##gff-version 3 ##date Wed Jul 24 04:28:23 CEST 2024 ## exported from the transgeneomics system molecule_59049575 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59049575 mpicbg region 9631 19810 . + . Name=dmel-5.43-2L;type=genome;start=14414236;end=14424415;strand=+ molecule_59049575 mpicbg region 19811 19883 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59049575 mpicbg region 19884 20872 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59049575 mpicbg region 20873 50778 . + . Name=dmel-5.43-2L;type=genome;start=14424416;end=14454321;strand=+ molecule_59049575 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59049575 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59049575 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59049575 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59049575 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59049575 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59049575 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59049575 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59049575 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59049575 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59049575 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59049575 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59049575 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59049575 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59049575 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59049575 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59049575 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59049575 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59049575 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59049575 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59049575 coding_transcript gene 12230 12713 . - . alias=bur &gr;;ensembl=FBgn0032546;alias=bursicon beta;alias=bursicon;alias=Bursbeta;alias=bursbeta;identifier=FBgn0032546;alias=CG15284;Name=pburs;alias=partner of burs;alias=burs-beta;id=51143714;alias=partner of bursicon;alias=bursicon beta-subunit molecule_59049575 coding_transcript gene 19808 21588 . - . alias=CG3474;alias=Cuticular protein 35B;Name=Cpr35B;alias=DmelCpr35B;alias=DS06283.4;ensembl=FBgn0028871;identifier=FBgn0028871;alias=CG3474;id=50933329;alias=BG:DS06238.4 molecule_59049575 coding_transcript mrna 19808 21588 . - . id=50933340;Name=FBtr0080633;parent=50933329 molecule_59049575 coding_transcript exon 19808 21514 . - . parent=50933340 molecule_59049575 coding_transcript cds 19808 21514 . - . parent=50933340 molecule_59049575 CLC misc_recomb 19884 19917 . - . Name=FRT molecule_59049575 CLC cds 19925 19996 . - . Name=BLRP molecule_59049575 CLC cds 19997 20017 . - . Name=TEV molecule_59049575 CLC cds 20018 20041 . - . Name=Precision cut site molecule_59049575 CLC cds 20042 20083 . - . Name=V5 molecule_59049575 CLC cds 20090 20806 . - . Name=SGFP molecule_59049575 CLC cds 20813 20872 . - . Name=2xTY1 molecule_59049575 coding_transcript intron 21515 21576 . - . parent=50933340 molecule_59049575 coding_transcript exon 21577 21588 . - . parent=50933340 molecule_59049575 coding_transcript cds 21577 21588 . - . parent=50933340 molecule_59049575 coding_transcript gene 46739 47379 . - . id=51467673;Name=CG15283;alias=BG:DS08340.1;ensembl=FBgn0028844;alias=DS08340.1;identifier=FBgn0028844 ##FASTA >molecule_59049575 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACAAAAATACCTAATCAACTCC TTCTCTTGTGTTCCACAGACTTATTAATTAGTTGAGCTAAATCCATAAAA TATTCGATATGGTATTGTCCAGATATGTCGAATGGCATTAGGCTAAACTA TAGTTATAATAAACACAACATAAATTTCAATCAGAAAGCGAAGCGATCTT CTTGTTAGCTTCCACACGTATAATACCATAGGCAAACAAAGAGATTTTTG AAAAAAAAAAGCAACAGAAATACCTTTGAAGATAAAGCCAATCAATGATG TCACGCCTTCTTGTCTTTTGGCCATTAATGTGGGCTGATTGTGTTTGAGG GCTGAGAGCTAATACGGCAGTGTGTCTTGACACTAAAAGCATTTTTCCGT TCGACAAAATCTTTGTTGTTTACATTTCGCCTTGAGCTTTCATTAAAAAC AAACAGAAATATATTTCACCGAATGACAAACAATCAAATTAATTGCGTTT TTATGCAAATGCGAATGGAGAAGAAATAAAGAATTCGAAATGATGAAAAT TAATTGCCAATATTAACGCGTTTTAACACAAAAAGTATGTTAGATATTGT ATAAGCGATAACCACCACCAGCAGCAGCAGCAACAATAACAATAAAGTAG CATTCAAGTAAATGTTTATATTTTTTTGTCCCCCCTTTTTTGTGATCTTC AAATTTGTTATTAATTAACATTCATTAATTATCATCAAAGTGACTCGGAA GAATATAGCAACTTGCCTGCCTTTCGTGGCCAGCGCTTAATTTATAACTT ATAAATATGCAGCAATTTATTTAACACGATGCATGCGTTCGATTTGGCTC ATAAATGTGGCCTGTGAGTGAAATTTATTGGTGTATTTAGCGATCGATTT TAATAATCTGCGCAAAGTCTTCCAAAAGTTTTAATTTCTTTTTAAGAGCC CTCTGAGTAAACCACACAGTACAGGAACCTGTTTTTATCTTGAAATTTTA ATATCCCATTTTAGTTCAAAGTATCTTTCCCACTCGTTCTTAAGTTAATG ACTCAAATCGATGCACACTTTCCAGGTGATCCGCGATTGAAGCTAAATGA GTTATTCAGCACCTGCAATGGACCAGTAATTGTGTTGTTGTGGAAACCCG TTCGCTTATAGACTGTTTAATTTGATTACCCTAATGAAATGTTAAAAGTT TTGAATGATCATCTGATCGCAGGTAGTTTTTCGCTCACCGGTTCTACGTG ACTCCATCCGGGATGCAAGATTTGCCGAGAAATCTTGCTCGATGTATGTT ATAAATATAAATATATAATTTATATTGTGTCGGCACGTTGCTGTTGATGG AGCCACTGACGCGCGATGCCACCCAGGAACCCCCCTCTTGATCCACCGTT CCCCCTTGGACAAATCTTGGATGGGTATATGGAGCTCAGCAGCTCTGGAA GATCACTGCGGTCCGATGTTAATGGGCGTGTCAACTAAATTATGAGTTTC GCACACACGAACGAAAGGCGGCAACTCAGTACCGACCGGTGGAGATCACA TTCAGCTGGGTAGTAAGTATATGGGGAGCTGTGGAAAAATGCTTAAGTAA ATTACAGTGCGTGCAAATGTGCTTGTGAACATGAAATTATAATGTAGCCC CGAACCGAGCGTGTTCCGTTCCAAGCCAAGCTCCAATTTACAATTAGTCG ATGTTGCCCCATCTCTGGTGGCTTTAATCAATTCAGCTGGGTACTCGCAT GTCTAAAATAAAATATAATAAAACAGGAGGAATAGGGAAAATAATGATGA AAATTAACAACCAGAAAGCGGTTTTCATCTTAAGTGCAGTTTATGCTTGA TTATTATGTTTGCGAGACGAGTTTCCGGGTGGTTAGGCATCATGTGCCGC ACAGATGCCAACATAAATATGGCAATTGCGAGTGCGCCGGACCCTCTGAC TAAATGAGTTAATTTGGTAGCCAGGCTGGGCCAAAAAGTCAATATGCTCG TTGCCATTTCCCTGGCCATTGCAAATGCCTGTCAGAGGACGAGTGATGTA TTCCATTTTGGTTGCAATCAATTTTTGGCCTCCAGTGATATGTCAAACAT TTTCCGATTCAGGATTGCATTGCATATTTTTGGGAAAATCAAAGTTCATG CATTCATGGAGTATAGCAAGTGCCTCTCAGCGAAATGTGTACTGTATTTT