##gff-version 3 ##date Fri Jun 14 18:01:04 CEST 2024 ## exported from the transgeneomics system molecule_59047340 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59047340 mpicbg region 9631 24687 . + . Name=dmel-5.43-3R;type=genome;start=25882275;end=25897331;strand=- molecule_59047340 mpicbg region 24688 24760 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59047340 mpicbg region 24761 25749 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59047340 mpicbg region 25750 48059 . + . Name=dmel-5.43-3R;type=genome;start=25859965;end=25882274;strand=- molecule_59047340 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59047340 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59047340 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59047340 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59047340 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59047340 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59047340 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59047340 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59047340 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59047340 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59047340 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59047340 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59047340 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59047340 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59047340 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59047340 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59047340 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59047340 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59047340 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59047340 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59047340 coding_transcript gene 16731 18554 . - . id=50414900;Name=CG31031;identifier=FBgn0051031;ensembl=FBgn0051031 molecule_59047340 coding_transcript gene 23109 24387 . - . ensembl=FBgn0260468;alias=Dromel_CG7950_FBtr0085563_CHCHD4inmorf_mORF;identifier=FBgn0260468;alias=CG7950;id=51007708;Name=CG7950 molecule_59047340 coding_transcript gene 23109 24387 . - . identifier=FBgn0085346;Name=CG34317;ensembl=FBgn0085346;alias=Dromel_CG7950_FBtr0085563_CHCHD4inmorf_uORF;id=51247972 molecule_59047340 coding_transcript gene 24637 26345 . - . identifier=FBgn0039744;Name=CG15526;id=51189693;ensembl=FBgn0039744 molecule_59047340 coding_transcript mrna 24637 26345 . - . Name=FBtr0085562;id=51189698;parent=51189693 molecule_59047340 coding_transcript exon 24637 26053 . - . parent=51189698 molecule_59047340 coding_transcript three_prime_utr 24637 24684 . - . parent=51189698 molecule_59047340 coding_transcript cds 24685 26053 . - . parent=51189698 molecule_59047340 CLC misc_recomb 24761 24794 . - . Name=FRT molecule_59047340 CLC cds 24802 24873 . - . Name=BLRP molecule_59047340 CLC cds 24874 24894 . - . Name=TEV molecule_59047340 CLC cds 24895 24918 . - . Name=Precision cut site molecule_59047340 CLC cds 24919 24960 . - . Name=V5 molecule_59047340 CLC cds 24967 25683 . - . Name=SGFP molecule_59047340 CLC cds 25690 25749 . - . Name=2xTY1 molecule_59047340 coding_transcript intron 26054 26134 . - . parent=51189698 molecule_59047340 coding_transcript exon 26135 26345 . - . parent=51189698 molecule_59047340 coding_transcript cds 26135 26166 . - . parent=51189698 molecule_59047340 coding_transcript five_prime_utr 26167 26345 . - . parent=51189698 molecule_59047340 coding_transcript gene 26257 27606 . + . alias=Spn-A;identifier=FBgn0003479;alias=Spindle-A;alias=DMR1;alias=DmRAD51;alias=Dmrad51;alias=rad51;alias=DMR;alias=RA51_DROME;id=51139179;alias=D37788;alias=spindle A;alias=CG7948;ensembl=FBgn0003479;alias=spnA;Name=spn-A;alias=Rad51dm;alias=RA51;alias=Rad51-like;alias=DmRad51;alias=Rad51;alias=Dm Rad51;alias=RAD51;alias=spindle-A;alias=dmRAD51;alias=DMR/DroRAD51 molecule_59047340 coding_transcript gene 27605 29788 . - . ensembl=FBgn0039743;identifier=FBgn0039743;id=51190575;Name=CG7946 molecule_59047340 coding_transcript gene 30190 33667 . + . id=51190628;identifier=FBgn0039742;Name=CG15528;ensembl=FBgn0039742;alias=MKP-like molecule_59047340 coding_transcript gene 33637 35827 . - . identifier=FBgn0039741;Name=CG7943;id=51189762;ensembl=FBgn0039741 molecule_59047340 coding_transcript gene 36144 37073 . + . alias=Ribosomal protein L32;alias=Rpl32;alias=ribosomal protein L32;alias=rp49;alias=BcDNA:RH03940;alias=CG7939;alias=Rp-49;alias=RP-49;alias=r-protein 49;alias=Rp49;alias=Ribosomal protein 49/L32;ensembl=FBgn0002626;alias=RPL32;alias=rp49/RpL32;identifier=FBgn0002626;alias=Rp49/RpL32;Name=RpL32;alias=L32;alias=M(3)99D;alias=143250_at;alias=bs30a02.y1;alias=Minute(3)99D;id=51390167;alias=RP49 molecule_59047340 coding_transcript gene 37411 38956 . - . ensembl=FBgn0003512;alias=anon-EH8;alias=sry;alias=Serendipity delta;alias=CG17958;identifier=FBgn0003512;Name=Sry-delta;id=50451804;alias=Sry-delta;alias=Srydelta;alias=srydelta;alias=serendipity delta;alias=sry delta;alias=Sry delta;alias=EH8;alias=serendipity-delta;alias=sry-delta;alias=Serendipity delta molecule_59047340 coding_transcript gene 39216 41087 . - . alias=sry;alias=sry-a;alias=serendipity alpha;Name=Sry-alpha;alias=Serendipity alpha;alias=serendipity;alias=sryalpha;ensembl=FBgn0003510;alias=serendipity-alpha;alias=Sry alpha;alias=sry-alpha;alias=Serendipity