTAGAAAAA TTCCTTTAAGACCAACCTTCATACCTTTTTGTCTTACAGATACATTTTGT ATAAAAAATATTGATCTGGTCAAGATTGCTAGACATATGTATATAAATAG CTTACCTTAAGAAGCCTTTATTTGTTTTTTATTTATTTTTTTTTTTATTT GTTCTGTTCACTTAAGGACTTGCAGTAGAGAAATACCCTTCTTATCCCTT AAAGTTCTCGACAAAACACTACAGCACATTTTTCAGCGCAAGGGGAATAA ACTATTGCAGCTGAAAAAATGTTCAAAGCTGCAAACTGAAAGGCAAACAG AAAAAAATAGTGAAAATTTGTAAGAAAAAGCTGGAAAGCGTGAAAAACAT GGCTAAAATTCGCACGAAAAGTAAAGCTCATATGAGCTGGGAGAAGTGAG GGTCCCTTTGGAGCGGGCTTAATGCGTTGCTGTGTGTTACCCTTGTTTCA ATTAACTGAAATTGAAAACGACAATCGTAAACATTAACAGCAATGGGATT CCCCGCTGAGCAACAGGAACAACAATCGCAAATGCAAATCGCTTTGGTGC AGCAGAGAAAACCGAGTTGACGGCCAGAAGTCAAGAAGAAGCATTTTCCA CATTTTCCACAAGCAGGCGAAAAGAAAACAGGTTAAGAAAACGGCAAAAA TGCTTGCCGGCATCGTAAATGAAAAAAGCAAACAAACGTAAAATTTTATT TGTGCGCAATTTTCTATAAATTTTCATCGATTGCCATTGGGATATTGGCG ACATTTGCGTTTGGCATTTTGCTGCGTCCTTCAAGAACGTATATATATGT ATGTATATGTACTTGTGTGATCCTGGTGGCTCCTCCGGCTGCCATAACTT CAGCTGCACTTGGAATTATGTTTTTGCCAGCGCTGCCATCCCACACGAAA TTGAAAAAGTCCATATACTATGTGTAATACAAGTTTCCAATCAACACCGA ATGAAGTTTCCATGATGGCAAATAAATAATGTTCTCCGCCCTTTGCAGGA AAAGTAAACGGAAGCGGAAACGGAAACCCGGTAAGCAGCCATTGCTGGCA TCAAATTAATGTCTCAGCACGCCGCAAAAATGGCCGACGTGGCAAAATTT ATGACACCGAAAGACAACTCTAAAGTGTCCAAGTAACCAAGTGGCCAAGT GGTCGGAAGACCCATTCCGCTGCGGTGTGACAATAAAACGGAGTCAAATG GCCATAAAAACGAGGGCTGCCAGTGACGGCCCCAAATCCAAAAACCAAAC CACAACGAAACGGGCCATACATAAGCATATAAAAGCGAAATAATAAATAA GACCGTAAATTCTTCGAAGGAAGAGCGGAAAAGGGTTTTTCAATCATAAA CAGACAAAGTGCGAGCCATTCAATAAGCCAACATCTCCAATCAATTGGCC GCAGGCAAAATGTGAAAACTTTCAGTTTGCAGTTCGGAAATCAAAATATC AAGTTGTTGGAAAATTTCGAGGACTTGACAAATTAATAGGAAATTAAAAC GAGCAACTGACACGCATCTTCCATGTCTGGGCTGCCAAAAAGCAAATTGA CACGTTTTCATTTCATTTGCTGGCGCATTGGAGATGCCGAAAATAAACGC CGCCCTGGCAAAGTTTTCCCTAACAAGCCTATAAAGTTTGCTCGCCTTTC CGACAAAGTAAAATTCTTCTTCTTCGTCTTCTTGCTCTTAGTTCTTAAAT TTCCCAGTCAGGGCAGTCCGAAAAAGCTGATCAAAAATTAAAGAAACCGA AGGGCAGTGCCTTGCAGATTGAGTACTGCGGCACAAAGCGCATTAAATTT AATTAGCTCACATAAATCCCGCTTCGGATTCGAACGAGGTTTTTGGCTTT GGGATTCTGCCTGCACAGGACACTCTGGGAATCACTCGAGTTGACATTTT AATGCAAACGGGAAGGGGGAGGGAAGTGGAAAATGTTCCCTGGCTTTCCC TCTTCTGTATGCCATTTTCCTGGGCTTTCATGACTTATGCAAGTTTTGAC GACAGGTGCACGCGTTTGCAACTCCGGCAGTTTGTGTATGTATGTGCCTT CGTGTTAAATCAACTGTCGCTTCCTCTCGGCAAAGTTTGTCCTGCGAGGA