CAATCAAACAGATGTTTGTTAGCCTTTGGCTTACTGCATATCAATGTAGC AAACAATAATGCATGAAACAACAGACACTTTAATCATGAGCAGCTATCAG TCTAATGTTGTTATTCAAACACACACGAAGATCCATTTTAAGCATAAGTT AAATAAGGGCGAAAAAGTGGAAAGTTCAATATAGAAACTAATTTTGTATT AATTTAATTTAATGGTTATATTAGAATAGACATTAAAGATATATGTATTT ATTTAACTGAAAAAGCTGGGACTTTCACTTATTCCTTTATTAATTCGAAA TATTTAAGAATATACATGATTTTAAGTAATGGTACTTTTAATGTGGGGCT CGTTTTGAAAATATATGAAACATATTTCACTCTGCAACTAAAACAAATGG ATGCAAATAGCATAGTTTATGTTGAGGCATTAACGTGTGAAATCGCCACA TTTGAAGCACTTGCACTCGGTGGGCTCCCGAAGACGTATATCCATGCTTC CCATTTCCGGAGAGGTCAAACGGGTGCCGTCCGGGTCATAGCAATGGGTT AGAGTGATGACCTTTTCCTTGAGGAAGCTTTCGCGGCAGCAGTAGCACTC CTGGAAAACATGGAACCTTAGAGTTCGCTAACTCTATAGAGGCAGGATTC AAACTTACTTTCAGAAACCCCGTGGGCGTTATCACCGATGGTTGCACCTG ACTGTTGCACAATCCTTCGCATTTGTTGACGATGACGTCGGCATTGCAGG TCCTCTGCATCCGGCCCAGCTCGTCGAACTCCTCCTTGATCAAGTGGATC TCCGACTTGAGAGTCTCGCAGTTCTCGTCGCCAGTGCCTTGGCTATATCG CAATGCCCTCAGGCATTGGGGCACTAGGATCGCGGCCACAAAGAGCAGTT CCTGGACATGCATGCTGACCCACTCCCAACGCCCAACTGTTTGGAATCGC TTCACCCGGAGGCTCTTTTATACGGAAGAGGGCTGGACCTGATTGGATTC CATGATATATGTCAATGACTGGCTGATGGAATGTTTGTGTCCTGCCCAGC GGGTGAAAATTCGGTCGCTTAAGTTGCGGTAGGACATGGCAATTTACACA TCACTTTTGTGCTCCGTTAATTGGTAATTAAATCAAACGACTTGACCACA AGTAACGATGTCGACTGTATCGATTCGATTTTTTACACGTTAAACCAAAT CGATAAGTACGGAATAAAAATATAAAATGATTGCAGAAAATTTAATAACT TAATGCCAGATTGCGTTACACTTAGCTTATACTATTGGTTATATTACAAT AATTTATTGGTGTGAGCAATAAAGAGGCAAATACTTTCAGCCTTAATCTA TACAAGGGGCTTTCCCGCAATTTTCCGGCCACGTAAACAAAAAATGAAAT TGCAATCTGTCTGAAGTTTTCCACCTCTCGTGTCTGTTATTGCCTGCTTT TGGCCCTGTTGGCCCTCCCCTGTTGGCATCGTCTTTGTCTCGCCCAATTT CGCAATAACCACATTCTCTCTCCCAGTATCTGTAGCTGTATCTGTATCTG AATCCCACTGTGGGCTCGACCGCCTTTCTCCACTTCACTCCTCTGTGGGC CATGGTCGATGGTTGCGCTTTAGAATCATCGACGCAAACGCAAAAAGTCT CAATGGCGCAGTAAATTATGTTTTATTATGCAATAAAGTCAACCATAAAA ACGCTGCAATAAATTAAATTAACTACTAAAAATGCTGATTTTATTTTTAC CCTCCGTTTGCGAAATTGTTGTTCAGTCAGTTCCGTCTCTCCATATATAC ATATGTATACACACACGAGTATTTGAATACATAAACAAGGATGCATGCTT GTGTATCTATCGTATGGCGCAAAGTTTTGTTCTGAATTTTTGGTTTACTG TCTGGATTTTTGCCTATTTTTCCTGTTTTTCTGTCTGCGAATAGTCTAAA TGGTAGTTTGCTCGGAAAAACCGCTGCGCTCAATGCTGGAACTCAAAGTT TGACTCAGGATTTCAATTAAAATTATAAAAAAATAAAGACTTATTTACAT TTCTAGACAATATTGCAATTGTGATTCTTAAAAAGAAAATACTTCTAATT ATAAAAATTAATTCAAATTCCCTATTAAAAAGCTGAATAATGGATGATGG TGTACAAAAATTAGTTAGTATGTTCCGCCCAGCCTAAAAGATTGGTGCTG CCCCAATGCAGCTCAGATCAATGTTCAAATTAGTGCCATTCCCTAAGAAG TCCCGACATCAAAGGATAACCAAGGGTAAAAAATACATCCTGCAGGCTTC GTGTCCATGAATGAAATCCAAAGCGACACACGACCGGCAGCAGTAAAACA AAAGCGCAATGCTTTAAATGAATAAATATGACACATAAATACCATCCAAC AATGGATAGCCCGTGTGTCTTTGTGCAAAAGGAAAAAACAACAAATTCAA CAGATTCGAAAAGGCTAAAAAAAAAATAAATACAAAAAAATCGCAAAACA TCGTAACAACAAAGCCAACCGACCAAGCGACAGGGACCGACAGTTAATTC CGCGAAAGAGGAAATTACAATTCATGCCCTTTGGCAGAACTCCATGATTA TCAGATCGAATTAGTGTCTGCCTGGGCATCTCGTCCTCCCATCCTCCCAT CCTCCTTTCCGATACACGGATACTCTTCGGTGTGCCTGACTGTTTGTCCT GGGGCCACATGAGCCCCACACATTTTTTTTTGCCGCATTCGGTGGCGTTT CGGCCCTCAACCGAACCATTTGAATGAACTTGGACCGGCTGCTCCTTTTG TTTCCCGTTAACAACAAATACAACAATTATGAGTGTGTGCCCCGTCTGGC CGAGTCCTGTGGAACCTGTCATGACCAGAAAGTTGCCCTTATTTTTTGGT TCACCGTGCGTTCATTTCGTTGTCCGCAGACAAGGAAAAACAAATATATG TGGTAAAAAATGCAGCATTTTGACTGATTTGCGGGTGTCGCCATTATATT CATATATTAAATAATAGAATTAGAACTTCAAAGTGCTATATGCTAAGCCT AATGCGGTTTTCAAATAGTTAAATACTTGGCAACATTTATATATGCGATG TCTGGATTTTTTCTAATAGTTTTTTAATTTCCCCCAATTGATTGGTTTGC CCTTGCCTAATTGATTTAGAATTAATACTTACTGTCCGTGTCTCGTAACG CCAGCTGTAGAAACATACTCGAAAAATGATTATGGGCAGACACATTAATT AAATTAAGCCGACTTTGGAGCCTTGGGGCTGCCTGTCTGATGACTAGAGA CTGGGAGTGAATCGGTCTGAAGTGGCTCTTAGTTGGCCAAAATCGCTGTT GACTCATTATGGTAAAGACATGTGTTAATTTATGTAACTTTCCCAAACGG CCATTGCGACGTTCATTAATCATTTTTTTAGTTTCGAGATTTTCAAGTTG GCCCCATGTCTCGCCGTGTGCTGCCTACTCTTTTATGTTATTTTTAGTTA ATTGTTTGCGCTGTAAAATGTTTATGCGTTTTTGGCCAGCAGCTCGGTTC GGCTGCCTTTGCCCTCTTTGACTAATGTGTGCCGCGTGTTCACATTTTTG TCTCAATGATTTATAGTTGTCCGCTGGACAAAGTCATTTTTGCTTTGGAA GCGGTTTTGTGTGCCTGCAAAACGTATCAATCATATTGGAAATTAATTTT GATAGCCACATAAAGCTAGTCATATAAAAAAAAGGTGGAAAGTGGGAAAA ACAAAGCAGCTTAAGCAGAAATCTCAGTTATATTGTAGTAATTAGCTCCT AATGGATTCATTCATTTTCTATCGGAATTCAATCGAGGAAAATAACTTAA AACTGTTTTTCACTACCTGTACATAAACAATTTGGGAGTAGTACTTTACA AGTGCAGAAATAGTGAAGCGAAAGTAAGCAGCTCCAACGATTTGCCCGTT AGCCACCTCTACACTGCCCTGCATAATTATGGTGCGTATGAGGCCCGAAC ATTCAATCTGCCTGCCCCATCCAAAGCTTTAAAACAAAACCCCTAATCAG CATTAAGGTGCGCATAGCCTATTATTAACTTGATTACAATTCGGGATAAG CGAAGGCAGCCAAATCAGCTGGGCTATGTGTGGGTAACACCCCGGCGATC GGCGCAAAGGGAGGGCCTATATGGTGGGAAGTGAGGATCATTTTGCACGA TTTACGAGATACGAGTTGCGAGTATATGTATGTATGTTCATATATAGTCG AGTCGAGTCGAGTACCCGGGGCTAGAGTGGCGGATAATGGTTACGGACAA TGACGATGAGTGGATGGTGGCTTCTACTCTCTCGCCGTGGAATGGAATAA AGACTGCCCCACCGTCGAGCACATCCATCAATCGTGATGGATAACTGACA GTTTGGGGCGTTGCGGGTTCTCAATTTTCATGGTCAGGCTTCTCCGGTGA AATAAAGAAAAAATTCCATTTACCCGTCAACCCAATTTGTTGATCATTAA TCATTGATATATGTAGTATATACGGTCAACCCGTTCGTCTATTCGTTTAG TTGCTGCGCTTATTTGGTTGCTTAAATGTAGCATTGACCCAATGGGGAAT TGAATTGATTGCGCATGTGCATGTGCGATAATTGGCATAAATTAATATGG CCAACAAATTTAATTAGACATAAATCAATGAGTTTATTAAACAGTAGCCA GCGCAGACTGCAGGCAGCAAGCAAACCGGCAGCCAATCATGCCAAACCGT TTTCCACCAATAAACTGCCGCAAATTGGCTAATACCGAATGGCGTTATAT GTCGAACCCAGAGTTATGCCCGTTTCCCTCTGTCTATCTAGCCAACGCCC ACCAGTCTCGGCGCGCACATTAAAAATCAGTTAAATTCAGAAACACTCTA CCCACTGACCCCCGCGCCAACACAAAAATGTCCATAAACAATTTTCATGG CAAAAAGTCCGACCACGACTCAGTGGAATCGAGGGACCTCTCACTGTGCC GGCTGTCGAGAGACGCAGCTGGATTCGAACTGGTTATATGAACGGACTGG ACTCGACTTCTGTGTGCGGTTGGATGTGCCACCAAAAGCCATTTGGCACA TACATTTCAAACATTTATGGTTATTATAAAGCATTTAACATTATTATGGA TGCCATGGGGCATCTGTTACAATCCGACGGCCAACAAACACCGGCAGCAG CAGCCCATATAGCCGGCTTAAATAATCACTCTGCGGTGTAATTAGCAAAA TATTTATTGATATTTCGCAAAGCGTGTGCAAAAATAGGCAATGCAATTGG CCAAATGCTGCAGCTTTCGGTGGAAATCTACATTGCAATTGGGAAAATCA GTTTTTTGGATTTTACATGACATTTTATTAACTATTCAGATATATTAATA TTTAAAAATCCTGAATATTTATTGAAACTCTTTTCTATTATGTTATTATA GTTTTCTTCTAACAGAAAATATTTTTGAAAATACTACAGTTAAATGCATC ACACAAATGAATTTAAAATGTATTTATTTCGAGACGGACTACTCATGTTA