alpha;identifier=FBgn0003510;alias=Sryalpha;alias=srya;alias=Sry-alpha;id=50718359;alias=sry alpha;alias=CG17957;alias=ser molecule_59047340 coding_transcript gene 41271 42570 . - . alias=Srybeta;Name=Sry-beta;ensembl=FBgn0003511;alias=serendipity;alias=Sry-beta;alias=Serendipity beta;alias=srybeta;id=50393607;alias=sry beta;alias=sry;alias=sry-beta;alias=sry-b;alias=serendipity beta;alias=CG7938;alias=sryb;identifier=FBgn0003511;alias=ser molecule_59047340 coding_transcript gene 42765 43685 . + . id=50677785;ensembl=FBgn0001280;alias=jan;identifier=FBgn0001280;Name=janA;alias=janus;alias=jan A;alias=janus A;alias=BcDNA:AT12574;alias=CG7933;alias=Y;alias=janus;alias=Jan molecule_59047340 coding_transcript gene 43564 44322 . + . id=50677740;alias=janus;alias=Jan;alias=bs30f02.y1;alias=jan;alias=janus B;identifier=FBgn0001281;ensembl=FBgn0001281;alias=CG7931;alias=janusB;Name=janB;alias=jan B;alias=CG31024;alias=janus molecule_59047340 coding_transcript gene 44572 45307 . + . Name=ocn;alias=bs29e10.y1;ensembl=FBgn0041102;identifier=FBgn0041102;alias=CG7929;id=50814670;alias=BcDNA:GH02250;alias=Ocn;alias=Ocnus;alias=ocnus molecule_59047340 coding_transcript gene 45456 47262 . + . identifier=FBgn0039740;id=50973616;Name=CG7928;ensembl=FBgn0039740 ##FASTA >molecule_59047340 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACTTGCTTGTTATGTTGATTAC ACAACTCGTGCGGGCGTGGGAGCAAATGAAAATAAAGTTCCCTAGCCCGA CTTGCACTTGAAATCCACGCAGTCAAGTCTGAGTAAAGGTATTACACTCA ACTTGAATACAATAATTCCTTGCTTCGTTTTCAGCCAACGGTCTATAGAA CTTTGAGTCTTAATGATTCCTCTTCTTCTGTATCTTGGGCTACACGTTTG CAGCGGTTTAAAGTCACCTCGCGTAGGCCATCACCGAAAAGTATGCAACA CTTGGTGCCACGCCCCATTGGTACGTGCCTGGCCAGGATCACACGCCCTT TCAACCCACAACACTCGCGCCAGCACAACTGTCAGCTGCCCTCTCGGAAA AGCTGGGAAGGAAACAGAAACTAAAAAAAGGAAACTTAAACAGAAACAAA CAGCGGGAAACTAGCAACTGGCTTGTGGCAAGAGTTGAAAGTTGAATGTC TGGCAAATGCCGCGGCAATGCCCCCAGAATGCAGCGCCAGTGGAAAATGC ATTTTCCGAAGGGGAACTTTTCACACGCAGCGCCAAATCTGCCAAAGCCA CTTTTCGGTATTGTTTTTTGTTGCTTTCCAAAATTTATTGCAACACTCGC TGGAGGAGCTGCTATACTTCACCCGCACTTCCATCTCCATCTCCATCTCC AACTCCACCTTCATCCCTAAAAATCCAAAGCGATGCTGGCTTTATCTCTT CGCTGTCTGTCTGTCAGAGGATATTTATCTGGCACGTTAAGTTTACTTTT GCCCCCTTCGATCCACTGCCACTTTCCTCGAACATTTCCCTCGCTTTCCA CCCGCTCGTTTCATAATTTTTCGCCTCGCGGCCAAATTGTCGTCTTTATT TGCAGCATGGAAATGCTCGAGCGCAATTTCCCATTTCCATTTCCATTCCA CTACACACACACACACACACACACATCCGAACGGCAAACACTGCCCGATG CGAGATTTTCCCGCATGACATTTGCGATTTTCCGCACATTTTGTACTTTA TTGAACTGTTTGTCACATGACGTTTAGTATTTTGCGAGCTGCGCCAGCTG CATGCGAACACAACCCACATGCACAGCATGAAAGCGGGAGGAATCGGCTA GGATTGGGGAGAAGTACTCCTCCAACTTGAAATCGGATGAAACTTAAGGG AGCCTAAAAGTAACGAAGGTACTTGATACTTCCCCTAAAGGTGTCTAAGA GTATGCAACAGTTATTTGACATTCATTTTCCGATTGATACGTAAGTGCAT TTTATAGCAGACCATCCTTTGGTAATTCCACTGTACCTTCCATCACCATC ATCATGCTCGAATTTTAAGGGAATAAAAGGGGAGGATGGTTGAAGCTTTT AAGGATGCACTGCACCAGCTGACCCCCTTATTACAAAGCCATGTAAACTT GATGAAAATCAAATGGAAATAAAAACGGACAGCACTCATAAACAATAATA TTGCGGGCAAGCTTTCGCGAACGGAAACTTTTTGGAAAAGCGGGAAAAAG GAAACTTCCATCAGAGCGGCGAAAGCAACTTAATAAAAACAAAAATGTAT GAAATACTTTTACGACTTTCGAAGACATTTTTACAACTTGCTGGCAAGTT TTGCTAACGATATGCGAGATGCACACAGAACTCGGGATCGCCAGCTGCAT CCTAGGACTCGAGCGTCCTGGTCAAATGGATACGTCGCATCATAAAACCG AAAGTCATTTCGCGCAGAACGTGTCTACACGAAAACCAGGAGCGGGCGAA TGTCCGGCCAAGAAGCCAAAGTCATCGCAGCCAATAATAATTCCAATTGT AGTGCAGTGACAATTTTCTGTTCCTTGGCTGCAAGGATGCGCTCTTTTGG GCACTTTTGGGTACATTGTACCCCGAACAATGGTCAGCAGAAGACTTTTT ATTGCCCAGCGTTGGCATTTTAAGTGCAGCCAGCCAAGGAGCACCATCGT AGCTCCATCGCCGCTCCATCGGCAGTGGCAACATTATTTGGCCAATGTAG ACGACATGACGCGGCCATTAAGAGCAACAAATAAGCAAACAATAACAAGA AGCCGCACCCGATGAGCTGGGGAGAAATTAAGAAAAAATGCTTGCAGCAA ACACTTTCCCACTCACACTCTGCAATCGAAGATGTGGGACTTCATTGCAC GGAAAGAAATAAGAGGTCATTTAATATCGAATTGACTCCTCTCTCTCTCT CTCGCATGACATTCATAAATTACAAAGAAATTACAAAGAAACTTACTTCA AAGTTGCTAGTTATCTAGCCAATATATATCACTATTTTCGTATTGTTAAG TGCCACTGGCATAATTCCTTAGCAAATAAATATAAATTCTTTTTTGTATA GAGAAAAGTGAAGATACAAAAAATATTTGCTCTCTATGGTCAGGCCATTT ATCTATCGATCTGTTTGGATATTTCGACGCGGTAACGATACTTTGGCTTA TGAAAATTGATTGCAAATGAGCTGGTGGCTTTGGCGCGTCTTCCATTTCT AAGCAAGATGGGTGGGAATATTTCTCTTGTGGCATTGCTGATAGTGAAGC AATAAGACGTAGCTGGATTATACAGATTTACTAGCTCAGGCATACGATAT GAAATGGCGAATAAATAAACAAAAAAACAAAATCTAACATAATTGAATCA GCAAAAAACTCGTTGAAATGAAGAGATAGAGGAGATATGAAAGTGCAGAT AGCGATAGATACAGAGATTTCAGCTGTCTCGCTGCCTGACCAATTCGTTT ACTTTCGCAAAAGCTAATTAGCAACTAAAGTGAAATTAAAGCAGAGCCAA GTCAAGCCAACGACTAATGGTCTTTGTGTTGCAAAAAAGTGGAAAAGGGG CAGACAAGAGGAAGGTGCTACAACTAATTAAATGCAATAAGCTATGGCAA CTGCTGGACGTGAACAGGAACTGCTTGGGATTCTAGGAGTCAGGATGCGG AGCAGAGCACAGGACAGGTAACGCCGCCGGACGAGTGACAACTTTGTTTT GATGTGCCGGACTCTTCCGGCTTCCTTCCTGTCCTCCGCGTCCATTGCAA CCCACCAACTAACGACGAACGCGTTTTAATTTGCACATTAAAGTAATTAG TTTAGCATTAGTTAGCTGTAGTTTGTTTTAATGAGTCGCGAGTTTTCGGA GTTGGACGATGCCACTTACCGCTCTTGAAGGTGGCCATCAGGCGTTCGGA ATCTGCTCCATGCTGGCACGAAAACAAAGAGGTGTCAAGTAGATCCTTGG GCGAATATCCCAGTAAGTCATGCATCCTGAAATCAAAGCAGGGAACAAAT GAGAATTAATGTTACTATCCTCTAGACGGGTTCCCATTTTGATGCTTTTC TAGGCTGCTTAATATGTTTACGTAATCTATTAATTTGTGCTTGTTCATTA TGAGTAAGTAAATGATAGTTAAGTGCCACTTTTGGCAGAGCAATTAGTCA ATCCCTCAAAAAGAAACCTAAGCAGTTATGGTTTTTAAAATGGGATTTGC GTCTTTAATTCTGTATGTATCTCACTTGTCATCCACATAGGTGAAACGCA TATCCAGGGAGTGTTTGGTAAGGAAGGTGCTAGTTCCCAACGGAATCTCA ATGTTCGAAGGATGCGGAATTGGTCGGCCAATGGCCATCAGCAGACGTTC GCCCTTTGCATTGACCACCAAGTGTCCCGTGATGTGAATGACCTGAAAAC CCCAATAAGGCATGGGTTAGTTGGTGCTATGGTGTCTCAAACTCATTTAG CTCACCTTATACGAAGCGCTCTTGATGTTGATGCTTCGTCCACGACTGGT CAAGGTGCACTTCAAGCGCACAAACAGATCCCGGTGATGGGTGCTCACTC CAGAGTTCTGCTGCGGCTCATCCTTGACCTTCTGGGCAAGTTCACGCTTT AGGCTGAGAGCCTCCTTGATCTCGGCGTGATCGCACTGGTGCGAGTACTC