CAGGACATTCAGGAGCAGAGCCAGTGGAATTCAAGTTATGATAGCTGCAT GCGTTTCAACAATTTACTTAACAGCTAACTCTGCTGAAAGTGCCACAGAA GGGAAAATAAATCGGGGGCGCGTGCGAATGTGCGGCCATTGGAGCAAGAA GTTGGAATCAAGTCTTCTGAAAAATAAGTCGGAGTAAGTAATAGGGAAAT TATCATAGCAGGTACGCATAAATAGTTCATATTATATGTTAATACTTTAT AACTAGCTTCTCGAATAAACTTGCATACTAACGTATGGCAGTAACAACAA TATTCTTTTTAACCCATTTTATATTGAACTTTAAGCTTGCGGATTGCATC GCTTTCGTTGGGCGTCTGCAACTGTTGCTAATTAAATTCTACTTTTGCCG GATTATTAACGCAACCGATGATGGTTGGTTGCACCTTTCTTGTTTGTTGG AGAGTGTCATTTATGACATGCAATTAACGCCATTAAAAATCTGTGAGCGC TAATTAAGTGAGTCATGTATTTATACATTTTGCATGAGTAACTTGTGCAT TATTTATTGCTGATTTTTCACCATTTTTGTTTACCATTTGTGCTTGCGGT CGAATGGATCGATTCAATCAGCTCCGTTTGAGCGCCCTTGGAAGTCTTTC CTTCTTAAAAGGGTTTGCAGCGCCGGGACACGAAACAATTCACTTCCGTT TTGTTCAGCAAAGTTCCGTTGCCAAGCCCTCTGCCACGCCCCCAATGGCA ACCGCCACGCCCCGCGAGCCCTGGTTGCGGAAGTACTGATAATGTCTGCC ACCCGGCCATTGACAACCGCTGAAAATGCAACCTGCCTCAAAACCGTTTG CTGTAATAGTACACGGAAAACAATTTCCTAGTTGAATTCGAAATCTCGAA ACCCTGGTAAAAATCTGATAGTTACTTAAGTGCCTTAAATACTTACGTAG TGAATTAATTAAAATGTGATGCTCTTGAAACAGATCAAATTTATTCAAAT CTATAGATTACAAACAACATGCAACTTAAATATTGGGGAATCGAGAATAT TTTAATTTTTCTTCAGTTTGGATTACTTAGAATTTTCTTAAATTCAATTA CATTTTCTAAAAATCCATTTTTAGGTATATTTATTCAAACACTTGTTTGT TTATTTTCGCTGTGTAGCTGCAACAGCTCCGTGTCTTTTCACCGTTATTT GACTTAACTGACAGCGGAAACGGCGCTTCCAGTGGGGTTTTCCACCTGCT CGCTTTTCCTTTTCCACTTGCCCCGCGTCGTGCTCTGTGTATTTCTGCGC TGTTTACAAAATAAGCGAAAGCTGTGCCAATAAGCCTCAACGTCGCCTGC ACTTAATTTATTTGCAACAAAAGGGTGAAGAAACTTTTACGCAAGTGCAA CTTAGCTTTACGTGCTTTTATTTTTTGCAACCCATACCCGCTCACTTCTT TTGCCCCATTTGTCTCGCTTTTGCCTTTTTTTCTTTTTTTTTTTTTTGGT TGCATCCACATCAGTTGGCTTGTTTTCCACACAGTCACATACATATAACA TATATACATACATACATATGTATATATCCTGGCTTACAACGCGAATTTGG TGACCGCAAACACGAGAACAGGATGTGGGGTGCATGATGTCAGGCGAGGA TGTGCCACGAATTCTCGGCAGGATCTGGCAGATTTTTACGCGTTATAGCC GCAAAATGAAGGCATTTGCATATCAGCGGCTCCATCAGAGCGGCACACTT GAAAAACATGAATGATTTTCGAATTGTCCCCACCTGTTGTGAATAACCGA ATTTTTTTTTGGCAACCTTTGCGTTAGGTAGATTCCCGTAGGCAATGTAT GCCCAACCATTTTGAAGAAGGAAATGTAATCAAATGAAATGTGTCACCAG CACTCGCACTCATACTTTCGATTTCAAATGCAGACAAACGCTCAAAGAGA CTGGCAAAAAACTGGCCTAATTTTGCATAGAAATCACCAACAACAAATAA TCAAATGCAAATATGTATTCAGGAATCAATTTGAGCGCAATCAGTGTGGG AAAAAGTGATATTTTCGTGACAACAAGAAATAGACGGATGTGATTATCCT