GCACTTTATAAAACGACATTAATTGATTTGGCATTTGTAGCTTATTTGAC TGGACACACAATCTCCTACCGAATCAAGCTTATTTATGTTCCACAAAGAG GCCAAAAAAAAAACGAGCAGAAACTTGACAAATAAGTTACGCTTAATTTT CTGGCAAGCGTTTAAAAAACCGAAACACGCAACAAGGCAGTCAGCCACCT AAAGCAAAAGCCATTAAAAGCGACGCGACACTTTTGATAACAAATTCAAA GCCCAAACCGAAGCCAAAATGAAAATCAAAATCAAATTCGAAATCCAAAG CCGAAGCAAGTTCAGCTTGAACAAAAAAAAAACAAAAAAATCAAGCCAAA CTTACTATACTATACCGAAAATCAGAGGCTGCCCATAAACATTGAATTTT ACGACGCTGTGTGGTCTCGTTTGACATATTGTGGGCTTTACGATTCCAAA ATTAATGACACCATGGCCCAAGTCAGGTAACGGGCATTGGAGTGGATTCG ATTGGATGGGATGGGGATTGGGAGCGCACTGCTTACGGATTTTGACTTGG CTGGTGCCATACCGGTTTGGGAATGTATATTTGGTTGGGCGAAACGACGG CCTCATCAGTTAATAAGACACATACCCATTTTTATGGCATTAAACGACGA CAAGTGAAACATAAAATATATATTTACTTTATTTTTATGCGCGAATGGTC CGCTTTAGAGCTCAAAACTCACTTGACAAAGCAATTTGCAATGCAAATGG ATCGTCGCGTTTGGGGTTAGTTTCTCGGTTTTCTAAAAATTCATTCCGTT TTGCGTTTCGGCAACTGTGTTTTTTATTGCTTTGATTTCATTTCAAATAA ATCGTAATCAAGTGAATTTACGACCTGTGCCAACAGCGACTTCACATTCC CTTGAAGCTTAGCTTAATTAATTTCAATTTAATTTTTTCCGAAACAAAAT TTATGATTCAATTGCATTAGGTGGCATGTAAATTTTTCACTTTAGCTCAT TAAGTGTCGAATCGCATTGATTAAGGATCGTGATTAAGGAAAATTAAAAT ACAAAACGCATAATTTCCTTAAATGTCAGTTGATAATTTCTTTTTTATAA TCAGAAATCGCAATGAGATAATATATAATCTTAATATACTGATACTTATT TTGATTGGGAATATTTTCATTATTGAAATGAAGCATTTTTAAACGTATTA TTTCTTAATTGAAAGCTTCTTTTACAATATTTGCGCATATCTACTCAAAT GATTTATTTAACAAATTATTAGTATAATTTCTGTTTTTCTGACCTACAAA TTGAGCTTCTCAATATGAAAAAATGAACCTCAATTAATCATTATTTGCAA CACAAGAAGCACAAAAATCCGGCAAAAAGTGCCATAATAAATATAAGTAA TAGCTGTTGCAATTTTCGCACTATATCTCGTATATTACATAATGTAGAAA GTGCGTGCCGCACAAACACATGGAACGTATAAAAATAATAAATTACACGA AGCGAGAGGCAACTGGAGTCCCGGTCGAGTTGGGTCGAGAAGGGATTTTT GTGGAGCGTTTATTATGCGCACAATAAACGCGGCGGGCGCAGCGGCGACA TAAATTAAATTTATGATGCTTATAAATATTCCACAGTCATTTGTAATACA GCAACAAACGAGGGCAACAGGATAACGCAAGGATGTGCCGAGCCTGTCTG TTAAACAAATTGTAGCCAACTCGGGCTGAGGGGAAAGCAACAAACAAACA AAAACACACGCACTCGCGAATGCTAGGGAGATATATATATTTGATTTATG GGTGTGCGCGGATGAATAAAGGACTTTCAACTCCGAAAACCCGATTGCCA CCACTAGAAGTGAAAAGAAATCGCCCATAAAAAATCGCCATGTGCACGCA TATATACAATATGTGTGTATGCTTGCATAAAAAATACAAGTTTCAGCCAC CTGAAATAGCCAGCGAATAGATAGATATGCGGGCTAATTTATGGATAAAC TGTACAAATATGATTTATAATAATCGAATTTGTGATATATCTCGCCTGTC GTGTCGCACATTACTGATTCTGACCCAAATTACGGTCTATGCGATTCTCG TCTTGGTGTTGAGTCGCGAATGCCTGCCTATTCAATTCATAAATCACCAT ATGCTAAATATGCTAAAATTTCACTAATAATTTGAAATGTTTAAATATTC CAAATGTATCGAAAAGAGCTATCTACTGTGATTTGTTTCTTTTTTAAGTT AATAGTTCGTTGGTAAGTATAGAAACTTTATAATTCGATTTTAATAGGTT TTAGGGAAACTTTAGTTACACTTCTTGTCCATTTCAAATCAAATAATTAT TTCAATTTTGAAAATATTTGCCTGATTTATTTTGGTATAACAACAATAGG TATTTGGTAAGAGTTCAATAAACGATTGATAAACAATTGTATAGCTTAGG GGTCAACTCACTTGTCGTCGTCATCCTTGTAGTCAATGTCATGATCTTTA TAGTCTCCATCGTGGTCTTTATAATCTGTCGACGAAGTTCCTATACTTTC TAGAGAATAGGAACTTCCCGAGGATCCGCTGCCGCCGGCGTTGCTGCGCC ACTCCATCTTCTGGCTATCCAGGATCTGGCGCAGGCTGCTGGCCATGCCC TGGAAGTACAGGTTCTCGGGGCCCTGGAACAGCACCTCCAGGGTGCTATC CAGGCCCAGCAGGGGGTTGGGGATGGGCTTGCCCTCGAGCTTGTACAGCT CATCCATGCCCAGGGTGATGCCGGCGGCGGTCACGAACTCCAGCAGCACC ATGTGATCGCGCTTCTCGTTGGGGTCCTTGGACAGCACGCTCTGGGTGCT CAGGTAGTGGTTATCGGGCAGCAGCACTGGGCCGTCGCCGATGGGGGTGT TCTGCTGGTAGTGATCGGCCAGCTGCACGGAGCCATCCTCCACATTGTGG CGGATCTTGAAGTTGGCCTTGATGCCGTTCTTCTGCTTATCGGCGGTGAT GTACACGTTGTGGCTGTTGAAGTTGTACTCCAGCTTGTGGCCCAGGATGT TGCCATCCTCCTTGAAATCGATGCCCTTCAGCTCGATGCGGTTCACCAGG GTATCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAGGTGCCGTCATC CTTGAAGCTGATGGTGCGCTCCTGCACGTAGCCCTCGGGCATGGCGCTCT TGAAGAAATCGTGCTGCTTCATGTGATCGGGGTAGCGGCTGAAGCACTGC ACGCCGTAGGTCAGGGTGGTCACCAGGGTGGGCCAGGGCACGGGCAGCTT GCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGTTGGTGGCGTCGC CCTCGCCCTCGCCGCGCACGCTGAACTTGTGGCCGTTCACGTCGCCATCC AGCTCCACCAGGATGGGCACCACGCCGGTGAACAGCTCCTCGCCCTTGGA CACCATGAATTCATCAAGTGGATCTTGGTTTGTGTGAACCTCGTCCAGCG GGTCCTGATTGGTATGCACTTCATGGTAACCGTGTCCGTGCTCGAAACCA TGATCCTGACCGTGGCTGTGGCCGTGCCCATGTCCGTGTTCCTGTTTCAG CGAATAGCTGTGGGAGCTGCTTCCGTGACCATGTCCATGACCATGACCGT GACCGTGCTCCTCGTGTCCGTGGCCATAGTCGTGTCCGGATTGCGAGGAG TGCTCCTCGAACTCAACGTGTCCGCCCTCGTAGCCGCTGTGTCCATGGCC ATGGTGCTCCGCCTGGTGGTGATCGTGGAGCTTCTCGCGATGGACATGAG CCTCGAATCCCTTGTGCTTGTCCGCCGTGTAGTGGACAGTTCGCTTGTGG CCATCGGCATCGATCAACTCATAGTGTCCGGTAACCGTGTGGCCATGTCG TGACTCACTCTGTGACTTCACATCCCCAGTCTTTTGATCCTTGACGCCGT ACTGGAAGTCATACTCAGCATGGGAGTCATGGTGATCATCATGCCCGTGA TGGTCGTGATGATGACCGTGATGTTCCTCGTGATGATCGTCGTGCGATGT TAGATGCACGGAGGCATGACTGGTGGCTCCACCGTGATGACCGTGGTGTT CGTGGCCATGGAAAGGAGCTGCCCGAATAGCCGCAATGGCCAAGAGGGCA AAGGCGATGAAAAACTAAGGAAAATCGAGGTGAATAATAATTTGCTTTAG TTGTTATCCTTTTTTGCTGAACTCACCTTTTGAGCCATGGTACCGCAGCT AGTTTATGAGTTAATCTTAGCTAGACTACTGTTGTCTGATCTCCAGACCA AAGTGAACTGTACCTAAAACACCTTTAACCCGGCCTTTTTATAGTTGGAA TAAATCGAACCCATAGGTTAAACTTTCAAAAAAGAATTGGTAAATCGGTC TTTAGTTACGCCCCAATTTGCAGTTCAAGATCAGGTCGTACTTTCGCCCC AGAGACGTGCAATTATATTCGACTGCCAGTTCGACCCTTTTATTTAGCTG TTGTTTCGAAAATCCGTAAAAAAAAAAAATAAATAAACATAAAAATGAGG AAAGAAAAGAATGGCAGTGTAGTAATTCATTGTAAAATTTACTGTCGCAA CAATTGCCAATTTAAAGTGGCATTGTTTATGCATCGCATCGCTGTCGTTG TCGGCCATTATAATCCCCCGGCTTGGAGTCGGATTTGGATTGGGATTGGT ATATGTGGGCATAGCCAAGAAACAAACGAGCCAAAAGATTTATATGCCTG ACAAACGTCTTCGAGTCGTTGACGTCAATCAGGCCTGACAAAAAGTCATC AGAATTGCAGTTTGCAGTTCTCCCTCGGCAGCGGCTTCTTCATTTTGGCC AGATCGGAAAGGCTTGTCTGCTCTCCTCAATCCCAATTCCAATCCCATCC CATCCCAATCCCAGTCCCGTTTCCCGATCCCGATCGGGATCCCAACTTTC GGTGGACTGTTGTCCCGCCAGTCCGCCTGTCAGCAGTCAATCGGCTACCG TCTGTCAATGTCGTGTCGCCTTCATCAAAGGCCACATTCGAGTTGACAAT GGGGATATTGGTTCTGTTTTGTAATCCGCAAAGGATACGGATTTTTGAAA GTGCTCAAGTCTGGCAAGAAGAGCTACGTGGCTGGATGGAACATACTTGA ATGCAATTTGCATTTGATGCGTGAATTAGCTGGGAATGTAATAATTGGAT GAGAATGTTCAGAAAGAAGGGATAGAAGAACATGGCTAACAGATTCAAGG ACCATCAGTTATATGATGCTAAGTATTTATTAGTATTTATTACTATTTTT ACTTTTGGTACCCTCTATGTACCCTCAATGCCTTAAATTATGCTCCTTCT GCTGTGTTTAGATAACTTTATGCAACAGTTGTGGTTTAATTGATACTGAT TATGGTAACTGGGCTTATGCATCCAAAAGTCGAGATCTGGGAGCAGTGAA AGCCCCCTTCTTTCATCATCGAAATTGCCCTTATGGCAGTGGTCTGAACG TGGCACAGAGCCGCAATGTTGCTGCCGCAAGTTGAGAGTCGCAAGTTGCA