CCAGATCTGTTGGCCAAGTGTGTCAATCTGCGCAAAGTTGAGAGCAAGTT AGAATCTTCTTCAATGAAGTATTTGGATACATTTACCTTGGTGATGCCCA GATACTCGACTACGTTTTCGGACACGTAGGTGATGTCTCCCTCGTGGGAC AAGACCAACAGGAATCCGTCCATGGTCTGTTTGAGGAGCTCTCTGGCCTC AGCTCCGTTGAGCCAATCCTCAGTGCCCACTTCCAGCTTGGGCTTGACTT CCTGCTGATCCTCTGCAGTTTCAATGTCCTGCTTGATGTCATCATTGCAG TCGCGCAAGCTGGGCACTGAAATAAGTAATATATTAGATGGTGCTAACAA AGATTTCACATCCTAAGGGAAACTCACCGAACTGCAGCATTTCGCGAATC TTGAGGAAAGCGATGGTGATCCTCATCACGGAGGCCTTGTCCAGTTGGTT GACATCGTCGGTTTTCAATGGCAAAGCAGCCGAGAGTTCCATGAATATCT CTGTCTCCTTGGAGCGACGACATCTAGCCGCATCGCGAGACTTTTCCTTG CGTTTTTCATTGTTCCTGCAAAGATCGATCGGATGGAAAATTAGCATAAG CTCAAAACGAGCACGTACGCCAATGATCAGTGGGAAAAGGGGGGATCTAG CACGGGGGAGGCTGCCTGAAATATGCGTGCATTTGCATGGCTGCACTTTT ATACCCGTTTGATTGCTTCTGATTCAATTCACGCGGCCAGAGCTCGCAAT TTTTCAATTAAGCAAAACGCTTGTAATTTTCGCGTTTGTTGCCAGGTCGA GCGAAAAAACAAAAGTCGATCGACACGGCGCCAAAGTTCTCGGCAGCTAT TCCTAGCCGTCTTTTCGAAAAACACTAACTAATAACAAATAAATAAATAA AGATGAAGATCAAAGTAAATGCTGGTAATCAAAATACTACTGCAGAACAA TAAATTATATTCAATTCTAATAAAGCCTCATATCTGAAAAGAATCTCAAT GTCGCGACTTTGTAAAAGTATTTTTCTTTTCAACGATGCTGATAAGGAAT TTCTACGCATTCCTCATCTACAGAGTCTTAAAAAACATTCGAAATAAATC CAATATTGCCTAGAGGATCCTGACATACAGAGACGACCTCCCTTGGGATG GATACCTGTGCATTCCGAGCTGGCAGAAGAGCCCGGGGACTTAGATAGTT TATAACGTCTGTTTCGGATTCCGAGAATAGCCGGCAGTCACACGTTCCAC TGATAAAAAGTGGCTAAGTTGCCTTGGCACCAATTTTCGTGGTGGTGGTC TTTTGGAATATTTCGCCAGGGGATTGACAAAACACCGATGATTTGGCAAT TAGCGACTCTGCAGAGTTAGTTGTCTTCGCTGGATGAGTAAGTCCCATTT AAACCCTGGGTATCGACTCGTCTACATTGGCGACGTGTTTTAATCGGCAA CCAAGCAGGCAAATCGATCGTACACACTTGTAGGACGACAGAGCACTGAC CTCACACACACGACTGACACTATCTTTATGCCAATACGAGTATATTGCGG GAAATTCTAAGAAAAGACGGATGGCCCTCCCGCGGGACTGCGGAAAAACT GTAGTCTGCCAAGAAAATCTCTTGAGTAGCCGCATGCAAGAACATAACTC GTGGCTCTTAATATTTTCTTTATTATCGATATAGTGGGCGAACTTGTATA ATCCACGGGTGACGCCCATTTCAGCACGTATGTACATTTATTTCCTGGCA TTTTGTTCAAAATTTGCCAACGCTGCTTTATTGATCCGCTGGGATGAAAA AAGACCTGAACACGTCAGGTGGTTCACTTGGGAAAATCTGCCCGGTAACA ACGCGAAAATATCAAACTTTTTTGTTAACAAACCCTAAGTACCGCCTGTC AACGGAGGAGTCGCAATCATCAAAAGTCCATCATATCAGCCGACAAAGTC ACAGTACAATATGATCTATTGTCAGTCTGCCGCCTGTCTAATAATGGCTT AAGTATCTATTAAAAACAGTATTCCCGTTTTCTTTTACTGTAAGTAAATA AATTGAATAAATCGAAGCAAACTACTTAGTTGTTGAACATAATCTTCTAT TATGACATATTTAAATATGAGATAGGACCCCACTAATCGATCGATTGTAA ACAGAGGAAATCTTAACATAAACAAATGCTAAACTTGACTTTGCACTCGA AAGAATTTCTATTATTAAAAGAGTATTCTGAACGCCCAGATAAAACGTTG ATTAGGAAACTCTGTGAAAGTGAAGAAACAATGCATTCAAATAAATCAAA AATAAATAAAACAGAAACCAGTTTAGATAAGAGGGCTTTTCATTGTCAAT CAACCAACTGATGGATGGAAACCAAAGTTTGAAGCGAAACTCGAATGGCT GCTCAAATAATTATTATATAGTATTATATTACTTCGCCAGCAAAGTGAAT ACTAATATAGGCGTAGACCCGTGGATTTCTATATATATTATATATGCATT AATAAACACAAATCCGATAGTTGCTAGCTCGTGGCCCATAGAAAGCGGCG GAGAGTGACTTTGAATTGCATGCTAATGGCCTGCTTAAATGGTGGGATAT TCGCCGGGGGGGTGGGGTTTTGGTTTGGGAGGTATGCACATACATATATA TATTTTCGATCGGCCCCATTGTCTGTTCATTAGAACAGAGGCAAGTACGG CATGTTAAATATTCTGCCTGCGCCAGCAGAATTGCCTTGTTATTGCCGCT GGTGCTGCTGCTGTTGTTGTTGCTAAGTATTTCCGCTCCAAAGCAGCTCA AAACACTGAACAAAATTAAGCTATAATATTGAAAGCACACCTTAATATGT GTACTACCCTTCCGTATGATGATTATAATGATGTAGTATGCTGATCTTAA GATACCATTTTCCGCACTTTGTGTATGAAATGAGTTTGAATATGCAAACA CCACGATCGCCGCACGTGGCCATCTAAGTCCTGCTGGCTTATCCGACAAC ACCTTAGGATACTGACCCGCTGTTGTTTGAGTTTGAATTGCGAGCATTGC GAAATGTTGGCCAAGCTACCTCCAAGTGCGCCGTATCTCCGGGCGAGATA TCAGCGAAAACACATAAAATACGACTCGAAGTGCTAATGCCAAGTTCATG GGACAGTAAATCGAGGCGCAACAGCGGGTCAGGGATGTTTGGTCTCTTCT TGGGAGCACCATATTGTGGGTGGAGTTCTTCGGGCAGCGCCGTCCTGCAA TTGCGTCAGTTTGGTTTCGGCTCATTAGCATGGAGATGGGCCAGCCGAAT TTGGCTTAAACGTGTGCAAAACGTAAATAAACCAAATCCGACTACCATTA CGAAAACATTTGCTTGCTGCGCACGTTGCATGCAAAGTTTTCAAGGAGGT GAAGTCCAGGGAAAGGGGCTGTAATCTGCGTCAATCGCCAGATAATCGTA TACATCAACCAGATGGATTGTGAAACCTTCAGCAGACCCCTAACGATAAC TCCTTGGGAAATACCCCACATAAAATCATCGGCGGCAGATAACAATTACA CAACAGCACAACTGACAAGCAATTTACTATTTCCACGCAACAATCGAAGT GAGAGAAAAAGTCTTTTCCAGCCCACAATCTTATAAACGGTACCTCTCTT GGGAATAACCCACCGAACCTTGACTCATACGACACCTCTCTCGCGCCATA GTTCCGTCCCCCTCGCCCTATCTTTTGCTGCGTATCTAAATATTATTATA AAAGCGATTCACAAATAAGCATAGATAAGTGCAGCGCCGTTTGCTTTCGG CTCGGGTTTTACAATGGAACACGGCCAATTTTCTAGGAGCTCAGCTCGTT CAGGTGCCTCCAGGAAAATGTAAATCGCTAGCGGCATTCGGCCACCGATT CTAACTGGTTTTTGTTTTGTTTACTTGAATGAGCTAGAGCTCTCCACAGT TATGTAACAACAATTATTAAGCAAAATTGTGTAAATATTCGTACTTGAAT ACTATTTGATAATGAGATTAAGGAATACCCTTCGTGAAAAACGCAAAATC ACAGAATTACCCAAAACAACAAATTGACCAACCACTTTGGTCGTCACTCA CATGAAATCCTCGATGTCGACAAACTGGGAGAACTGGCAAGGTTGAGTGT TCGTGGGCGCGTAGCCATAGCAGTAGGCGTAGCTCCAGGGGCGGCTTTCG CGACAGGGCGTGGCCACGTTCAGAAGCGATCCCCTCTGGCGATAGAAGGC GTCCTGGGGCTGCTGCTGATGGTACGGATGGTACCTTTGCATCCCAGTGG AGGACATATTGGGGCCGAGCATAGCGCCCACGAAGGGTTGGCTTCCGGGA GCAGGGCCATTGTAGAATGACCCGTTGCCAAAGTTCACAGTGGGTTCATT GATGGGCATTGGCCCAAAAGCTGGGCCATTTCTGCTCAGCTGCCGCTGCC GCTGCGGCTTGGAATCGCACTCGTAGAAACTAGAACCGGGGATCACATCT TCGCCGTAGAACGAAATGTCGCCGGTACACGAAAAATCGCAGCTCTCGAA GGAATTAAACATTGAGTGCGCTGGAATCCGGCTAAGCCCATCGATGATGA ACACACACACGCGTGCGATAAGAGCTGATAGTGTTTTGATTTGGCCACAA CTTCACTGCTCCGGATATTTTGGTAGAACACGACGTACGGGAGTTCGAGC GCTAAATGAGCGAAAGGTTCCATAGCCTCGAAGCCATCATATTTATACCT GGGCAGCCGCACCAAAAAAAATCGCAAAAGAGCGGAGAGCCGACGTGAAC GTCATATTCCGTGTGCTATCAGACAAGTTTGCCTATCCGGACAAGTGCGC TCCGGCCGGAGTGATAAGATAAAGTCCGGTCCGCCCGCCTCGTAGAAGCA TTCAGGTGGCAGGGAGCCAGCGCTTCGGTTCTGCCCAATGGGACGATAAC AGCGAATCGAGTGAGTGGCGGATTCAAATTAGAGCCATATAAATTATGTC AGTGCGCCCCACTTCAGTCGATAATTGGCTCGGACCATATAGTCTACTTT GCAGCGACGCCGGAAAATTTCCGCACGTCCAGGACCCATTTTCCGCCCAT TTCCCTCGCTCACAAAGTGCAGTGCACGGCAAAGTCATGTTATAATTTTA GAATCTCTGCACCGAGAAAACAGTGCCACTCACTTCGAAGTGAAAATTTG ATATAATATTCCAAAATTTTGAGTATTTAACCGCAGAACTGATGAACCAT TTTTAGGTATTTCGAAAACTAACCAAAATTCGCACACACAAAATGAGAAG