GCGCAAGTTTGCCGTTTTGTATATTTATTTTTTTTCAATCAGGGAATAAA AAATCTAAGGTATAAAAAAAACACGACACAATATTTTTTTCGAATTTTGT TTACCCCTCTTAGAACAGTTTACTATTATTAAATACCAAGAACAGATAAT TATCAAGCTGTACATATCGTATTTCTACTATTTTGTTCAATGGTCAAGAG TTTCTTCATCTGGTGGCTAACCTGATTGCCTAAATAATTGATGTGGCCTA GTTAAGTTAAGAAATCTCCACGCCAAAAGCCAATCAATTTCGATCTCACA ACATTTATCTGACCGACTTGTCACTGACTTCTGCTGGCGCATTGGATGCT CAGTGGGGCAGTTTGAAATTAGCACCTAAAATGTCCTTAAGTGAATTGAA TGAAACTGATTTATGGTCGCACTCAATGCAAATGTGCGGACCCCGAAGGG CTATCTATTCGTCTCTGGGCCAGTATCTCCCATCCGACCATCTATCTATC TAGCCAGTTAGTTGTTTGTTTATGCAGCCTACAAATACACATATTCTGTA GTTCGTAGAGGAAGCGGGTTGGTCAAAGGAGTCTGCTTAAGCAGGCGTGT GAAATCCGACCATTAGCAATGCCATATATTCTCCGCCCAGCTATGATATA ACTTCCATTCCCGCACATCTGTGTGTGTCCGTGTGTGATGTTGTTGTGTG ATAATTGGTGTAAATGCCACATGGCTGAATCGGGGCCAGCAGCACCGACT TGGAATCGGTATAGGAACCGGTACAGGAGTCGGAATCGAAATCGCAGACT GGTGTTTAATATGCAGCTGCATAACTTATGGCGCTGCCAGCCATTAATTT GACTTGGTTTATGTATGAGTGTGAGTGTGTGAGTGTTGGGCGGAATGGTG CAGAAATCGTTGCATAGCCACAGGCGCACGTGCGTGACCCACCTCGCCAC ATATATTTATTTATATATATATATATATTTTATTTTAATTTGTTCAACAA ACGAAAGTTTGCCGCCTTCGTCTTTGGCGTCATCACGATCGCTTCATTTG CTTCATTCAATCTGGCACACGTTCCACTTCTCCAATATATAAACACATAT ATATATTTTCATTCGAATATATATATTGAGAATGGGACGCAAAATCACAA TGGCCGTGTTGGCCAGGCCGAAACAATATGCAAACAATTTTTACCGTTAC ATGACTGAAATACACAAATAACTTCGGTCCAAAAGAGAGGGACAAACGAA CTGACGCACTTATGGTCACGTGCGATTATAAGTATGTCCAAAATGTATTT CCATCTGCACTTTAGAAAATTAATTTAAAAAGTGGAGAATTATATTTCCA AAGGGTCAGAGAAGAAAATTAGATCTGAAGGTTTTATAATTTGTACAAAT AGAAAGAGATATCTTTTTATTTTATTTTGTTAAGAATACAATTCTATGTG TCATATGATTTTTCTCCAAGTTTGAAGGATATGTAAAAATGGCAAGCTGA CCAGGAGCCACAAAAAAAGGAGAAGAAGACTCCAGAAGGCGCTAAAGCAA CAAAAACAAAGGAAAGAATTTTGTGTAGGCGAGAAAAAAAAATAAAAACG GACCTAAAAAGGTCGTGGTATGGCACATTTCCAATATGCCAATAGATACA AGCCCATCTACAGTGGGCACCCGCTAAGAAACATGAAACTCAAATACAGT ACTTAAGTGGTAACTTTTACATTACTCACCAGTCTTCACTGCACGTCCTT CATAGAACAATAACAGATTTAATTTTAATAAAATTTGCTTCACTGCCAAA ATTTTCGGGGTCAGCAAGACAGAAAAAATATTCCATGAGAATGGCGAAAA TTAAAAATAGGAAACTGCTTCCATTTTAATTAGTTTGTCATTGTGGGCAA GTTTGTTCAGTTTTTTGGCAAAAACCGCGCCGTAGCTTTTGGCCCGCTTT TAACCCTTTTTTATTGGTCATGTCTCGGGAGTTGATCGACATTTTTCCTT TTCCCAGCTAAAGTGGGAGTAAGCCCCTAACCGAAAGTTGTCCGTCATCC TGATGATGGTCGTGACACCGATAAGTGGCATGTGTGTGCAGAAGTGTGTG