AGTTGCCAGTTGCCGTCGCTGTCGACTCATCGTTGTCAGTCAAAGGGGCA AACGAAAGGCTGCGTGGTTTGGTTGGCTGGTTTCGTTGTCAGTGTCATTG CTGGCTGCGTTTTGTGGGCACATTTCGGCTGCTTGATTACTCATGTCAAT CAGGCTTCCAAACAGCGACGACATGCTGTCAATCTTTGTGTCATGGCCGC TAAAGTTGTTGGTCGGTTGGTCGGTCGTTTTGGCCGGTTGGCCAGTTGCT GGAGTCGTACAACAAGTACGCTTGATTGCCGGGCCCAAAAGGCTGGGTAA AAGGGTAAATACAGGACAGCAACAACAAAAAAAAATAGGAGGCGATGGGG AAAACCGATGATGCCACAAAGGTGCCCGGTGGCAGTGACAGGACTGTAGT TGTAGCCCATTCGATTGATGTGCATTGTATGTAAATTGGGCGGTCGTTTT CGCATTTGATGCCCTGTCAAGGGATAATCAACAGCAGCAGCAGCAGCAGG AACGGCAGCAGATCAACAACCGCAGACAACGAAGGGACAACTTTAACATT CACTTCTACTCGTTGCAAGTCGCAAGTTGCAACTCATTATGCGTCGCATA CGAAATTGTTCCCCACTGTAACGAGCTTAAGAAATACGATCAAAATGCCT CGATAATTTTTCGCACAGCACCACAGCGACCATAAATATCCTTCACTGGT ATCCTGCCGAAAATTGAAAACGACAATGTTGAGGGCTTGTTGACAGATAC TCATTTGACAGGATCCCATCAACTGTCACTGCCAAGCGAAACATAAACTG AATCGAAACCGAAGCTGAGTACGGATATCGAGTTTAATCGCGATTGTGGC TAGTAAAAGAGGCATATTGTTTGCAAAAGTTATGGAACGTCATTTAATTG GACTTCTTAATAAGCTGAATACTCTTCACACAGGGGAAAACATAATATAC TAAGCGAAAGCATTTTATAAATTAACTGCAAGCTGGCAAACTAATTGAAT AAGTTAATGACTAAAAGCAATTACATGATCTGAAAAAGAGACATTATCCT TTAGGCTCATATATAATGTTGTTAAATTTTACTTTGAATGATAATTTAAA CATTATATTGCTATGAAAGAACCTGTTTAATTTTATTCACAATACTCATT ACTGAATCTCTCACTCTATATACAATTTCTATACTTAGCTTTCCAGCACT ACCTACTTACATCCGAGGCAATGACAATAAAATATCGTCAGGCGAAAAAG ACGCAAGAAAATGCGTTAAGACAATTCGCAGCAATTGCAATTGGACAAGA AACTGGTTGGCAAGCCATAAAGTTAGCTGTAATCGGTAATTGCGATAAAT AAAGTAAGTGGCCGGGTTCGAGGTGTTGGAACATCCAGGGGAGGATGGAG AGGATGAGCACATGCCAAGGCATCCCGATGCCATCTACGATGCCTCTGGA GTCCCGAGGAGTGTTGACAATTCTCGTCAATTACGTTGTAATGCGTTTGC TTCATCGCAGCTGCCTTGACGTTCCAGTTGGGCCACTTGATGCATTGCTT GACACATTATGATGCTTGATTTGTTGTCATGGCAATTTTGCCACCATCCA CCGACCATCCACTGACCATCTTGACCAGGCCTCAAATGGCATCTACCCAA TCTTCACCTCTCTCCATGTCAATAACTCCGCAGGCAGCGACGCTGTGTAA TGTGAATTTTTCACTATGGACAAATGAGTTTGTCGCGGCCTTTTTGCGTT ATAATTACAAACGCTTTTTTTTTGCTGCCTCTGCTGTCTGTGAACAAAAA TAGTTAGCAACGCAACAACATTGCTGAGCTTACCAGTTATTAATGGCTAA GTCTGGACATGTTGGTATTTATCAGGTTGCCTATATATCCTCTCCTTCTG GCAATTTGTGATCGCTTGTTGTCCCCTAATTATTTGCTCAGCTAGTCAGG TATTTATGGGGAATTTCTTACATATTTCGAATGCAAATCAAATTTTATAT GAATGTGCTGTGGGATATTTTATGAAATTTTGTGCCTCTTGCTTATACAT ACATATAGTTAACATATGTGTGCAAGTCTTAGAACCCATTAAATAACTTA ACTACAAGTGAGTTTTATTCGCACTTAAACATTAGTTAATATGAACAATT AAGGATGCTCATTAATTTATACAGTACAGAGTAACATTTCGAGTGTGTGC AGACAGGAAAAAGTTGTTCAAAGACAGCCTCAGCTGGGAATCAATGAAAA GGTGACTGTAATTGATTGTGTGGCCATTTTTGAACTGAGCCGACAAATAC GCTTAATAATGGAGCGTATCGCGTAATCACAGCACTCGTAATTGCCTCCC ATAGACTCGATCGGAACAGTAGCCACTGGATATAAGCAAATTATGCATGC CTCCAGTCAAGTCTTTCAAGATTGAAAGACTTTTTCACAAAACATCTTAC CAGTCATTATAAGCACTTGACATTAATGACATTTTGGTCGCCGATACTTA AGACATTATCTCCACTCAGGTCCCACGAGTGAAGTAGAATAGTCCCGGTG GAGTGGAGGGGAAATAAGGCAAATTGTGTGGCATTTCCTGCCACTTGAGA GTCCGTTTCTCATCTGATCTTTGGCGGCAACCAATAATTATATGCGCCAT AAACGCTTTGTCATCTCGCTCACGATGGGGCCTAGAAAATGCAGATTAAT GCCCGCTTCTGGCCCGGCCTTTTGTCATGAGCATAATTTTCTCATCGATC TTGTGATTAATCATAAAAATTGTATGCCTCGTCTCGAACTGCCCGCTCTT TTGTCCAAAAGCCGACACATATGCTTCATTAAAGCAACTTCTTTTTCTTC CTTTTGTCCAAGGTGGCGGCAGCGACTCATATAGATTAATTTGTGGCCTG TGGGGCCTGTGAGAGATCACGTTCGATTACATCGGCTGCCAGCTACCAGT GTTCCACATTTGATCGATCTATCAATGATATGTGGGCCATTATAATCGAA ATAAATGGTATGCACGATGGGTATGAGCCTTAAGTTGGAATACAACTGCT GAGAAACAGACCGTGGAGGGTAAGTTAAAATTGTTAAAACTTAAACTTTA ATAACCTAAATGGCTTAACTCACATTGGTTTGGATTTGCTTTTTTATGTA CGATCGGCTGACTTAGAGATATCGAGGAGAATTCTTTCGATTCCATTTAA TTTTGGGGTGATTTCTATACAATACCCTATTTGCATACATTAATTTTGAT TTAATTGAATTTCTGTCACGAAACTCCCTGATCAATGGGTAATATAAAGT ACCCCCCTGTGGGAAACGAAGTGCACCCAATTAGTTTGCAGTTTTGGTGA CGCCCAAGTGAATAAACCAGGTACATTCGAGTATACCTATTGTAGAGCAC TGTTGCCTTCTGGCTTAACAGATGCCCGGACTAATCAGTGGCTACCAGAT CTGCACAACAATAGGTGCACGGTGATGCATATCGTGTTACCTTCATCTTG TGTCTGCATCAAATTTCACAGTTGTGTGAACCTAAACCGACAGAACTAAA CCATACCGCATACGATACCAATTGCAGGGGATTAACCGAATTGGGGGTAC GATGGCTCGTCACTTGTATTGTTTGGTGTCTGGAACTACCGGGTTTTTTT TTTTCTTTTTTGCGATCTGTATCTTAATTCGTTTGTTTTCATCAAATTAC AAAATTGCGTGTGATAACAATCTGGTAGTTGAGACTGTGAACGAGGGCCT AATCCCCTGACGAGCAGTTTCCTTCTTACTGAGAGCTGTCCATCATGGAA TTAGATATTTATCATAAATGTGCAGAGGCCTTAAGGAGTTTCGGGGCGAA ACTCACACTCGAAGTTCGGAAATTCACCCCTGGGTAGGGCCGGGCCAGCC CCTAAGTGCCATTGTATTTGACTGTCTGTCAGATTTGAGATTTGCTAAGC TGTTCCTCCCCATCCCACTTGCTGTTTACCCATCAGCCATTGTGCTACAT ATTTTGTCAGTTGTCTACCAAGTGAGTATCTCCGGTGCTCATCTCTAGGT CCTCTATGCTTTGCTCTACTCGGCATCGGCTTATTTAATGCATAAACAAT TGCTTCCATCAGGATTTCACAAAAAGTCGACAAAAGCAAACAATACCCAC CCATTCGACCTGGACTCTCAGCTATGAGCCCTCAATCCTGAGCTCTGAGC CAACAACATCTGTTGGAAGGAGTGGGAAACGGGGTTCTGAGTCGCTTCAG CTTTTTTCCAAACTGGATTTATGTTGTGCATAGCGATTAGCACAAAGGTG AGAATAGATTCTGGCATCACTGGGTGTTTTGAGCTGGAGTAGTGCAGTGA ACAGGAACAACCGCAAATATTTGTACTTCTCAAATTGAATCTTACTTGTG CCTTTTTTAATTACTTAAAAACAAAACCCAGTCCAGTTTGAAACGGAATC CAGTGAACACGGCTTACATAGTTGTGAAATGTGAGAAAAACTTTTGAACG GATTATTACGATTTTTGCTCTGCTCGTTGTTCCCAACAAAAATGGAGAGA ATATTTAAATAATCTCGAACTATTTGTATGTAACGATAAAACCAGGTATT TCTTTAAATTACTGAATGAGAGTATGAGTTATATGTTACGCTATATTTTG TTGTGTAAGAATTTTGTATTTTTTGTGTGAGATCGACTAATGACTGAAAC TAAACCCTTGATGCTTGGTCATGTTCGCTGGCGTGAGATTTCCTGCTTTC ATCAAACTGAGACCTGGCCAAAGGTTCCACCAGTTCCTATTAGTATTGAA TTTCGCTAAAATCATCGATGGCTTTTTACAGGGATATACATACGAGGTAA ATTAGGGTTGACCCACTCCAACCCGTGACATGGCTCTCAATCAGAACTGG GCACCTAATTAGCTCTTGGTTTTAGGGCTCGAGGTATCAATTTTCCCTGT TTCGCATCGAGTAACACATACATATGTGGCAATGTCTGGTAAATGTATTT GGAAAAAAGGGACCAATTTCCAGAGTCCTGTGCCACCTTTTTGCCCACCT AAATGGGGGCGCTAATCTCTGCAACAGAGATTAACAGCCGAGCAGACACA GAAACCAATTTTGTGTGCCGGCCAACTGCCGGCCAGGCAGGAAGGCAGAA TGGCTCTTGGTCGAGTGACAGCAGCCAGAAGGCCTAAATTTACGGCTTTC TGGGTAATTTGACACTTCGGACAGAATAAACGAGTGGAATGAGAGCCGCC AGGAAGAAAGGGAGCGGATAGTCATTGCAGCACAGGACATGGGACATATT ACGAGGGTTAGGTCCTGTAGGGATATGGGTTCGAACTGGTCGAGGTCGGA CCTGTGGTCACCGAGTGTCAATTGATCACAGACGTCTGCAGATGTCATTT AATTTTCTGGTCACGCCGTTCAACAGAAATGATCTTGGGGAGTGAGATGA GATGCTTTGCTGCACGGCCAAATCGATTTAACCTTTAGCTGATTAATACA AAACGATTTGTTGTCTTACAACACAAAGTGCATATGGTGCATGGCACTAT TCCTTTACTTATTTTAAAACGGATTGTGTTTCTATTATACTTTGAGTACT