AAATATTAGAGAATTGATCTTTTTCACTGTGCGAGAAAAGCTGCTTGGAT GACTAAATACTATCAGACTTATCCATGATTTCCCTAGTCGGCCGATAAGA ACTATAACATAGGAGTTAAATATTTGGATTAGTTTGGCAAACAGCACGGA AAGTGAAACGAGATAAGGGAAGCTAGTTCCCCAGACCAAGCAAACGTAAT CAAATCGCAATGTAATCAGCTCGTGGAGAAGGCAAAGGAACAGGCAGGGT CAACTTAAATCACTACGATAACCCCTTGTTTACCTGTTTATGCTACACCC GTCTATCACTAAACTATTTCGATGTTTAAATGTATTTCATATAAAAAAAC AGTAAAAGTAGTTATTAACATTGTGAGCTTCTTGGGCTTCTCTTTTTGCA GATTGCCAGGAGTCCTTGTGATCGTTAGCTATGGTCTCATCTTGCATCAT TCAAGGACTATCTTATAGAAGGTCTGTCAATCCTTTAGGTTGCTACAGTA ACACCCGACGACGACCAATTAATTCGAAAGATGTCGTAAGAAGTTCATTG AGTTGTGGCAAGACCAGTGGTTAATACTTAATCCAAAGGAATAGCTGTTT ACAACAGAACATCGTAAAGATCTTATCCATTCCCAAGAAAGAAGTTCCTT TGTTCTTGTTAATGTTGTTAGCAAAAAAATGACTTCCAAACAGGTTTCGC AATAATCTTAATCCGAAATTTTTGCTCATTTCACAAAACCTGTGGGGAAT TTTCAGCGACTGATTCCAATTTATCGCCTTAAATATAAATTTAAACTTTC CCTGCCAGCAATTGCCGAATCATAACTTACACCGAATGCGATGCATATAG ACCTCACACGCAACTGAACAAACGAAAAAGATTCGGAAGCTGCGCTACCT TCACGCTGTCTCCCTCACTCCGCTTATATACGTCTCTCTCGCTGCATCAA GTTCAATTTCATACAGAGAAAGAAAATTAATAGACAAATATATTGAATAT GGTACAGTAAGACTAATTTATCTTTTTCTAAGAGAGCGACTGAACTTCGG ATTTTACTATTTGAAATTTGATTACCAGTTATTTTTTTCAGTGCTCCAGT AGCAAGCAAGAGTGTAAGCATGTAAGGAGAAGAAGGAGAAGATCAACAAT AACTCCACGAGCCTAATACTTGAATACAATGCCATCCATCTTTCTCTTTC TCCCTACATATACAATATATATGTAGTAGCACCATAACACCCCCTCGGGC GTTTCCATCCTCCCCGGATCGTCACATTTTTAGTTCGATTGCGCAAAAAG TAGGTCGTCGTGGCCAGACATGAAACAACAACAACAACAACAATAACAAC AGCAGGGCATATCATTTAAATATTTTACAATACACACATGCTTGTGTGTA AGCGTGTTTTACTTTTGTGCGTTTCTCTGCGTTGGTATTGAAATTTATTT ATTGCCGACTTGTTTTTAAGTTTATTCATTAGCTTCTTGGCGCAGGCCTA ACAGCTTATAGAAATAACGTAAATAGAAAAACAAACATGAAAAATCTTGA TTCAGATTCTTTCCTCCTCCAAATTCCGCCAACCAAGTCAACTTGTAATA ATTCACTTTTATTGAGGTCACACCGTAGCTGCAGTTACGATCTGTTCAAG ATCGCGTGTGCTGCAATCGAAAGAGTCGACCGATAGGCAAAAGGTTAGCG ATGAACAATCGGAAAAATCGATGTTCAAAATGTTTGGGAAAATGCAATAA GACAATCTAAATTGACGTATTTCACATGGTGAGACGACTTAAGTCAATTG TTTTCATGTGTCACACTGCAAAATACATTGGAACCAGTTTGGAACAAATG GGAAAGACTCGATTTGTCGGTCAATGGGTCTAATCGAAGCTAGAGCGCAT TTTGAAAATGGTTATAGAACCGCTTTTCGGCTTTTCCACACTTATTTTAC TGCAGTTTTACGGTAGTCACGTAGGCCAAAGCGAAACTTTGTTTCAATCC AATGTAAATGTCTTGAGTGAAACATAAACTTATCGGTTTATGGGCTTATA AAATAAATAAATTTAAGTATTCGGAGGGGCGTGGACCAAAAACGAAAATA AAACAAAGCCAACAAAACGAAACACGAGGAAAAAAAACGGGTTGATCTTG GAGCAGGGGGGGCAGCATAATCGAACAGGTTTTCCTCATTGTGTTTTGGG TTTTCGCCTCACTTAAAAATAACCCATAAGTGCGTAAGGAAAAAGAGAAC AATGCACTCGTCTAAAAATAAATCGCATTCAACGGGGGGGCTTGTCTTTG TGAGCCCTTTAAGGATAAACCTTCTCAAGATAGCAACAAGTGTTTTCAGG CCTCTCTTCTTGCCGCAATGGGCACTCATTCTCCTATCGTATACCCCCTA GATATCATATTCCACAGCGGAAACCAACCATGCATATGCAAACTGAACGA TTTCGGTTCGTCTCGACTTTTGTCTTTGAAAGCCTGAAGGTCGCGGGTCT CGGCCATTGGATTCGCCGTCGCCATCGATCGTATAATAATTGCCGCGAAT GCAAAAATTAGTTGAACGCGTGATTAATGATTGGCTTTCCATTATATCCC AATGCCTGTTTCGTCAATTAGTGACGCCCATTGAGGGAAGTTCACAAATT CCAGCCAGGCGGGAATTGAAATTCATTAAGTGAAATGCAATTCGCTCCCG TAAGGGTTAAAAGCGCTCTTATTTTTGGCTCAAAATCAGGCAGTAAGGTT GACTCATCTATAAGATACTGATTGCATACGAAACCCATGAGGACCTCAAC GAAAGAAAATCAATCAATGTTGATAATTAATTAATTAATAGAGTGGAAAT ATAAATTAAATGTCAAGACTGAAATGTATGTGTAAGTTAGGTGTCCAGTT TGTGAAAATAAACGAATAAACATTGTACGTAAGGGATTCCCGATTGGCAC TAGATTCCATTGATGTATCAACATTCTGATTCCAGATTGTTAAAATAAAC GAAATACCGCATACGCACTAGGAAATTGAGAAGAAACGCGAGAAGCGGCG GATGGCAACGAAAGCCGCGACGAGCAATAATATCGCGACGAAGAGCGGGC GAAAAAGAAAGCAGGCGCTTATGCAATGGGCAAACAAGCGATCTAGGCAG ATCCAACCAACGGATGGGATTGTAGATCGGCGGTATCCGGATTGCAGATT CGTGTGACTCACCTTCTTTTCTCCTTTGGTTTGCCGCTGGCCGTGAGATT GGTTTTTGGGGCGCCAGGAGATGGGGAGCCAACGGACGAAGATGGTGGGG AGGACGAGAACGAAGAGGAACAGGAGGAGGAGGAGGCGGAGGTGTTGGTG ACCACCGCTTGGGACTGCTTCTGTTTCTCGGCCGCCGCTTCGATTGTGTC AATTAATGAAACCATTGTGTCTCCGGATTTCAAAGTGCGGCAGCATTCAA AAGATCTGCCGATGTGGAGGTTCCTGTTTTCCTTATCGCGAGTTTTTCCA GCACTTTTTGAGACTCTTCGTTGTTGTTTTCTATTATTTATCGCTGTTAC TTTCGTTGTTTTCCTATGTATGAAAACTATTGTGCGCTTGTATTGGTTTC TGCGTTTGTATTGTTGTCACTACGCACACACACACTCGCACACACTATAA CTCTGTTTTCCTGTTAAACCGTTATTATTTAATCACTTTTACACCGTTCA CCTCGATTAACTTTGTGTATATCTGATTTTTGAGCCACAAAAAACAAAAC ACAAGGTTATATTATTATTTCACTGCTGTTGCTGTTGTTGTCGTTGTTAT TGTGGTTGTAGTCTCAACTGGCCAATTGCACTTTGCTTTTTTCGATAATT CGGATATTTTTGTTATTGCACCTTGAAGTTCTGCACCGACTTGATGTTGA ATTCGCGTTTAAGCATCTCACAAACGCGATTTATCCGCAATATATGCATT TTACACTGCGCCTACAGCATTTTTCCTTTCCACACGAAATCTTAATACGC TTTTATTTTTCCGTTTTCTTTGATTGCTGCTTCGTAAACAGTGTGGCAGC AGGGTGGAAAAATACTGCCAACGAGGTGGGAGCGCTTCGAGTATATACCA GAAATACACAACATATGGAAATAACGGCCTATTGGCTACAGTGAATACAA GATACATTTACATTTTTTTATTTGTGTATTTCGCTATTTGTAAAAAAAGC GAGAATTTAATTGAGAAAACGAGTATCTTTTATTTCTGAAATAAGCACTA TGCTGTTTCAACAATATCTCTGTTAATTCCAGACTATCTGGCTGATAAAT GTTTCCCAGTCACGATCGATAGTGTGGGGATGGATTGAAGTTAATGACAA GTTTTATTTATTTTGTACGAAGTCACACCTAGCTCTTATCTTATGTACTC CCACCTAAGCCTTGGGCACCACTGAACTGCTATTGGGGGACACCAGCTCA TCGCCGCCTCCGTTGTTGCCCACATCCGCCAGCGGATCCGCGTTCTGGCC ACCAACTGAACCGGCATCCGTGTCCAAGGCCTCGCTCAAGCCATCATCGT CGTCGTCATCACCGCCAGATTTGTTGTACACGGTGGGGTACTTCTGGAAA CAGTCGCGCATCTTGGTGAAGGCATCGTAGCAGTCCGATCCCTTGGGATC GGCGGTGCTGTTCTGGAAGCAGGAAAATGCCTCACGGAAATCGACGCCAC AGGGACCGGTGGCCATGCCGCCGAGGCAGGGACAACTCCAGTTGATCTTG CCGTCCTTGGTGATCACGCCCTCCGGCTTTTCCGGCGGCGGCAGCTCGAT GGTGCTGGGCGTGGCATGGTCCTCCTTGGTCACAAAAATCACCTTGTCCT TGCCGTACTCCTTGCAGTAAGAGAATGACATCCTGATGCGGTAATGCTAG TTAAATGCTACAAACTCCTCGGGGGATTCCTCAAAATCCAAGGGCTTTCG GGATGTGCTGAGCACCTGAAAATGGCAGGGCACCTCCTGGTAGTATCCTA TTAGGGCTATAGCTACGCGAACGCGATCCAGGACGTTCTCGGGCACCCGG AGAATGGAGCGTTTTTGGCTGGAACTAAATTTCACAATTTCCAGTATGGT CTGGCCACCTATTTCGCCAAAAATACTAGCCAAGGAGCTATGGATGCAGC CACAGAAGAATACGGGCGTCAGAGTCACGGAGTCTGGATCACGGAGTTTT CTGGCGATTAAAAACGTGAATTATCTTAATTATATTTGCATGATGCACGT