GCCAGGAGTGTGGGTGTTTAGATGGCTCGTCCTTGTTGGCCTGATTGATG ATGTCCTTGGGAAATGGCCAAACAGTATGAAATCCATAAGTTGACAAGAC AATTATCTTGCAGCCCGCTGTGTTTCATTTTGTACATATGATTCAATATG ATTCAAATTGAGGGTTTATCCAGGAGTGTTCACGATTGGCTTCCTTTGAA TAATGAGGATTTAATTAAATTATAGTTATGTTATTACAGTTATTGAGAAG CATAAATAGAGCCTTGAGTGGCGCGATTAATTAAGTTGCGATGAAATGCT AATAATACGTATCAAAAACTCAGCATGGTTTCATATTTATTACAATAAAA TAAAGCAATGTTTCTGTGCAAGCTTAAGTCACTAAATTGAACACAATTTA TGCAGTATTACAAATTATATGTTGAAACCCAATCACCCTCTGTGATATTT CCTAAATTCTCTTGTTCGCAACATATTTCCTTTCAAAAACCTTATATTTT CTTTTAGACAAACAAAAAGGTGAAGTAGTTACTTAAAAATATTGCAGGCC ACAAAGGTGTTGAAATAGCGCCATCTAGCGATGTTTCACGGCAACATCGA AGTTCCGTATTCAACCGTGTAGATGGCCTTAAATACATATTCAAGTTAAA AATAATTCAATTCAATACAAATACATATTAAGGGTAAACAGTACAGCCAA TAAAAATGTTGTTCATTTCATTGAGGTAAACAATTATTGAGAACAGTGGA ATTGTAACTGCCTTATGGCTATTTTGTTTTACTTCATTTTATTTCGCATG AGCACAACTACTTATGGTTCATCATGTACAGTGCCCCAACCAGTAGGCTG TTTCCGAGCCGTGACACTGCATCCGGTGGCAGGCGCAGGAAGTCAGTATG CCAGGACGGCAGTCAGGAAGTCCATGTCCGCTCGAGTCCCGTTCGGTAGT GCTATCGCTGATCCTGCGAGTGGTGGGATTGGAGACTCATGTCGTGTCAA CTGCGTCGCCTCCAATTCAAGAAGACTACAAGTGGCTCTCGGTCGGGCAT TGAAATCTGCTGGCTGAGAGCGGGAGTGGAGCAAGCCCACTTAACGCTAA GTGCAGTTGATTGCTGCTGGAGACGGGCAAATATGCCATAAGTTCATAGT TCATAGTTCACTGTTCCAGTAGTCATGTTTGCAAGCCCTAAGCCTTATTT CGCAATCGCAATAGCCCCATCGTTTGTCATGCCCCGTCACGAATATCTCG TATCACGGCTATATCGCTCGGCTGACAACAATAACCACTCGAGAGCCAAA CAAAATCTCCTGCTAACCAAACACTTACCGGTTTCTATACCTTCAATACA ATGGAGGTCAAAACAAAATCAAAGAGAATTGAAAACACTCTTTTGTTAAA CATTTTAAGACTCTTAAAACTGAAAACGTAAGGTTAAAAACATGCAGTTC AAGTTAAAATTATGGTTATTATGTGTAGCTCTGAGCTGGTAAATATTTTT AGGTAGTTAGTAATTAATTTCCAAAAATGGATTATTTTTATATATTCTTT TCTTATTAGGACTAATATGTTGACCGCTGTTGTTAGTTTTATCTATAAGT TACAATTGAGTGTCATAGGTTGGGGTAGGATGTGCTTCGCTGACCAAAAA GGATTACTGCGGCAGCAAATACTTGCAGGAGCTTAGTAATATAGCGACCT TTGCACCCACTTTTGTGCTATTTTATTAATGTAATGCACGTAGAGTGTTT GCAAATATTTGCCACATCTGTCCATGTCGATTCATAAATTAAGGAAACAT TGCATTTATCGCCGTTTCAAGTGTCGCGTTGCATGTAAAATATGCATTTA TTGATATCACGCATACGCCGTGTGCTCCATTAGAAGCGGATTGCGCAAAA ATGCTTTCATAATATTGGCGATAATTTGAACAAATTATAGTTGCAATTGC AAGTGGCACCCTCTCTCTCTAGGGAAATGAAGCTGTGCGCACAATTGTTG CCGGAATTTATTTCCATTGTCGACCTAGCGAAAACAATTATCGGGGAATG GAGTGCAAATATGCAAACAGAAA