TCACTTCTTTTTAAATAGAATGGTTTTTAAGTCATAGTTTGGCCTTTTGT CTTGAAATATATTCCTGTAAAATTGAGCTACTGCATCTGAAATTGTGATG TGAATAACTAATATTTATGGGTAATCAAATCAATGGTGTCCAGAACAAGT CCGCCTTTGTTGCCTACTGTTTTGTGGTTCAATCAATACAGGATTAATCA TTTTTCCTAGCCCACTTCATTCAATTTACAAGCTATGCACATATTTGCAC GACCAGAGCCAGTGCAGCAGGCCCAAATAAAATGGGGAAATTCATTCGCA TTCGGAGATGACTTATGCATGCCCATGTACACGACAAATAACAACAGTGG CAGCAGCAGCAGCAGCAGCAGCCAGAAATCGTGTGTGGCATTTCGACCAG GCCGAAAGCAAAAGACAGACACCCAAAGACAACAAACGAAACAATCGAAC TGAAAAGCAGACAGAAGGCACAGACAAAATCCATCTGTCATACGGTAGTC ATATTCAATCATGTATTCAATGCAATGCGATGGGCGAGCGAGTTTATATT TAAATAAAAGCCCCATGTTTACACACCCAAAACCCGGGGAGGTTGGTGCT CGAAAAAACCAATAGAAGACATTGCTTATGGACCGAAAAGAAAATGAAAA TGAATGAACAACGAGAAAAAAAAGGTTGTTAAATATTTGCATTTTCTCCC GGCACTGTGTGTGTATTTGCGTCAATGTTGCCTCTTCAATCAATAAAATG TCAGAAATGCATTGCGCAGACAGAAGGAACCAGTATCGGATGATTCTGAA TCAGAATCAAAATCTGTATCTGAATCCGAATCCGTAGTGGAGTCGGAAGC AGAACAGGGACGAGACATTGAGTGACTGACGGACTGGACTGACTGGCGTG GCTTGGCTCGGTTTGGGTTGGTTGATTTCTAGGCATGACTGATATATGGC TTGTATTGACATGGACACAGTTCTTGACTTTCATTTTAGTTGGCTGGAAA CCACCATCAGTCAGGCAGCCAGTCGTCCAGTCATTCAGTCTTTCAGTCAG TCAGCAGCGAGCTTGTGTCAATATGTCAGTCAGTCAATCGGTGTTTGCAT AAGTCTTCGCTCCGCCGCAGATCGCCAGGTCTTTGATCGCCTGGAAGACT GATTAACATAACTTTCCGACAAAGGCACCCATACAGCCAACTGGCGCCGA CTGAATTTTGATTTGATTTGGAAATATAATTTGTTTACCTTTTTTTTTTT TTTGCAAATATGAATACAAAATAATAAATAAAGGGCTTACCTCAGACCAG AAGCGGCAAAATTCAAATCACATTCCCCATTCGCCATCATCTGATAAAGA CGAAATTTATTGCCCCCGGCGATTACAACCAATTTACGATTTAAGTTATT TGCCCATATCATTTCTCAATTGTACAAATATCGCATACTTTATATGGTAT ATGCATTCTGCAAACGAACTCAAAAAGTTCCGCATTTAATGACCCATAAC ATTTTGCCTTGTGTTGTGCATACGTAATTCTGAGATTTATTAATTTTGGT TCATCCATAATGGGTGTGTGACACGGCACATGCGAAGATTTGATAATTTT GTCTAAAAAATAGGAAAGTCGCATGTATAATTGGAATTTTACGACAGTCA TAAAATGTTTTAATATTGTGCTAATTGATGGAGCTGTGGACACGACAATA TCCGGTGACAGTAAAAGTTTATTGTTCAATAAGTATTACACTTTGAGAAT AAGCACTTCATTTCTTCATTAGAAATAAGATAAGTGATAACAAGTTATTT TTCAAATGGTCAAAAGAATGTTTTTTAATCTACACATGCACTCTTCTTTC ATTTATTCTTTGTTAGAAAAAAGAAAAACACAATATTCCTTTGTTCGATG GCACTTACATTTTTGTGCAATCAACAATTTCTTTCACTATAACTACACTT TATGCTGAAATCATAGACAGTTCAAACTACTTGCAAAAAAAAAGTGAAAA AAGAAGAAGGTCAAACATTGAGAATTAAACTGTTGACAGTTCTGACAAAG GAAATGATTGGCAGATTTTGGATTTAAGCCAAACCGAAAACCGGTTGGCC ATTGTAGAAGATACTTGTTTAGCCGTTCTAAGTCCAGGATTTGTTTTCGC ATTTGCTTGGCATTATATTGATCCTACTTACAGATACGCATACATATGTG CTCCGATGAGCAGCCGGGGGATAAAGAATGTTTGCATATGGAGATTTTCC CGGGGGGTAGTTAAATCGCACAGCCGACCAAACTTTTCAACATGTCAACT GTCTCACATAAATCTAACCTTTATAAGCATTTAATTGGCCGTCTACTGGG CTCTACTCACATCTGTGGGGCGATTAGTTTAGCCCTAGCTCGAGCACCAT TTGTATGATTACCAAAGTACGTAGAGTTGCATTATTTATGTTTCAGTTTC TATTTATTTTGAATTTGGATTTTTTGTTGTGTTTTCATTACTGGGTGACC AGGCTCAAGCCCAAGTTGTCATCCTAAAAAAACAAAAAAGGAAAAAATTG GAACTGCAATCATCCCCTGAACCGGAACCGGAGTAAAGTACTCTCTGTGT TTGTACACAACACATGCTGCAGTTGTTATTGCTGCATTTAAGCACTTTGT GAGAATGTTTTGTCATTGTTTATTTTACCCAAAGCCTGAGTGGGCTGGAT GACTATTTTGCGTTCTAGAATCCTTCAATCTATTCCCTCTATCGCCGTAG TCATCTATTCGTTTATTTTTGTACTCCCAGATCCTTGTGGTTTCGAATAA GGCTGTCACATATGTGAGCATTTTGTGCTAGGCTCTTCATATTTTCAATG CAAACAGTGAGAGATATTTTGTTTATTTGATTCGGGTTTGTTTTCTTGTC ATCACATCCGTGTGGTCCAAAAGTCCACTTAAAGCGGAAACTATAAATTC TTAACAAGTTCTTCTGAGCTCAAACGACTTATATATCTTTTTCCATTCAT ATTAAGTTATCACTAAATTTTCTAAGAAGCAGTAAACTAAAGAACGAACT TGGGATTCATTCACAAAACCACAGAAAACATAACTCTTTTTGAAATTCGT TTCTTGGAATTCGAGAACGTGTAGCACAATTTTTACGTATTTATTTTGAA GATATTTTGTAGACTCTCTGCACGTACTTGCTCGGAAAAGTTGGCCTCTC AATGGTTTTAATATGGTCTTTCGGCGAAATTTCTTTATTTAAGGAAGGCA GCAATTTCTGGTAGTTCTTGTATTTTCAACTATCTGGACATTAGATCGAA GTCACGTCCACTTTAGCTTGAGATGAAAATGTTTGTGTCAAAGATAGCAT TTATTTGTATTATCTTCCATCGGCATGAATTCCATAGGACATGAAATAAA CTAAATATTAATTTAAAAACGAATTTATAGATATAAGTCATATGTTTGTT AGAGCAACATAAGTATTTTTAGTTTCTTTAAAGTCTTTTATTTATGTTTT TTACTTTATTTTTATTATCAAGGATAAGAATAGCTGAAGCACAATATCCT TTGAAAACGAACAGCTGAATAAAAATGATCTTTCCACGCATTTGTAAAAG TCTGAGATGGCGACAGATCGAGATAAGTACTTTCTATTTCACCTTTGTCT TGAATTTTATTCAATTACTTGGGGTTTCTTTTTTTTTTACGACCAAAATA AACTAAGGTTAGAAAGAGGAGCGTATCGCATCCACTTTGGAACCTGAAAT CCCAAAAAAGACATTTGGTGTTACACTTGAAATTTATGACATCCTCTGTT TTCCAGTTCCAGTTGCCACGCCACTCATTGTCTTAACGATTAGCCTTTGT CCTGCTCCCTGCTGAGCTCTACTTTCACCCCGAACCCAGAAAAAGTAGAC ACTACAAGACACTCACGTCTGTGGAACTGGAAGATGTCTATCGCGTTGCG GAGTTGGCAAGACAGAAATATCAATTTCTCCCTCTGGTTTCCCTCAGCTA TCTTTGCCTGCCATTGAAAGTGTTAATTGAACCATAAGCGTAACCATAAA TGGATTTTATTTCCTAGCCGAAAGACAAAACAAGAGATTTCCGAAAACCG AAATTTATGTCCCTCATCCTCACAAACGTTTTATGGCTTTGCCCATCTTT GTCTCTCCATTGTTCTGCTGGCACAAGGGATTTTCATTATTCCTGGGTGT TTGCGGGGCATGTGTCCTTGCCACTAAGAAAAAAGGATCTGGTTTGCTTA TGCAATTTGTTGCAGTCCTCCTCTACCTTTTGTGAACTGCATTGTGTTTA CTCAGTTTGCAGATCTTGGGAGATCAGTTAAACAGTAGCTCTAGTTGGGT GGGTTGCTTGTTGAATGGACTTATAAGGAATTACATAACCTTGTGTCGTG ATATAACGATGGGTGTGCTACCGTAAGTCGATCTCAAAACCCTGAACTCG AGAAGGTTTTAGGATCAGTCCATGTAATCAGTGCGCTAAGATCTTGTGGG TTGCCGTGTTGTATTCCTTGGAAGGATTTAATTTTTGATCCTAGTCTAAT TCTTACGTTACTCTAAGGTACACTCTTTTCTTGGGATGCGATTTATTCAC TGCCAACCAAAATGATTTGAGAATTTCCGTACTCCCACCATAACGCGATT TCGAACGTAATTTATTCGCAGAAAGACTGCTTCAACTTCAGCCTGGCGTT TAAATCTGGCATAATCACAACATCATAACTTAACGCTGTCTTACCTGATG CCTGGATGCCCTTGAGTAACGCTTGGACTCGCTCCTTTTCGCTGGAGTTG CCCCCATTCCCATTCCCATTCCCATTTCGTTGGCCATCCCCTTGGCAAAA TCACGACACAAATGCCGTATAATCACTTGTCGAACGCTGCTCAATAATTA TAAGAGGGCGAAGTAGGTTGGACCCGTCCATTTCGCAAGCAGCGCGTTGC TATTAGGGCCCTGATTTCGTTGAAACCTATCAAAATACATAACAATCAGT GGGCTGGGACGGGCTGATCGCCCAACTCCGCCGCCGGGGCGGCATATATA GCGATGATGATGATTTCAGGCCGACAGCTACGTAATTATATCGAGCAAAC ATAAAAGGATCGGAGCGACCGGGGTCCCAGACCATCATCATCCAGTCACC ATCAAATCAGAGTCCCAGGTCCCCAGCTACAGGTCCCCAGGTTCGCGATG GAGGCGTTGCCAAGACGCATAACAATGAAAACGTTTAAGCCGACTAACGA GCGAACGGTGAGCTGTAATCTTCTTCTCCGCCGATGAATCTCTTTCTTTT CAGCTAAAAAATGCCCAACGACTGGGGGAGGCGCCTTGAATGAAGTTTAA CAAATTAATATTAAATTACGTGCCAAATTGGCAGACATCGAAATGAAACT AAACGCAGCGCAACGAAACGAAACGACTTGAACTTGAACCACATCAAAGG GAAGGATGCCACTGGATTTCGAAGCAAACGATTTCCAGCGGCTTAGAATT AATGCCATGTCTGGTCTGGGGAGCTCGGTGTTCGGATCGAGTCTCCATAT