GCGCACGTGGGAAATACGGGGCTTTAAGGAGCGGGGCTGAGTGCCCGGAA CTCACATCTTCACGTCCAGATATTGGTAACCACTCATGCTTTGGGTGCAA GTGCCAGTGCCCCTCTTTTTTTGGCGGAATCTTCGGGAAAAGTCGTCCAA AAGTTGCCGGTCAGTGTGTTTTTTTTATGTAATTACTCCCCTTTTTTGCT GTTTCTTTCTGCTTCTCAAACAGCTGTGCGCCGCCAGAGATGCCAGCTCG GCTCACAACGGACATGAGTAGTTATAAAATAGCTAAAATTATAGCCATTT ATTAAAACATTTAAATTGTTATTGGAACTACTTAAATGCAATTTTATTAA AATGGTTACAAGTTTATGGGGTTTTTCCGCTTTTTAATCTCATTTAGTAG CCATCACAGAAATCATTTCAGTTCGTTGTGAATGACAAAAAAATCAGATC ACAGTAAAATCAGTTAGGATTCAAATTCAAATTCTTCATGACGGTTATAA TGTATATTACACTGAGTATTACAATTCGCTAGTCCTACTTGTCGTCGTCA TCCTTGTAGTCAATGTCATGATCTTTATAGTCTCCATCGTGGTCTTTATA ATCTGTCGACGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCCGAGG ATCCGCTGCCGCCGGCGTTGCTGCGCCACTCCATCTTCTGGCTATCCAGG ATCTGGCGCAGGCTGCTGGCCATGCCCTGGAAGTACAGGTTCTCGGGGCC CTGGAACAGCACCTCCAGGGTGCTATCCAGGCCCAGCAGGGGGTTGGGGA TGGGCTTGCCCTCGAGCTTGTACAGCTCATCCATGCCCAGGGTGATGCCG GCGGCGGTCACGAACTCCAGCAGCACCATGTGATCGCGCTTCTCGTTGGG GTCCTTGGACAGCACGCTCTGGGTGCTCAGGTAGTGGTTATCGGGCAGCA GCACTGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGATCGGCCAGC TGCACGGAGCCATCCTCCACATTGTGGCGGATCTTGAAGTTGGCCTTGAT GCCGTTCTTCTGCTTATCGGCGGTGATGTACACGTTGTGGCTGTTGAAGT TGTACTCCAGCTTGTGGCCCAGGATGTTGCCATCCTCCTTGAAATCGATG CCCTTCAGCTCGATGCGGTTCACCAGGGTATCGCCCTCGAACTTCACCTC GGCGCGGGTCTTGTAGGTGCCGTCATCCTTGAAGCTGATGGTGCGCTCCT GCACGTAGCCCTCGGGCATGGCGCTCTTGAAGAAATCGTGCTGCTTCATG TGATCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTCAGGGTGGTCAC CAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCA GGGTCAGCTTGCCGTTGGTGGCGTCGCCCTCGCCCTCGCCGCGCACGCTG AACTTGTGGCCGTTCACGTCGCCATCCAGCTCCACCAGGATGGGCACCAC GCCGGTGAACAGCTCCTCGCCCTTGGACACCATGAATTCATCAAGTGGAT CTTGGTTTGTGTGAACCTCGTCCAGCGGGTCCTGATTGGTATGCACTTCA TCATCGGACACAACCGCGACAGTCTTTTCAATGCTCTTCTCAAAGTCCAG CGATGATTTGGATGTTTCCAAGATCTCAAAATGACAGGGTATCTGCTGGT AGTGACCGATGAGCTCAATGGATATGCGGGTCATGTCGTGCAGTTGCTCT GGCACTCGAAAGATAACACGATGTTGCTGGGCGCAGAACTTCACGATCTC CAGTGTGGGTTTCTCCTCGCAGAAGAAACTGTCCAGGGCGTCAAGAACGC AGCTTCGAAACAGAGATGGGGTCAAAGCAACTGCAGTCGGATCCCGAAGT TTACTATTAAATAAATGAATATATTTACTGAATTTAATAACAACCAAGTT TATATTAATGACCGCAGAACATCATTCTACTCACAGTTTGATGTCGAAAT AGTAATAGTTCGCCATGGTGATCTTGCGCGTTCCTTTTAAGCGGGATCCT CTGTAGTGATAGAGTTTTGTGCGTTCGGGGCGATTGGCAAACTGATTTTG CAGTGAATTGCGCGCCGCGCAGTCTTTGTCGAAATTCTCTCACGCAAGAC GTGCAATTTAAATAACGAAACTCGAAACAACAAATAGTCAAATTTAACTT CGAAACTGTCAAATGGAGAAGCTAACGAATGTTCAGGCACAGCAGGAAGA GGAGGAGGAAGAAGGTCCACTCAGCGTGACTAAGTTAATAGTGAGTAGGC TGCGATCTCGACCAGGATTATTATGGGCATTCCCTACGATATCCTCCTCC TAGGGCGGCAGCATCACGGCCAAGGACATCAAGCTGCTCCAGCAGGCCAG TCTGCACACCGTGGAGTCGGTGGCCAATGCCACCAAGAAGCAACTGATGG CCATTCCCGGCTTGGGCGGCGGCAAGGTGGAGCAGATCATCACGGAGGCT AACAAACTGGTGCCTCTGGGCTTCCTTAGTGCTCGCACCTTCTATCAAAT GCGTGCCGATGTCGTGCAGCTGAGCACGGGCTCCAAGGAGCTGGATAAAC TGCTGGGCGGCGGCATTGAGACGGGATCCATTACCGAGATCTTTGGCGAG TTCCGCTGCGGAAAGACCCAATTGTGCCACACTCTGGCAGTAACCTGCCA GCTGCCCATCAGCCAGAAGGGCGGCGAGGGCAAGTGCATGTACATCGACA CGGAGAACACCTTCCGTCCGGAGCGTTTGGCTGCCATCGCGCAAAGGTAC AAACTGAATGAATCCGAGGTGCTGGACAATGTGGCCTTCACCCGTGCCCA CAACTCAGATCAGCAGACCAAGCTCATCCAGATGGCGGCGGGCATGCTCT TTGAGTCCAGATACGCTTTGCTGATTGTGGACAGTGCCATGGCGCTCTAC AGATCCGATTATATTGGTCGCGGGGAGCTGGCCGCCAGGCAAAACCATTT GGGCTTATTTCTGCGCATGCTTCAACGCCTGGCCGATGAGTTCGGAGTGG CTGTGGTAATTACTAACCAGGTTACTGCCTCGCTGGACGGCGCACCCGGC ATGTTTGATGCCAAGAAGCCCATTGGCGGGCACATCATGGCCCACTCCTC AACCACGCGGCTGTATCTGCGCAAGGGTAAAGGCGAAACCCGCATCTGCA AGATCTACGACTCGCCCTGTTTGCCGGAATCGGAGGCCATGTTCGCCATT CTGCCGGATGGAATAGGAGACGCCAGGGAGAGCTAATTGTGCTCACTTAT AGGTTAATTAATGCTAGGAATAGAGCTCCCTAACTTTCTAATGATTACTT ATCCCTAGACTAAGAATTAAACTTCGTAGATTGTTTTTTTTTTTGTTTTA ATGTTTACTTAGAATGTTTAGGATAACGACGAAATAAAACAGCCGTTGCG AATTGTATGTACCATCTATATTTAATTCAATATTATTCAAATCATCTACA AACTTAGAAAATATTTAGGGGTTTCGAAGCAAAAACCTTTTTTTTAGTCT GGTAATAAGCGGATGCAGCAGGAAAAGCCCCATCAGCGCAGCGTAACACG ACATGCACCTGGCAGGCAAACAGAATTAAGGAATTTAGCTGAATTTTTAA CCTAGAATTAAGCATAGCCCACTTGGCTCATCAAAACTTTGTCATCCAAA GCACGGTCTTTAAGTTGCCTGGTTTGTAACGCTTACGAGTAACTGCAAGA AAGAGGATTCTTGAAGATGTGTTTCAACTCAGCGGTTTGCGGTTTCCCAT CCTACCTTATCATGTAATTGGTCCAGCAGAACTGGTCCTCGATCATTTAC TGTGGAGCCGATCCGGCTGAAGCGGCGGCCTCCTTGGCCAAAACCAGGCT ATTATATCCGCGCTCGTTCATCCCGACGCGAAGGTTTTCGTTGATATTTT TCGTATAGGTCTTGTAGATTTTTACCTTTTCGCAGAAGTCGATCCAAAAG TTGTCCTCGCTCTCGGGCTCCGGATTGAAGAGACTCTTGAAGCCATCGTA TATGCCAGAGGAGACCTTGCGTATGGTCTGCGCCCTCTCCTTGAACTCCA CCTCGTCGGACAGGTCCATTTTCCAGAGCTCCAGATTGCCCACATACCGG CGAAGTCGGCGCATTATGTCCACGCACTCCGGATTGCGCAGCAGCATCAA CTTGGTGAACTCCACCTCCTTGAACTGCTCGAGGATCTCCAGGCATTTGC CCACATTGGCGCGCCGCAGGCCCAAACATTCGCGCAGCTGCTGGGAAAGT TGGATGAAGTCTCGCTCCATGAAGAGGGCATCCTCGTGCTCAATGAGCTC CTCGATGAATCGCAAAGCCTCCTGCTTGGGTATTTCGCTGCGTGTTGGCT CCACCACGATCCTATCGGGCATGGACTCCGGATTGATTTGGCCGCTCTCT AGTTTCAGTTTGAGCTCCAAGGCTTCTTTGCGGGCGTTCTCCATCCAGGC TTCCTCGGCAGCGGCGCTTTCGAAACTCTCCGGCTTTTTGTAGTTTATAA CGATTCCCAAACACTTGGCTGTGGGCATGTACACCATGAGCATCTCGTTC CGGATGTTCTGTTTGGGCAAAAATGGAAATCAATGTATCGTAATTCATAC TAGTTTATGTCTGGTGGTATTTCTGCATCGCACTTACATTGACTGGCCGC GACCGCTTCTGAATCGGAGTTACTGCAGCCGTGGGCTTGGATTTCTTCAC TGATTTCTTGCTGGAGGTGGGGGTCGCCGCAGCCGGAGCAGCGGGGATGG CTGCGGCGGTAGCCAGACCCTCGGTGGGAACCCTTCGCTTGGCCGGCGGA GGTGCTAGTTCCGCGCCTGCTTCACTATCCCCGTCCACATGGCGCGGTGG TGCCTTGGTCTTCCGGGTGCCGCTCTTCTTGGGCTTCTCGGCCGCTGCTG CGACTGGTGCAGCAGTGGCTGGCTCCGGTCCCGGCTCCGGCTTGGGCTCC TCCGTCTTGACGCCATCACCAGTTGTGGGCGGAGCAACTGGCTCCGCGCC GTCGAGCAAATCAATGGGCGCCGAGTCCTCGCCGCGCAAGGCGCTCTCGA TCTGATCGATGGCCTCGATGAACTTGGCCCGCTTCATGATCTTCTCGGTG GCGAAGCGCTCCTTGTTGCTGGCGTACGGGAACAGATCCTCCAACTTGAT GTTGGCCGTTTCGCCCGTGCCGTAGAAGTAAACATTGTACTTCTTGTTGT TGTTGCTCTTGGTGATTTTGGCCGGCCAGGGCGGATAGCCCTTCACCTTG GCGAACACCAGGTCGCCAATGCTGTAGGAGGCGGCCGCCTTTTCCTTACC CATTTCGTTTGACTTCTAGCTCGTTTGGTTCGCGTGCAATACCAATATCT TTTGCCGTATTTCTGCGGCGTCTGCTTTTCTTCTTTTCGTCTCGCGCTTT CTTAGATATGGCACTTGGCTCCGATAACAGCGATGTCGATCGACAGTGTG GCCAGCTCAAGAGCCAGCCAGCGCTAGCAGTGCTCGTATGTGCGTTGGTC GTTTGCGGTAACGACGAAACTGTAGCTTGGCGGGCTTTTAGCTTTCGAAT TTAAAAATGATGGAGCTCAATAAAATATAAGAGTTTTTCGTTAAATGTTT ATATGTTTCTTATTACATAGTGAAACACACTGCTTACTATTCTGCATACC TTTTCAAGTTGGTATCCCAATCTTCTTTAGCTTATAGTTATAAGTAACTT TGAATGTTTTTAAGCCTAAAATTGTCGGCATATTTAGCAGGCATTGCTCA TTTCATTGGCCAATTACGAGTTCAAAATCGCTGGCACAGCTCCCACAGGT GGAAGTTCGTTGGCAGGCGATGCCGGATTCCCACCTCGTCGCACCCACAC AAAACACCTTTGGCGCACGCACCTCGTCGCGCGAATTCACCACATCAACT CGAACTGAAAACATTTTTCGAAGGCATTCCTATTCGTCGGCCAGTCGTCG TTGGTTGGCCAAAAAGAACAGTGTTGTCTCTCCCACGAGTTCCCAAAAGA ACTTCAGTTTGTTTACCGAATCGAATCGAATCGAATTGAATCGTTGGAGA GCGAGCAAGGCGGAAAATAATTTTTAATTTTGGCCTGGAATCCGCGGAAT TCGTTTATTGTTTAGCGCAAATTCCCGACTAAGTGGCCAGCGCGAATTTG TGAGCCCATAAACATGCAGGAGTTAATAGTCGGCGGCATCGCCATCAGTG GCGTTCCCTTCGCCAATGAGACGGTCGAGAAGGAAAGTCGCCAGAAGTGA GTAAATGCACGCACATTTTGCAGTTTGCTGCCAAGTACAAACATTTGTGG TCGACATTTGAGCCCGTTTTGTTAGCCACAAACACTAAGCACTAGATTTG CTCAAGGTCGCCATGATGTCACCTCGACAAACCTTTGTGGCTGCCTACTA CCTAATTTGCTCGCTATATAAATAATCACACCTGAATCGAACAGCTAGTC GTGTTTACCTGGCGGAATAAAGCAAATAGAGTGTTAAAACAAAATCATAA CAATGCCTTAGAATTATTACCTATTATATTTTATATTGAAAATCAGCTTT GAAATATCCATTGAAATACAATTCCCCCCTTTTTACGGAAGCACAAACTC CATAAATTTGGCCATAAAGCAGCATATGCAATACATTTGGCCACATGCGT TTTTCAAATCCGATTCGTTTTCGAGCAAAATTCCATTCTGAATTCCGATG TACTTACATGCGAGCATATTTCCCGCTTTTCGCCAGTGTCCCAAATTTGA ATTGAAGACGGAAATCGATTCGGAACTGAATGCCTTTCATTGAATTGCAC AATGTATTCGAATATTACAAATTATTCTTGAGTTTTCGGCGCATTCTTTA TCGGTGGCCCTGACTCTGACAATTGAATTCAAGGACGGCATAATTGCCAA AATGAAATTAGTCATTTATCATTGAGGGGCAGACGGAGGTCTGTCTGCAG GTCTGTCAAAGTTTTGGCAGTCGAAAAATGCGGATTTTGAGGCCCCGAGG TGGATATTCATACATAGCTGGGATGTAAGGCATCTTGTGGGTTGGAACCC CATGCAGTTCTCTAGATAAACTGGGGAATGACTAGATGGATAGGCTCAGA AGATAAGCGAATACCGTCCATCCCGCCCATTAACCTAGATTCCCTAGAAA ACAAAAAAAAAACAATCATGTGATGGACAATGGAGACAAGGATTTCGGAT TCCAACGCTCGCTGGCGAATTCATAAATAATGGACTTGGAATTCGAAAAC AGCTCAATTTGTTCTTGCCTTTATTTTTGCATTCGGCGATAAAGTGAATA ACGAACGGAACATCGGGGGCGGTGTGAAATATTTTAATTTCACTTATTTT CAAATCAAGAAATTTTCTGCCGATGCCACTGCCTCTTTGGTCTAGTGAAA GTGACCGATGATTAATTTTGGCGCCGTGCCAGTGGAATTTGTGATTATTA TTTAATGACGACGCCGAGTCGCCGTAAACATATAATAAAACCGAAAAGAA CAAGCCATTTTGAAACAACACACAAAATGGCAATACTCTCGTTCGAATAA AGTAGTTTCGAGATGTTATTTTGGAAGAAATGTAACCTCCCAGGTGTTCA GAAGTATGCAATATAATATTTTCAGCTCGAAACTCAGCTGAAAAAAACTT CAATAACTTGAGTGTTTTGAAATCTCTGCGAATTTCTTTGGTTTCTAGCG AAGAGTGTAGACTTATTCGTTTTGAAATCAGCCGAGTGCTTAATTTTACA TTCCTCAGTGGCAGGAGCTTTTGGAGGGCGATGACAGCAGGAAAGGCGGC AGGGATTGGCACCTTCTATTTGATCTCTATTTGATTGGATGACTGGGGGT GCCAAGGGATGAGAAGATGGAGCGGGCAAAGGGAAACCAGATGGCAGACC TCTGTTTCCATTATAAGGTTGGAAGTCAGGAAATGATATAATATGAAAAT ATGACTAATCCCAATGCTGCCTTCGCTGATCCCTTACTACATTATATATA TCGAAGGTAACTGACCTCTTGGATTTTCCCAGCCAAACGGATTTGGATCC AAAAGATCGGAGGTGCAGTGGTTAATATCCCATTATGCGATGACTGATCT GTTTGTTTACGCATTCGCCAAATACCATTTTAGAACTGCGCTATTTTCAC ATCGCCTCCATTTATTATACACTCCGCGAAACTAATTATAAACAAGCATT TCTGAGGTGTACAGATACAAATTTGGATATAGTATATACATATATGTGTA TATACTATATGTAGGTATTTTGGCAATATGTTTATTGTTTGTGCCTACGC AACGAACTCATAGAACCATGACGTCGACCCATAAATACGTAGGCGATGGG ATGGGATGGGATCGAATGGGATTGGATTGGATGGGCTGGGATGGGTTGTT TTTCCATTCACAAAAACACACACGAATACCTGCCATTTGTTTATGGCCCA TTTGTTTTTGGCTTAGCACCAGTTGTGCTCCTTTGTTCGCCCGCGAAATG TTCTTATTTTATCGGGTTTTTCACCCACTTTGAAGTGCACCAGGTTGTCC AGCCAAATATTTGCGCATTTATGCCATTTGGCAGAGCCCCCCAGAACTTT GTAGCTATGTAAATTTAACGCATTGCATAAGCTTTCTTTTGTTCGGAAAA AGAATGAGAACTCACCAGTATTCCCTCTTTGATTCCTTGCAGTCAGCTGA GTGCATCCACGCTAGAGGATCACACGCCGTTTCCCGGTCTGTCCCGCATC ACTCCATCGCTGATCCTTTGCGGTGCCGCGGCGGTGGTGCCCGCCTACAT GGACAAACTGGGCGTGAGCTGCGTCATCAACGTGGCGCCCGAGCTGCCGG ACACACCACTGCCCAGCCAGAAGAACCCGCTCTATCTCCGCATCATGGCC CAGGATCGCTCCGAGGTGGACTTGGCCAAGCATTTTGACGAGGCGGCCGA TCTGATCGAGGAGGTGCATCTCTCCGGCGGCTGCACGTTGATCCACTGCG TGGCCGGCGTCAGCCGCTCGGCCAGCCTGTGCCTGGCCTATCTAATGAAG CACGCCGGGATGAGCTTGCGCGAGGCCTACAAGCATGTGCAGGCCATACG TCCGCAGGTTCGCCCGAACTCCGGATTCTTCCAGCAGCTGCGACGGTACG AGCAACAGCTGCGGGGCAGCAGCTCGGTGGCCATGGTGTACTTCGCCTCG CTGGACAAGGAGATCCCCGACATACTGGAGCCCGAGTACAGGGCCATGGA GGACTTCTACCAGCGCTACCGCAGCTCCCTCAAGAGGCGATAGGCCCGTT GTGCCGCAATTAATCTTACTTGTGATACTCGTACCCTACCACTAGCCTTA GATTAGATGTTTAAGTTGTGTGTGCTTAATGATAATGAAATGAAATGCTG AAACTTACATAAGATGTACGCTTAAGCCTCGTTCGTAATTACAAATACAC TTTTATTTTCGTTTAAGAACATTGAATCTACCGCGTTAATTAATCAGTTG TAGTATCTTCAATCAATCACAAAGTTATTGGCGAACACAAACAACACACT CGTATTATATCGCACATCATCTAGTATTATTTACACGTACACGAAAAGTA GCTAACTAAACCGTAACTCGAAGATTGGGTACCTTTAAATGCTCACGTTG TATTGTACTTGGCATCCGCGAGGCGAATTGAATAGATCTACAGGTATACA GATATACAGATATGAGTAGGAGGAGCAGGCGACCTCCGCTTGGGATGCGT GTATGTACATTAACACCTAGAATTCAGCATCTGTGCACAAGCGACTTAGG CGAGACTTAAATCGAACGAAATAATTGGCTAGCTAAAGGCAGAAGTAACC GTTTGTGTACAATCAGCTAAGTTAACTCTAGTTCTACTCAGAGGCCAGTG GCAACGGCGGCTGCTGCTGCATTAGTTTCTTTAGGTTTTCGTACGCCGTA TTCATGATGCCCCAGCTGATGAAGGAGCGGCCTGTGTTGAAGGGGCATCC GCGATAGAAGTTGCCAATGCGGCGATCGCGCTCTACGTAAATTCGCTTGC ACGCCTGCCAGCTGCCCTCAGACCTCTGGCCCATCTCACTCTGCAGCGAC ACCTTGATCACATTGAGCGGGTAGAATATTGTGCTTATGCTCGCACCGAT CACGGCGCCCGCTATGAACTCCTGCACTGTTCGAGTGGATACGGATTTCT GTGGATGGGCAACGGATTGGTTAGTATCTTAGTAGGTTCGTATGTGTGAT AGGGTCAACACTCACTCTCTTAGGCAGCCGGACGCTGGCCTCTTCTCGCA GTACGAAAAATAACGCGTTGGACAGGCCGTTGCGCCAAAATACTGGTTCG AGTCCCCTGTAGAGCTCCCGGTAGCCGTGGTGGGAAACCACATACCTGTG GAATGATTAAAAGCCATAAGAAGATCCCATTAGCAAACTTAAAGATCCGT