GCCATGGTAACCAACGGAAGTAGAAATTAAGCATTCGAGGATGCTACGGC TTGGTCCCCCAAATATACCATAAAATTTGCCCCATTGGCGCCGCGTAGTC ATCAGTGATTTAGCACACGTTTCTGTAGACGGACCTTCTCCGCTCGCCGC AGATTTTTATTCACTTTTTCTTAGTTTAATGGCGTCCTTTTTAGGGTTTT ATGGTCGTTTTGTCGGTCGTTGGGTCATTTAACGGACTCGCGTGCACTTT AAAATTGATTAAAGTGAAAGGCAAGGGTATCCGTTTTTTTTTGCCCGTTT TAATAACAGGACTCTTGCGGCGCTTTTCGCAATTAGCTGTCATTCATCAA AATGGGACAGCTTAATTGTGCGGTTGCTATGCGAAGTTGAATGAAGGTAC ATAAGTCGCAAAGAAACTATCATAGCAGTCTGTATTGGTACACTGGGGGA AATCAGTCATTTCCTACTGATTAAAGTTTAAATAAATAATTATAGTTGCC ATGCAATTATCTAACTTAGAGAGTGTAATTAAGCCTTTCTTTTTGGTGAT ACATCATTTTACTAGGCTTTATAATTCCTTTAAACTCATCGTAAATAATC TTACCTGTTTTACCTTGTACTTCGTTAAATTCGAAACATTTTAATTTGAT TAAGTAAGTTTAGATCGCCCAACCGACGCTATAACTATTCCTGCTGCCTC AATGATTTATTGCTAATTTCCCGTCAGAACAGCAAGGCAATATATCTCCT GCATATGGTCACGTAGGGCCCAACCAAGCTGAAAATAACCCAACCCATTA AAAGCCAATGATGGGTGGGTGTAGTTGTGCTGTTAATAAAATCTAATATG CTTAACCACAAAATGGTTGTATTGGGTCTTGTAATTATGCACCTTAATTT GCCCCATTCCCAGCGTCACAGCTTTGCCACACTAATTGTATATGCAGCCG GTGTGGAAGCCATCGTCAGTATTAAAAGGGGATTTTCAGGGAGGTGTATC CAATCCCCATCGCCACCCTCCCCCCCCCTGCCATTTGTATATCTTTGTCT TATACCTGCCAGCTACTTATGGAAATCGCTGTGCACTGAGCAGACTATGG AAATTTTCATTTTATTGGCGCCCAGAGCGTCTTGACTGCTCGTAACCCTC TAACTCCAACTTCTATTCCGCCTCCACCTCATCAAGCAAGCCACACGCAC TCTGGCATACCAAAATCCTATAAGTAATTGTCAACGTACTTTGGCGCCTT CTCCGCTCCTCCGCTCGAACTCCTCGAATCCTCCTCCTGGTAGCCCCAAC CATTTGTATTTATATTAATTAAGCGTCGTTGAGTTGTCTTCCTGTTGCTG CGAACTGGGAACTGGGAACTGGGAAACTTGGGACTGGGGAATGGAGATTC CTCCCTATCGACAATGTTGTTATCTGTTCAGCTGTCGTCGTTGTTGTAGT TGCTGCGGCTTGTTTTACAAGCTGGATGGGCTTAGGGTTATGGACTCGAA ACTCTGGCACTGCGGCACTCTGTTGCCAACCCAACGCAACCCCACCGTTC AGGGGCAGACATTTTAATTGCTTGAAATTGATGATAATTAAGCCGATCTG CATATTTGTACTTTCGGAATGTGCTTTGCTATTGTTAGCCAAATGAGTTT TTGGGGGAGTCCTCCTGACTTTCCCCCCTTGTCCATTAGGCTTATCGATT ATGAATTTTGTTCGAATCAGTTTACTTTCAGTTTAGGCAATTTGATTAGC TTATGAATAACAATGTTGATGGGATTAAATCTGTGTAAATAGTATCTTTC GCTCCCTTGATGTGAATGAATGAATTGACTTAATATATCTAATGTAAAAG ATACGAAATTTAACAATATTTAAATATATGAATTAAAGAACTTATAATAT ATTGCCAATATTTTTTAATTAAGAATAGGAGATTTTTGGTATTGCGTTCA TACTACATTCTCTGCTCTTTTTTTATCGCTTGGTCTTTCCAAAGTACTTA GTTATGGTCACAACCATTTTGCGCACCCTTAGTCGAGGATTACTGTGTAC TTGTAGGGTTTTACCGCTAATTACACTTCATCCGGATATTAAGTACACAC AGACTGCACCCAAGCCACATTAGGGCAAACGTGGGCGAGTGATCAATAGA GGCGAAGCCATAGAAGGAACTCAAGGGAAGTAATTAAAGATTTCCAAACT GTTGCGACTGAAGTGTATAATTCACTCAATACTTTCGCTAAGGTATACAA TTAATCAGCTCTTTCAAAGGTGATACTTAGACCAGGTAATAGTAACAACC TTCAATTAAAAGTCAATTAGCTTGGTCCGGTCTGGGAAGAGCTGGCGACC CTCGGAAGGATACGGGTTCGGTCGGTCATGTGAAACAATTTGAGACAGCT GTCGAAAACCACACGTTGCTAATTGTTGGCTGTAGCCGAATATGTGTATA TAAGTATGTATTTGATTGGTACCTTCGAAAGGTGGGCGAAACCCGCAGAA GATTAAATAAGAAAGAACAAACCTTTTTGCACCTATGCAGTGTCAAACGA TGATGACGTTCAAAAAGAAGATATACTAGCAGTAGTGCTTTCCCAAATAC TCTTTGGATATATATTGAAATTTCAAAAAAATAAATAAAATATCTGTTGT GTATAAAATTAATGTACGAATGTTTTATTATATTTGAATTTATTATTCAT ATGAATTTATAGTTAGAAAGTGAACTTAAAAATTAGTCTAAGTTTGAGTT TTTCTTGCAGAGGTTGCAAACTGTATCTGAAAGCCCATATACCCTTGCTA CTTTCTCAGTCCGGACAACCACAAATACCCGAGTGTGAACACATTACCCG GACCAGGGGCATTGAGGTTAACCCGAAGCGGCAGTGACAAGGATGCCAGG CGACAGGAAGTGGTAACTACTAAATAAGCAGCTCCGACTTGTGGGTGTGG CCAGTGGGAACCGGGCCAGACCAAACCGAACGGAACCGTGTGGAACGGAA CTTGACCAGGGTCAGCAGTTGGTAGTGAAGCGCATGTGACAAAAGTGGGA TGAGCTGTGGAAATGCGACAACACAATTTTTCCTTCCTTTTCCTTTTATT TATTTATTTTTTTTGTTGTATTCATTTGTTAGGGCAGACGTTTGGCATAC AGGACTACTGCTCGTTGGTGTCGTTGTCAGCTTACCGAGCTGGTTTTCTG CCGGGTTTCTCCGGCGGGTTTCTCAGTCGTGGCTGGTTGGGTTTAATTCT GTTTTCGGGTTAAGTAAGTGAATAAGTATGCGCTAAAATTCAGTCAACCG CATTAAGTATTTAAGCACTCAGCACACGCTCAGCACCGAGACTTACACAC TCGTCGGGGTATCGCATTGCCATTGCCCATCGCTCCCCTATTCTCTAGCC TATACACTTGAAGAAAAATGTTGAAAAACTTTATTTACATGTTATAATGT AATAATATTTATCATGGTGAAACAAATGTATTATCTTGCCTAAACTATTC CATTTATATTCATAATAAATAAGCCTATGTTACTGCCAACATATGAACGC ACTGAATAGATTATATTCATTAAGTAAAATCAGTTATTGAATTATTTTTC TTGTGTACGTACCTAGCATCTGCCTTGGCGAAATCGCTTGGTTAGCATTT TTCCACAACAACGCATACACTTTGAGGTAGCTTTTCCGCTAATGAACGCA TTAGGCGAAAAGGCGACGACACAAACGATGGATGAGGGAACCTTGTTGCC GGCTTAGTTCCTGCAATGGTGGGATATTTTATTAAGTACTTAACATGCCG CTTTCTTTGCGCGCAGACACATTTAGGCTCCCCTGGCATTTGCCTACAAT TACCGACTTGCTACAGTTATGTGGACGGTACGCTGAATTACACAACGTTT GAGGTTAAGCGGATTTTGTAATTATCCGACTCGTAGCTACAGCGAAATAG ATGGGGAGGGGGGACTTAAGCATAGGATCTGGTAAATGAAAGGGCCATGG GCTTACACCCGGCTCGAATGTCTGACTTTCGAGCTGCTTAACTCTTCATG TCGATCGCATCAAGCCATTTGCAGCTGCAGTTGGGAAGTTGGTAGTTGGT GAGCTAAGTGCACTACATCTATATTGTGTGTTTATATAAAACCATAAATA TAATTACAGAAGAGTAACTCAAGGCTTAGGAGAGATTAAAATGATTGGAA AAGAAATTTTAAAAGAATTGTATTGCTATGATTTTTTGTTAAATGGAACA GAATTTAAATGAAAGAATTTATTAAGCTCCTATCCTGCATTTTTGATTTT TTGGTATCTTTTTTTTCTGACCCATTTGTATTGCTACGCACACCTGCTAG TTTAACCGATACAACCTCTAATAATCGGAAAACCGAAGCGGTGCGCATCG TCACTACGTGTTCTTCGGGCCGTGGTGATAATATGCGCACGGCCTGTCTA ATCGCGATACATTGTTGCTCCGGAAACTCCTCTATCTCTATAAGTTACCC ATAATTTCATTCTGCGGCTGCATTTACCGCATTTCGCTTGGCCAACACCA CTCACGAACCAAGTTAAGTCATTACTGTGTGTGATGGCTGGCGTCATGCA CAGGCACTCGTACACGCTTATGATTTCCAGAAATTACAACTACTAATTGT CATAAAAAACCATTAAGCACATTACCATTTATTAAATCAGGCAGGGAAGC GTGCCTCCTCCGGCCCCAAATGCATTTCGCTTCAATTATGCCACGTAGCG GCGCAGAGTGTCGATTGGCGGGGGATGCGGTGTGAGTGTTCTGAATTTCC ACGAAAATTTCATGTAATTATATGTATGTATGTATGTATGTATGTATGGA TGTGTGGACAGGGGCACCATACCCATGCGGCATAATTTTTAATAAGTATA GGTGGTGTGGAACATCGGCGCCAGCCACCCGACTGCCTTCGATAATGACT CGATCCCTGAGGCTCACCCTCGCTCCCTTCCCGCATTTCAATTTTCCACT TGCAGCTAATTCAACAAACAGCAAATGTGCCAACCAGATGCACGTAATAG GACAGGGGAGTGGGGTACCTTCATAGGTATGCCATAGAGTTAAGCAACAT TGTCTTCATGGACGACACTCCCTTTCGATTCTGTGTACGTGTCAGCTCTT ATCTCCTTCCACCGGATTTCTTTTGTATGAATTTCATATTTTTATGGCTT CGTGGAAAGGCGAAAACTCATAAAATTTATAAAGGCACACAAATTTGTAC GTAATTACAATAAAAACCCATAAAATATATCATAAAAAATCCAAAAATGC CCATCGCCAAACGCACTTACAGGAAGCCGCGAGGGAGTTTTCCCAACAAA ATTTCTAAGTAAATTTATTATTATGACACAATTTTTATGCTCTTTACGAT TATTTTTTGTCGTGTGTCGTCAAATGGATGTGAATGGGTGGGTGGGTGGT TGTGTGAGTGCGGGACATTTGATAATTTATGGGTTGAGTTTTATTACGTT TGATTTGTTTATGTGGCAATTCCGAGGAGAGCTGGCCAACGAAAAAATTA TAATAATAAATAAGTTTGGCCTCATCCCAGCCGAGAACCCATCCCATTCA