CAGCTCACCTGAATGCGTTTTGTGTGTTGGAGAAGTGCTGGTGGAACTTG GAGTCCGCGAGGAGGGTTTGCACCCGTTCGAAGGGCAGGAGGATGGACTC GGCGCTGCCGGCCACCACGGCCGCTAGCACCTTGGCCCCGTAGTCGTTCA GGCGGTAGTCCTCCACGAGGTACCTCCTCGTCCCGTCGAACACACCGAAC ATGATGGACAGGGATATGGTCTTCTGGGCGAGCGGCGGCAGCATGCCGCG GTACAGGAAGCCCAGTCCCTCGTGACGCAGCTGTGCAAAGGCCGAGGTGA TGGGCACGCCGTGCAGCATCTGACGGAAGATCATCTTGTAGATGGGATAG GTGACCGCGATGTTGACGAAGGCTGCTCCGCAGCCGCAGGCGAACTCCTC CCACTGAAAGGAGCCGAAGAAGCGCTTCGAGAAGACGCTGCCATGCAGCA GTTTCCCCGCCTCCCCGTCTCCATGTGGGCTGTGTGCTCTTCCGGATGGA AACCTTTTAGGGGGCGGTGGGTCGGTGGTTTTCGCGACGTTTGGTGCTCC ATCGTCTTTCATCTTGCTGCTGTCCTGTGTTTATTTCGGGCGTGTGGAGA AGTGCGCATTTGTCACCGCGTTACCATTGTAACTATTCAAACACGGGGAT TGCGCTGGTTTGGTTTGTTTTGGTTTCGATTCGCATCGGTTTTAATTATA TAATAATGAAGAAGAACCACGGTTTGACGGCCACGGCCAGTGTGACCGTC GCTGGACCTCTGCTGCATACCAAAGGACTCTGTTATCCAAATTGTTCACA AGCCAACCAAAATTAATTGTCGAACTTAAATTAGCAGCGGCGGCTTTGAG TTTTGTACTCGCCCTTTTCGGTAATTTACAAACTTAATATAACACCGTAT AATTAAAATATTCTTAGCAGTGCGTTTAACAGCACTGTCACTTTATTTTG ACCGAATCACCCTGTGTACTTGTTCCACTGACGCAAAGACCACCCTATGG ATCAGAAACTTATCATGTGCTGGTATGCATTGGGTGCTCTAAATCCACGA CTTGGATGCTTTTGTATTAGCCTCCTAAACCTCGGGAACACCTGCTCCTT GATCGCTTCTGTCAGCTTTTTACTTTTTCATTCCCAGCTTTCTTATCGTT TTTTATCAGATGACGGTGCTGCAAAACATCTATTGAACAGCTGTTGCATC CAGTGTGTAAATGAAATATGTTCACACTGCACAGTGGGTCAAGAGGCAAA GCATATTTAATTATATAACAAACTCCACCAAGCTGAAAATAGTTCCATAT TTTGTTGCACATAGTTGCAATCGTCGCAGTTGCTCGGATAGTGATTAAAC CTGCAACACCTTATTTGACGCGCCCAAGTTTAAATTCATTACACGATGAT CCGCAATATATCGCTTGGCATCGCCATGAACGAAACTATCGGCGAATCAT CGACGCACGACGTATCGATGTTTTTTCACACCACCAGCTTTTTCTTTTCG CTTCTGGTTTCCGGCAAGGTATGTGCGTGATTTTGGGCCCACGTGTATTT CCATTAATTTTAAGCCGTAATTGTCGTTTTTGGCGGTTTCGAGTTGAACT GCGTTAGTCCGTGCGCTGTTCGCAAGTGTGCGGCTCGTATTTCGACCGAA TTCGGATCGATTCCTGTGAGAGTTCGCCAAATGGCTTCTGTTTGTGATGG GAATTCGTGGGGCGACACACCGGAAACTCAATGGATACTGCCCAAGAAGC TAGCCCAACCTGGTTGAATTATGCATTAGTGGGACACCTTGTGTGTTATT AGCTTGATAAGTGATATTTCCAGTGGGTCAGTGCACTAATGGCTACTTTT GTTGTGTCCTTCCAGCTTCAAGATGACCATCCGCCCAGCATACAGGCCCA AGATCGTGAAGAAGCGCACCAAGCACTTCATCCGCCACCAGTCGGATCGA TATGCTAAGCTGTCGGTGAGTGCCAACGAGGATTGTGCCAAATTGTACCC GTGTTTAATCAACATGTCTCCTTGCAGCACAAATGGCGCAAGCCCAAGGG TATCGACAACAGAGTGCGTCGCCGCTTCAAGGGACAGTATCTGATGCCCA ACATCGGTTACGGATCGAACAAGCGCACCCGCCACATGCTGCCCACCGGA TTCAAGAAGTTCCTGGTGCACAACGTGCGCGAGCTGGAGGTCCTGCTCAT GCAGAACCGCGTTTACTGCGGCGAGATCGCCCACGGCGTCTCCTCCAAGA AGCGCAAGGAGATTGTCGAGCGCGCCAAGCAGCTGTCGGTCCGCCTCACC AACCCCAACGGTCGCCTGCGTTCTCAAGAGAACGAGTAAGCTTAAGATTC TTGAGAGTTCTTGTAACGTGGTCGGAATACACATTTGTAAACGTTAATAT ACCGGACTTTTAGTTAAAAAATGATGTGCGAGTGCCGAGTTCAATTGTCA TTTCTGAGATTGGGATAGCAGCACCATTGATAACATGTGCATTATCTGGA TGGATATCAGTTAATCCAGACCATTGCGGTCTTTCTTTCTGATAGCAACT GCCTCGAGATATTAGACCAATATAAATTCCTTGACGTGCCAAAACTAGAC AGCATCAATCCTTATCAGGGAATTTTGTTATATATTTTACATTTTTCCCC CTTAGTATTGAAAGAGGTTGTTTATATGAAATCATATATATATTCGCAAT TATTTTTACAGAACAGTGTACAATTATTATCGGAAATGCTTCTGTCTAAA TGAAACGCAGTAATTGAAATACCAGTAAATTATATTTTGTAGGAATCTAC AATAATCAAGTACAAAGAGGAGGAAATACACTAGGGAAAGATAAACAATT ACTTATTGTAGGCAATGTAGCTTATTTCAAGACCACGTCGTGATCAAATT GCAAGTGGTGTTCGAGCTCCTTCTTGTTCTCGAAGTTGGTATTGCAAATG AGACAGAAGCCGCTGTTCTCATCGTTGTCGGACATGATGACGGTGACGGC CGCCTCCGATTCGTCGACGTCCACATGCAGCTCCTCCACCACCTGCTGCT CGTCGGCGGGCGCCTCCTCGCGAACCCCGTAAACGACGTCGCCCTCGTGG GTCTTCATGTGCATCTTGAGGGTGTAGCGCTCGGTGAAGGACTTGGGGCA GACGGAGCAGTAGTGTCTTGGGCGGTTCTCCTTGTGAATGAGCGTGTGAT GGTTGAAGGTCTTGCGCGACTTGAACGACACATTGCAGATGCTGCATATG ATGGGGTTCTCCTCAGCCTCGTGGCGCAGCCGGTGGTTGTAGAGTAGGTT GTCCTGGGAGAACCTCAGGCCGCACTTCTCGCACTGGTACTTCTTCTTGT CCCAGTGCATGCGCATGTGGCGCAGGGTGTTCACCGGGCGCGAGAAGCTC TTGGGGCAGTAGCGGCATTGCTTTTCCGTCTTGCCCTCGTGCAGATTCAT GTGCAGCTCCAAGTACTCCTCGTCGCGCCGGATCACCCCGCAGATGGGGC AGATGTGGTTGGGCTGCTTGGAGTGCTCCTCGCTGATGTGCTTCTGCAGT TGATACCAGGAGTTGTACACCTTGCCGCAGGTAGTGCACTCCTGCTTGAC GCGCTTCTTCGTCGGCCTGTCCTCGCCATCGGAGGACTTGCCATACAGGG CCTCGGAGTCGCCCACATCCACGTCCTCGCAGATGAACTCGTCGTCGTCG TCGTCGTCCTCCTCCTCCTCCTCGTCCACGAACTCTCTCTTTATCTCCGT GTCGGACTCCTCCTGATCCTTGACCAGCTCCACGAACAGGGCGTCCGCCT CGGCATCGGCGTCTGTCTCGACATCGCTTTGGGGTATCTCCACCTCCTCC ACGAGTATGTCCTCGCCGGACTCCGGCACCTCGAACTCGGACTTTAGAGC GCCCTTTAGCTGGGTCGTCAGCCTCTTCTGGGTGGTCATCAGGTTCACCA TGATCGTGTCGTAGTCGGAGAGCTCCTGAAAGCAGCGCGGGCACAGCCGG GCGCCGGGCTTCAGGTCCAGCTGCGTCTGGATGCAGTTGGCCAGGTGGGT GAGCACCAGGGACACTGTTTTCTGCGACGACGGCACCTTGGCCGACAGCG TCTCGTAGCGCATGGAGCTGGAGGAGCCCGTGTCGCTCAGATCGACGGCG CCGCAGAAGAAGCAAGTATCCATTGCGCCGACGATGGTCCTTTTAGCGAT TCCGTTTCGTGCGGCGTTTGTTTACAATCTTTTAAATTGTGTATGAAATT TAATAGAGTTGGCAAAATGATGAATATCGGAAGCTATACTAAAATGCGTG AAATGCAACCATGGCATAATGCCCACCAGGGCTGGCGAACGATGCCGATT GATGCCAGGAACGGAACGGTGGGAATGGAACAGGGTGTGAAAACTGAAAT ATATGAGTTGAATAATAAAAATATGTGTTTGCTCAATATTGCAAACGGAT ATTCAATTTGCATAAATACATAATTTGTTGTTGATTATTATGGTGGTGTT GGTTTCTTTAGTTATGAAAACGAGTAGCATTTAATTTATTGATTCCCTGA AAAAATTGAATTGAATTATATAATTTTTTTATAATGGTATGTTTTAATTG TATTTTATATAAATTATGCGAATGGCTTCAACTTAATGAAGTAATTACAT AAGTGTAAAGAACACAATTGACTTAGGTAGCTAATTAGAATCTTTGTAAG GATATGTTTAATCTTAATTAAGCACTTCAAGCCAATGAAGTATTAAAAAA AATCTCATACAGATAAGCCCGCGTATTTAGAATATGGCTCGCCCCACTCA ATCTAACCTAAGAATCTCAGTGATTTGGAAACTAATAAGATCGCTTTCGC TGTGTCCGGATTCAGCAAGTGAGTCCTGTGGCCCGAAAACTGAGCAATTT CCGGTTTGTTTTACAAAGGATCGATGCCGTTTGCCAAAGGATCGACTGCT CCGCACAAAAGTTCGGGTTGCACTTGAGGGCACTTGAGCTTCGGAAGCAA CTGAGGAATCGGGCTCCAGATTATCCCTGCATATCAAGTCCCTCAGCTTG GCCAGCACGGAGTACAGTATCTTAAGGCGCTTCACGATGCGCTTGGGATC CACTGGGACGTCCAGGTTGACCACGGCCTGGCACTCGCGCAGGATCAGAA TGAGGTCCTTGTGCACCCGCTTGCCATCTTCACTGAGTCCCGAGTAATTG ACGGGCAGCCGAAAGTGATCCACCACCACTCCGCCCCTCTGGACAATCAG CTTCAGATGGCTTTTGTCCTGTACGTGGATCCTCTCGCCCAGCATGTCCA