ATCTGATAGGTGTGCGCGTGGAGCGCCAGATTTCCTGTCCACGATTTCGT TTTATATTTCTGTTTATTATAGGAATAATTGCATGCTGCTCATACTAATG AAAAGGTTGTGGGTGTTCCTCAACTGTCAGTAAGTTAGCAAAGGGGGTTT CGAACGAGGTCTAGATCGATCATTTCGCGGAATTTCAGTTTGGGGTGCCT CTAATAGAAAATAAGAAGTATAATAAACCAAAGCAACAAAGCTGCTTACA ATATATGTATGTATATAAAAAGTTGTCATTCTTCATGTACTTCTTACATT TTATAGTATTGCATTCAGAATCCTATCCTAAATTGTTGAAATCCTGTTGC ATTCGTAGATAAATCCCAATATTTTCGCCATTTAACCATCTGCAGTTAGG GTCTTTCGGTTGAGAGTTCTTTTTCAAAATACGATTCGATGCATCAAATC GAGCATTCGATATGTTGAGATCCAAATAAATTGTTGACATTGTCGACGAA TGCTGGGCGAGAGGCCAACCTAAATGTCCTTGTGTCCTCCCGCCCCCTGT TTTGAAATAAAATACATCTGTCGCTGTCGTTGATGTTGTTTTTGTTGTTC ACTCTGCTGTGGCTGCTGACAAACTGGAAACCATATGAGAACAATAATGG ATTGGGTGTCCAGAGCAAATCCTAGAGATGCCGGCTACGTGCATCTTCCT GCTTCACGCTCAACTGCAAGCAAATGTGTGGGCAATAAATTATAAATTCG TTTGACTTCTGCTGCCAGCCGCCTGCTGCCTGCTGTTTGCTGAGAATGGG GCAGAACCGTATAGAAGGAGTGTGTGTCCTGCTTTGTGGCCCTTTTCTAT GGCCGTTATCCTTGACCGCCGCCCTCGCATTGAAAGCGTGTCCCTGGCAC CTACCCGACTATCTGTGTGTGTGTGTGTTTGCCCGACCATAATTCACCGT GACAAGCCAAAAACCATTAGTAAAGGCAATAAAAATGACAATAGAAGTCA ATTTCCATATTGTGTGTTCCAGTTTTCGTTACGGATTTTCCATTGTGAAT GTCCCTCTGCTGATGCAGTTTTTCTCCAGTAATTTTCAGCCACAGTCAAC GTTTCCAGCGCTTAATGAGCATGTTCCATAAAATTGAACAATATTCAAAA TGAACGCCCATAAATATGTCACATAAATCACACCGAAAGTGGTTCAAGAT ATTAGGGCAATCAACATACAAAAATTACGTCCACCCATCATCAGCGCCAT CAACGAAATAAACCGCCTGTTCTGGGTTTTCCCATACATTTCCGCCAAGG GGCGTGGACACTTAAATTAATCGATTAAATTCAAACTACCAACTGTTTGG GGAAAATAACGAATAAAACAACTAACTAACTATATTTCATATATAATTAT ATTTATAAAAAGCTTAAATTTTTATTACTCATATATGGTATTGTAATATT TTAATACATTCCGTATTTATTTTTAATAAACATGTCTAAAATGTAGTTTA AAAATAGATGAGTTTATTTGCCATATTGTTTGTTCAGCACTGTTGAGTTG ACACATTGCTAAGCATTTGTGTTCTGCTGAGCGAGATTTATACATTCTCT TAAAAACGAAACAAAAATTCCGTTGAAAATTAAAACTGTCATATTTTGAA ATGTTCTGTGTCATGTTTATTTGCTGCCATCGGATGTGCCACCAGTGCCG AGTTAAGTTTCAGTTGTAAATTGTATTTTCAAAAGAGTTTTCCTCTCGCT CCGGACAGACAAAAATAGCGCCAGGTCATGGAACATTTAGAAAATGAGGA GGCGGTACCAGAAACAAAGCGGGAAATAACTTTTTATGGGACTTAGGCCG TCTCGGGATATTTCCTTTATCGCATGCCTCTCCGTTCGATGGTTTTCGAT GGTAAGGGGGGCAGATGGCAGGCGGAGGTTGTGAGGAGATTTAATATTGT TTATGAGGCATCACCCAGTCAAAGCGAGAAGAATTAAAATGTGCAACGAC GCGAAGGAGGTTGAACTGGCATGGAAATGAAAATGCCGCCGCCAACATAA ATTATAGCATTTAGTGTGAAAAAATGTTTAAATAAATTAGTCTGCATGAG AGGCGTTTTGGGGTTTTGCGTGGCATTAAGGGATTAAAGCTTTGGAAATT ATAACATAAATAAAACCTAAATTTTTCAGTTATTAATCTTTACAGTCGCA TATTTCAGTCAAAGACTTGGCTGTAAATTAGTCAAGGTGGATATGAAATT ATATCAACGGGCTTTTTATAAATACTTAATGTAAATAGCTAACCATTTTA TAATATGGCGTACATATGGAAACAATTGACTAGGAAACCATAATTTTCAT GTCTTCATCGCACGGTTAGGACCTTTATTAAATCGGAATCAGGGTCACCG AAGTTCGTAAACAGGTTAATAAAACTGTCATGAGTGCCAGCTTAAACGCT GCGGGACATCATTGTCAGGTCAAGACCAGGACCTCGCAAAGGACCTGTGT GACATGCATGGACAATGAGGCAGCTGAAAGGAATGGTATTGCAGCAGGAC TTGGTCATAAATTGCCTGCTGTTTTCGGCTAGGATGATGCTGGGCCGAAC TTCTTCCATACTCGTGTATGTCGCCCAATAATAGGTGCCAATAAAAATTT ATTGCAGTTTGACCACCATGAAATCATCGTTAGGCAGTGACAGTTCCTGC CGCGTTCGGGTCACCTCCTCCTGCAACTTGAGAAAAGAGATCAGATCGGA TCAGGGGATGCTCAGCGGGAAAAGGTCAATGGAATCACCGCAGGACATGG TTTGAGACACGGAGAAGGTGAAGGTTGCCCCTGCCGCCCACATAACTTGA CTTCGGGCTGGCCTTCTATCGTTTTCCCCAGCGATGGCTCGTACAAAGCG CACACCAGCTCACTCGGCTCGTTTGTCACATTTAACAGATTTGTTATCCT GTCGAGTTAATGTCGGGCACACAAGTCCCGACTGCCCGACTGTCGCACAC ATGTCCTGGCACACCCTGCACCCTGCTCCCTGCATTCCGGGTCTTGAGTC CTGGCTGAGTTCTCGATTCACGAGAATCGCTTGACAGGGACCTTGGGCTG GCAATAAAAACAAAAGATTGATGGCATTGGGCACACGTTCGATTTGTTTT CCTGTTGCTCGACAGCTCGCCCACCCCTTCTCTCCGCTGGGGCATGTCCT TGTGCCTTTTAGTGCTTTGTAATGTCTTAACATTTGACACATCACTTGGA TTTCATTCCCGTACACCGGCAACAGCAGCCCACCCCGATATCCACTAAGG ATATTGCTCGTTAGTTAAGGTTTCTAATAAATTTGTGCAACACATTTCTT TCCTTTTGGGTCTTGTTGTTGTTGCTCGCCGCCATCCTCTGTCGTCGCTT GTAACATTTTTATTTGATAACATATTGCATTTGCCCTTTTCACGAAATCT TTTTCCTTTTGCCCGTTCCGTTTGGTTTCGGATTTCGAGTCCCCTCGACC ACCGCCTGTTTTCCCAGCCGTTTTGCTTGGTTTTCCTCTCTAAAATATTG GCTGGAAACTCGAGCCATCGTCTGGCGTCTCAACTGGAAGCCCAGTGGCC AAGTGATTTATGGCGTCTGTGTTGGTCATTCAACTGCATTTGATTTAGGT TGTAAATTGTTGTATATTGCGGCCGTCGCGTTTCGCTTCCTGTTTATGTT TGCTCCCTTAATTTAGCGCCCTTTTCCACTTTCGCTGCTCAACATTTTTC GCTAATGAATTTATGGCAGAATTTATGGGCGCGGTGAAAACTTTGAGGGT AAGTTGCAATTCGTATGGGCTCAGTTAAAAAAGTCACAGGAAAAGTCAAT TTTGATATTTTAGGAAGGTTTAACTTGCCAAGAATATACATTTTTTTTAT AAGAATGAAATACATGAAATTCTTAAAATAAATCTAATAATTTTCCTTGC AACCGTTTCTTGAATTATGGTAAAAGTCGAAGCCACTCTGAAGGTTCTTG TCATTCACGACATCTCTCCACCAAGAACAATAAATCTCGCAAATCTCACA GTCATCCAGTGATCATTAGGAAAGTTACACATTCTTTATTTTCCTGCAGC TTCACTAATTTTTCTACGGCTTTTTTGCGGTCATCAGTGGCTTAGCGAGA TGGAAGGTGTGAGTCATCTATGACAGGCGAATATTATCCTTTGGCGGGAC GAGAACGAAAGTGATAAACGATGGCGGGAAAAGCGAAAAAGCGAGCTGAG GAATAGAAACAGGAATTGGAAGAGGAATGCCAAAGAGCCTGACACTTGGA CGTGAGCACACAAATAACACTTAACACAATAACAAACAAACTTTTCGACT AATGACAGTCCAAGTAGCAAACAATTTATCGAATGCCAGAAAGGAGCAGC CAGCAGGACGAACACATACACCCATTCGCACTGAGAGTTCCTTTTGCCAA GTCATTAATCTTGTTTCGCTCTGGTCGATATGGCATGGATGGGGCACAGG GGAAGTCAGCGGGAGTCCCAATACCCGATTCCCAGCCATGTCGTCGTTAT CCTTTCAAGCGTGAACACATGCGATTACGTCTTGGTGTGTGTCCTTCTTG TTGCCAGTTTCCGCATTTTCCTGCGCCAGGCGGCTGCCATGATTAAGTGC CATTTTGAAAAGTACTAAAATCCTGTTGGTCATGGCCCTGGACCTCAGCG CCCCACATACACACCGTACCCACCGCTTCCTCCTCCCCGCCAAACTGGCA ATGTCAAAGTGTCAATGATATATGTTATACGCTCCGATAAGACGCCCTCT CTGCGGAGGTAAAAGGACCTGGGCGGAAGGACCTCTGGGTGGGTTGTAAA AATCCCGTGTTTCTGGCTCGACTGGTGAAATCTGTGCACGTTCGCACAAT AACATAATAGTTCCCGATTCTCCACCTTCTCTCGCTTCTCTTCTCTTTGA CGTTCGTAATTTTTCACCAGTTTTTCTCAGTGTCTATTTGGTTCTGCGCG TGTTAAAAATGGCTTGCCAATGACTTGATGCATTGCAAAAACAGTTAATA AAATACAGCATTGACACAGCAAGATAACACTGTAATAACTTTTCAATTCT TTTATGTATCTGGTTAATTTAAGTACAGGTGCCTTTATTTAACTGCTGAA TCACACTTGATTTATTTCAGTAATTGTTGTTATAAATGGCGCGACTAAGT GTTTAATTTAGTGCTCGAAAAGCGGTACCAAATTAATTAGGATACATTCA TTAAAACTCTTACTCATCGAGTTCCGGGTTAACTGTCAGGATTTTGATAT GACAATCATTAGAATGATGATTGATAATTAAACAATGATGTGAGTCATTT TGAGTCTTGTACTGTAACCGTTATAATAGCTTAAAGAATAAAAAACGTAG TTTCTTTTGACATCGTAAAATGGGTTTTTCCAGAAATTTCTCGACCTATG GATGATTGAAAACGTGTAGTTTCCCCAGTTCCGGCAATAGCCTCCAATTT GCCGTCGGTGCTGGTTTTTCGCCAGCTGTAAATTGATTCGGCAAAGGCGA AATCTCTCAAGTGGGTGCGAAACTGATCGTAAACAGCCTCTTTGCCCACT CGTTCCCACAATTCCAAGTACTTTCGATGTGATCGAGAGATCTCGTACCG ACAAGACTGATGATCGTATGCATTGGGCCATCTCGCAGCCAAAAAAAAAA GGCCAGCTGAGAGAGAAACGTAACCGGAAAAAATCAAAGGCAAAACAATG ATCAAAGCTGTCATTACAGATCGAGGGGCGGTCTTTGATCTTGCGCCGCA ATGTGGTTCAGTTGGGGGATTTTATGTTTTGTTTTTTATTTGATTTTCAC TTTGTTCTATCAATCAGCGCCTACTACTTTGCGACCGGCCGAGAGGCGAA ATGGAGGAGGGTATACGGTTTTACGGATAGGTTCCGTTCGGCCTGGGTTA TAAAATGATCTTGAGAGCAGCGGTGCGGTATGCGTGTGTTTTCCTTACAT TTCACGTAATAAAAACACATTAACAACAACAAGCAACACGTTAATTTCGT TTAAAAATAAAATAGACGAAATAATTGCCGACGCAGAGGCTTTCTCACCG TCCTTCGCCCACTAAGTCGTTGGAAAATCGCATTTGATGGATGATGGAGG AAGTCGTCGCTTCTCGCGCCTGTTGAGCATTGGCCAAGTTGTCGATTTGG GGGATTTGGAATGTGGATTTCTGTGGATTACCCGAGTCAGCTGCTGTGTA ATTTCGTGTATATACATAAAGGCATTTTGTGGATTTCCTGGAATTTATGC GGAATTTATCTTTGTTTCGAGCATTTTACGTGCTTAATTTGTTGGATTGT GATTGATCTTTGGTTTGGCGTTTTGCCGACGTCGGCATTTGATTAAAGGT GTAAATACGAGGTGTGATGGGATTGACGAACTGTGCTGTATTTTCCGAAA CGACTTACTCGCTGTATGTCATTGAGGTATGCAAGAATTTTCCATTTTTA AATTACCTAAACATTGTCAATTAGCTGAGATAAATGTAGTAGCCTTTGGA AACATTTCACTAATTTCTATTTGTGTTAATTAACAAATCCAGTTTAAAGC CCACCAAAATGTCAACACGGACAAAGAGGCAAAGCAAAACAGCTGCAAAT CTTCTTTGAAAATTTCCAACAATGTTTCTAAACCACAAAAACGTTTTTCA GGGCCTTAAGAAAGAAATTTATGGCATTTAAAAACCCCTTTATGTGTCTT CGTCAAACGCACTATCGCTACAAAATTAGAAGCAGACAGCGAAGACACAC AGAAGTTTTTCTATTAAAAATCACGTAAACTGTCGCCTTAATTTCAAAGG AATCGAAACATTTCAACCGAAGCCCCCAAAACAGCACTCCAAATAATTTC AGCTTAGGCACGATTCTTTGCCCCTAAAACATAAATAATGGGAGTAGAAG ATTCGGTCGCAACTCTCTATTCTGAGAACCCCTTTTTTTTCGAGAGGCGA AAGAAAGGGCTATCAATTTACTTTTGATGGCAGGGCCATCCACAAATCCT CTCGATAGAAACCACAAAGAAATCACACAAAGAAATTTATGTAATGCCTT CGCAGAAGCAGCACTGCTGGGTATCTGAATTTTACTCATCTTGATCTGGA TTCCGTGGCTACTGTAGCGCACAGTTTTCCTCGCCCATCGGCAGCGTAAC AAATTGTGAGTGCTTCTGTTGTTAACACGGTTAATAAATCACAATTGTCC AAACAAAAAGGTGTCGAGGTGAAGATATGACTTCGCTCAGAAATCCGTGA CTCGTCCCTTGCGCTCCCAGTCGCCATAGCGCGTGGGTTCTGGTCCCGCT TGTCCACCGATTTCCCCGGTATACGGATTGGTATTATTGGGCCACGGTTT AAGTGGCTCCTTTTCGTGGGCCGGATGTGGTGCACACTCGGGCAGTGGTT CTAGCGGCGCCTCCGATCGCAGCTTTTCCCGGAACGCAAGATAGCGCTTA CTTAGTTTTTCCTCGGGATTCGGTGGCAGCTCAACCCTCTGTCTATTCGC TGGTGTTTCCATTTCTTCGACATCATCTTTTTTCAAATTACTTGCTGCCT TTGCAAGAGAACATCGTCTTAGGTGTAATCCGCACTGGGAGATCAGAGCT CGACAGGATCTAATCATTTGGGGTCTTTATTTTTGGGCTGGTAAAATGTG TTACAGATTTGGGATTAGCTAAACAATTTCCAACGACGAAATATTTTTCA AATGGAGCTGTCAAGATTTCTTTAAATTCATATGATTACTTGTTTTTGTT TAATAAATCGTTATGGTTATTCTTGTTGATTAGTGTTTAATTATCTGCGT TGCAATCGGAAAACCCATTTCTTTCCATTTAGCAATTAGATACTTTACCA TTAAGTCATGATCCGTCACAAGATCTTTTCCCAAAGGGTTAGAGCCCGTC TCATTTCACATTTTATCCATTATAGGCGGCATTACCAACATGCTGTCCAA ACACCGCTTGACATGAATCCGCCTGACAGGCCAGATCAAATGTCTGTCTC CGCTAGGGAGCCTCAAAGTCTCAGCTCGAAGCCTTAGCAAAACGCTGGCT GAGTGACAAGGCTGACGGAGTCTAATGACTTTCAAGCAGCTGCCGCTGCT CCGCTGCAACGGAGATAAACTTCCGGAAACGAGTAGCTGTCCAAGGCAGT TAGCCAGTCGGGCTGTCAAGTGAGCGCGTGCACTGAAAGAAATAATTAGT AAATAAGTCTTATTTGTGACTAATGTGGTATCAAGATGGAGATGTGTATC AATTTAAGTTTGTCCTGTACTTTATTTAAATAAATGTTTTTTTTCTTCTG TACATTGTTTTCTAAGTGTGTGCGAATAGAGTTGCCCCTTCTGTTACCGT TCATTAACAATTAAAAGTAGGCAGACAGCATCAGCATCTGTATCTGTATC TGGATCAGCATTAGTCAGGCCGTCAGATTGGCGGGCTTCATTTGGGAGGC TTCATCTGGGATCAGAGCATGCTCCGATCGTGTCAAGCCCGACATGAGTT GAAATCGCGCTGCAGACACCTCTCGCTGCTGCGGTGCAACTTCAAAGCGT TTTAAATATGGCTTGGGCAGGAATCAAGGAGTCGTCATCATGCACAGTTC ACAGCAGCCAGAGCAGCATTCTTCAGATCCCCCGATCTGTCGCCTGTCAC TTGCATAGCGTTCTCTGCAAATTTGTTCTGCAATCCAAACATCCCACTCG GAAATCCCGCTGCCAGTGGCAAAGAAAACATTAAAAGTTGCCGGCTCGCG GCTGTCGGGAGATTTGCCATGCACTCGCTTGCATCATTGCCCCGTTGGTT TGCTCCGGTTTGCCCAGCAACTTTCTCCCCTTCCCGACCTCTTTTCATTT TTTTGAGTCAGAGATTCTTGGATTCACAGATTCTCGATTCGCTTAATTCG CCCCCCTCATTCGGCATCTTCATCTGTCAGCTGGCACTGCGGGTTGTCTA CGGTCGAATTGAAACTGCTGCCTCAACGTCGGCATGACAATAATCTCGCA AATCTGTTTAAATTAAGCGAGACAAATGTTTCTTTCTGCCGTGGTATATG TGACCAAGACAACCGCCAGACATTCGGACCAGTTCAGCTTGTTATTGTCC TCGTCCTTGAGCGGATTTAACTTTGTTGGTCTGCGGAAGTTTTGCTTTAT TACACATTGTTGCCAACAAGTAACGAGTAATCAAGTTATGGGGAAAATGT TCAATAAATTTGTTGTTATCCTCTCAGTTGAACAAAGTGAAATCCATAGT TCAAGAAAATTATTTGTCCATGGAATAACGTGTACTTTATTTGCCGTTTA GGAGAATTCAAATAAAAAACAAACTATTTCTTCGGATAGATATCTTACTA TATATATTTTTTTGTAATAATAATAAATTGAGCTCAAAAACCCAAAAATG TAAATTGGCAAATATTTGCGAAATAAATTTCCTTAAATTGTAATAATTTA ACTTTCTAATTTTCAATTGAACCTCATCCGACTTTCATTGAATACAGATC TTCATAACTCAGCGAACAAATGCTGTAAACAGTTTTATATTGCAAACAAA GCGATGCGAAATTCACAATAATGAAATCGTATAAAAAATACGCGCATTAA AAAGCGAGAGATATCGAAAAATTATTCCCTGTGTGTGCTGCCTTTGATCA GCCGTCAAGTGGTTTGATCGATATCCACAATAATACAAATCCACCGACAA CTTGTCTATAATCAAAATCGCTCTGGGAATGCTGCTGCTGTTTTTGTGGT AGTCAGCATCCAGCATCCATCAATCACAATGAAAAGTTTTCCCGCACCGA CTGATCTGGCCTGCCAGTTCTGGCTGCGCCCACCCATAAATTTGTTTGAT CCTTCTTAGCCGGATTTTACGGAAGAATCGAACATTTTCACACAGTAATA AAAATCTCAAACATGTTTGTAAAGTTGTTAGTGCCTGGCTATACGGTGGC TGGCAGGCCTCTTTTTTTTTTCTTGGCTTTTTCATTCTGCCTTTCTCGAT TGTAGGCGGGAGCTGAACATATAAATTAACATTTTGACTGCCAACTGGCG CGGCAAATGATCAAAGACACACTGGGCCGTCATCGTTGCGTTGATCATCG TCATCATCGAGAGGAGCAGCAACAGTGCGAACATCATTCCACGTTTACGA TCCATCAACACGAGCCATCAAATTGTATACAAACAAACGCAGCAAAGATC AAAAGCCACGTTACCTACCCACAAAAAAAATCTGTGCCTTTGGCCGCGCT GCCTCGTTTTTGGTTTTTCTTGCCGGCTATCTCTCCGATTTTCCCTGAAT TTTCTTCCAAATCTAGCGACCGTGGCTTCTCCACTTGGCTGCAACTGGAG AACGATCTCACTCTTCTGCCCGGCTGCATATTCATTTTGAACACACTCAC CTAATTATGTGCCGAATACGATTCTCGTTTCTCATGTTAATGGGGCAAAC ACATTCTCTCATTCATTGTCTGGTAAATCATCATAATGATATGAATGAAG ATGCTGCTGCCGCAGCGGATGATGATAATCAGATGGGTCGGGGGTTAATA GTAGCGACTATAATGGCAAATAAAATAACAATTAAAACCCTTAGGTCATA ATTTAAAATGAAATATATGTTTTCTTACAAATTGTTTGAAAATCGGAGAC TTCAAAGCAGAACTGTCTTAAGCCCTTTGCAGCCTATTGGGAAAGAAAAC AAAGTGAATTTATCTTTAATTTTTAAATAAGCTACCTTAAGAGCCCCAAA AAATCCATTTACTTTAAGTAATTGATCTAGGTAACAGATAAAACTTTCCG ATCGAGCCATAACCATAAGTTAATTTTAACCCTGCTCAAAATATGTATAT CACGAATCAGAAATGAAAGGCGAGTAGTGAGTGTCATAACACCATCAGCC ATATCAAATGTCACCAAATCGTCAGAAAGCTGCAAATTTATATGTTGCCA CATCCGGGGTACCGTAACATTTTCTGATTTAATGCCTCTGAGCGGCATGT CAAATTCAATTTTACCCCTAAGAGCCGAGACAACGATGTCAGCTCAGCTC AGCGCTGGCCAGCCACCACCAGTCGGCA