GGTAGTTGTTGATCAGGGAGCAGCTATCGATGATTTCGTGGATGACGTTC CTAAAGATCAGCAGCTCCTGGTTAAAATGCTCCTGCAAGACCTCCGCGTG GTGTGCGGATGAAGTGGACTCTGGCAGCTGGAGAGCGGGCACAATGCACG CATCCAGGGATTCCAGTGAGGCCAGGCAGCTCCTGACAATCGTCTTCGTT TTGATGTCCTGCGAGAAGGCTATGGCCAGAACCCCAATCTGCTGAATGCG ATCCATGTTCGTGTCGAATGCGGAGATTAGCTCCTGAGCTCCCGCAGGAT CCCTTTGCAGTGCATCCTTTAGCTTCTCCACCGAAGCGTTTTCCAGATCT ATCAGACTGACGAACAGCAAGTGCAGCAGCGCCTCATTGAGAAAGGATTC CAGGGCATAGAGGGCACGTTCCAGGGAGAGGGCCTCCAGCTTCCGATGAC CACTGTTGGGCTCGCCCGCCTCCTCGTGGAAAGTGGCACATTCGGCGAGC AAGGTCTCGCACAAAGCCGTCAAAGCCTTCTTGTCCGAATGAATGGCCAC ATTGGCAAAGGCCAGGGCGTGGCGAACGATGTGATTAACTATGCTGGCCA GCTGGTAGGTGTCTTCCGTGAAGCTCTCTTCTAGAATGTGCAGCGAGTTG TTTCTCTGCTGGGCCAGCTTCTCCATGTAGTCATCCAAGTGGTCCAGAGC CAGGTCCATGAGCTCAACGAAGGAGTGATCCTCTAGGTTCTTGACTGGGG TCACGTTGCCTTCCAGTTGCGTCAAGGAGACGAGCAGTCGCCGCAAGCAC CAGTCCAAGCGGTCGAGGAAGTGCTGCCTGGTCATATGCGGTGCCTCCAT GCTGATGGTCCGCTCTAGGTGGGTGATGCAGGTTACCACCTGGGTGAGGC ACAGGAAGATGGTCTCCACATCAAGGTTTGCGCCACTGGGCGCCACCTCC GGCAGCCTAGCCTTCAGATCGCTGGCGAAGTCCAGGAAAGTGGCGCAGAA CTCGTTCAGCCAGCCAATGTTGCCGGTGCTGCTGTAGCCCTCTGCAATCA GCTCACTGCAAGTGTGTAATTGGGCCAATAGCTGTTCCATGCTGTTCTAT CAGATGTGCTCCGGGAAACAGAAATGTTCAACTAAGTTCTGGCGGACGAC GCAACACCTTTATATACTTTGCCAAGCGCACAGGTAGAAAGGACCTATTT TGGGGATTAAAAAACATCTGCCTGTTTTATTGCCATACCCGCGAAAATTC GCGAAATCCGCTACTTTACCTACTGGGGTTCCTGGAAAATGGGCGAAGAA CGGCAAAGAACTGGTACTTTCCGTCAATAATTGTTTAGATTTAATTTTAT GATACATACGCGCGCTAATGCACCCATGAGCTGGGCTTCTTAGATTAATC TAGCAAAGGACTACCCTAAAAGAACGTGACGGTGGCTTCCTTGGCCTCCG CCGACTCTGGCTTCTCGACCGGCTGGTGGACCCGCTTGTGCACCTTCAGG GTGTACTTGTCCACGAACGATTTCTCGCAGTCGGGGCAGGGGTAGCGCGG CCGGTCCGTCTGGTGGGTGCGCAAGTGGTGCTTGTAGGTGCGCTTGGTCT TGAACTGCTGGTGGCACACCTCGCAGATCAGGGCGTTCTCCTCGGCGTCG TGGCGCATCAGATGGTTGTACATCAGCCAGGAGAGCGAGAAGCGTTCGCC GCACTTGTCGCACTGGTACTTCTTCTTGTCCCAGTGCACCTCCATGTGGC GCAGGACGTTCCGCTTGTGCGAGAACTTTTTGTCGCAGTAGCGGCATTCA AGTTCTGTTTTGCCCTCGTGCAAGTTCATATGCAGATCGAGTACCTCGTC GTCCTTCACTTTCAAGCCACACACGTTGCAGGTGGCCTGCTCGCTCTTCT GGCAGGTGTCCGCCTTGATGTGCCGCTCGAGCACCTCCTGGCTGGAAAAC ATCTCGCCGCAGATATGGCAGGGTATCTCGGTGGTCTCGGTGAAGAACTC CTCCTCCGACGACGGCATGCTGTCGTCCGGCTCGCTGAACTGGAACTCCT CGTCCAGCATCTCCTCCTTCATGAATTCCTCGCACTCATCCTCCTCGCCC GGCTGCCTTTCGGGCTCCTTGAGGGCGGTGGCCTGGACGATCTTGAAGGC CGGCACCTGGACGCGGGCCCTCTTTGCCGCCTGTTGCTTGGTCTCCGCCT TGCCCTCCACCTGCCTGCAGCCGAGCAGTGCGTCCGCAATCTGGCGCTGC ACTTGGCTGAGATTCCTCACCAGCCTGTCGTAGTTGAAGAGGTACTCCAG GCAGTCCCGGCAGGCGGCCGAGTTGGGCAGGAGCTCCAGCCGCTGGTTTA TGATCTTCTCGAAGTATTTCAGTATATCCTTGATGGGCTTAAAGGTTCCT GGCACAATGCAGCCTGTGAAAAAGTCGGCTATCAGGACTTTCGAGTGCGG CGTAAGCGAACGTTACCTTCTATCAGCTGGAACACCCCCACGGACTTCTC CTTGCCGCAAACGAAGCAAAACGGACGCGTGGAGCTCATCTAGTCGCCGT GGAATCCAATCGAAAATTCGGCTTAAACAATTTAATTTGTGTATATTTTG TTGTGAACGCCAGAGCTGTGCCGATAGTGCCGATAGTATCGACTGCGTGC TGTCGGCGTAATCGATAAATTTGCTGTCACTGATAACAACGTTTTCTTTT TGAGTTTATTAATTATTACTAAAATATACTGAGTAGTACAAAAAACGTTT TCCCAAATGTACTAAAGAAATAACTGAATATTATAATTTTAATAGTATCG ATACATAAGGTGAACGAGAATAAAAGTATCTGGTCACATTGCTGGACTAA AGCAGCGTTTTTGGAAAATTTGCCGGTTGGTAAGACATTAAATTCTGTTT TCAAACACTTTTCCACAATGAATCGCCTCCAACTGCTTTCCAAAGGACTA CGACTGATTCACAAAATGTCCGAGGAAGCACTTGCCGGCGTGCCACTGGT GCACATCAGTCCAGAGGGCATCTTCAAGTATGTCATGATCAATGTCTTCG ATGGAGGAGATGCTTCAAAGGCGGTGATCCGCGGATTTGCGGACTGCACA TGGCATGGTAAGTCGGATCCTCATCACCCATCAAGTGCCCACTTAGCTTG GTTACTGTCCCACAGCCGACATCTTCGAGCGCGAGGAGGAGGTCTTTAAA AAACTGGGGCTGCGGGCCGAGTGTCCTGGCGGCGGTCGCATTGAACACAA TCCCGAGAAGAAGTACTTGAAGGTCTACGGATACTCGCAGGTGGGTCTAT TCCCTTGAGTAAAGGGGTCGCTGGGCAGTGGATGGACTGATGTATCTAAC TACTTGAAAAATTTTCTGGAGTTCTAATCAAGTCTTTCTATTTAAGGGCT TTGGAAAAGCTGATCACGCGCAGACCAAACGCATCCTGGCCACCAAATAC CCGGACTACACGATCGAAATCTCCGATGAGGGATATTAGCTGCAATCAAC GAGAGAAGACTCCACATAAGCACACTGACATGAATTTATACCATTGGCTT TGATCCTGTGTGCCATGATTTTATTGGAAATGGCATTTAAAATTGAGAAA TGCTCTGAAAGGCAGTTAGTCTGTAGCTTTGCAACTGCTCGCACTAAACC TTTTCGGATCTAAATTAATCAGTTTGTACACAAATTTCGTTTCTTTTCCT TTGGTTAAATAAAATGAAAATGTTCAAGTCATTGCGTCTGCTTCCTCATA TTGTTTCTCCGTTTCGTAAGGCTTAGGAATATTCAATATTAAGATTTACA AGCCCTAATATACTTGGTTTTAGAAAAATGTTACTCAACCGATTTGATAA GTTTGGTAGGCGTTCCCCGGGTCAAGATAACCAAGGGTCAGAATCGTTAT TTGTTGGTGAATATTCATACGCATGGCTTCACGAAGTATGGAAGAGTTAT TGTCCGTGGCGCCGATGTTGACAATCACTGTGAGTTTCCACTGCTGGACG CTTAACCTTGAGCAGTCTTACAAATCCTTCTTTCAGTGGCGGTCTTCGAC TCGATTTTGGAGGAGCTGGAACCCGAGGGCATATGTGCCAAAATCCTCGG TGGTGGAAGGATTCTCAACGAGGCAGAAAATAAAAAAATTAAGATCTATG GCACCTCCAGGGTAAGTAGAGGATCCTTGGTCCTTGAAGCACCGGCTAAT GGTTCTTGATGGGTCTCCCTAGACTTTCGGCGGTGCTGATCACACAAGGA CAAGGAATATACTTCAAGCGTGGACCACTTATAAGGACTTTAAGATAACC GTTAAACAATAAAGTTGCATAAATTTCGAAAATGGAAATTCAGTACTAAT AAAAAGAAAATAGAATATAAAAGTAGCGCTCTTTCAATATTATTAAGGGG TAATCGAACAGGCGATTGTAATTGGCGGAATATGGTTGATATTTCCATTT CTGGAGAGAGTAGAAAGAAGAGTAATTTTGCATTTATAGTTTAGTTCATA CAAAAATTTCTTTCACAAGATACAAGGGCTTAGTACTTTTTGAATGATCA CATGTGCTCCGATTTTCGTGTCAGTCTTGAATTTAGCATACGACCGGAAG GCTTCTGACAAAATCAGTCTAGCTGGAGCCTTGCTACCGTTCATACCAGT TTCTTTTCGGAATATTTCATCTAAATTCCAGTGCGTTTTCCTAAAATTTT TCCAAAATGAAAACCTTGAATCTTTTGGCACCTGTTTCACAATTGTTGAA GCCCCTTCGAAGGCAAAGTTCTTCGCGCGTAAACGCCCTTTTGATAAATG TTCCTAGAGTTCAGCTTTCTAAAGGCAAGAACAAGTACCTTTTGATGATG ATTCACATGCACGGTTTAACTAGGTTCGGCAGGACCATTGTAAGAGGATC CGCCTCCAAGGACCACGGTTAGTTCTAATAATCAGTATAGCTAATACGTG TTCTAATCGTTCTGTCGCCAGAGGAAATCTTTGAGGAAATCCAAAAGGAG ATGGACAAAATTGGAATTTGCGCCAAATGCCTGGGTGGAGGGTTCATCAG CAACAAGGAGGACAAGAAAGTAATGAAAATTTACGGGTGCTGCAAGGTAA GTGGATGAAGTTGGCTACGATCAACCTGATTACTAAAGAGACTGCCTGCA GACTTTTGGGGAGGCGCCGCACGGCAGGACGAAGGACATACTGCTGTCTT GGACCAAATTCCAGCATTACAACATCATCTTGCCCAAAAAGAATCTGAAC GCGTATCAGTGAAGGCGTTTGAAAGCTTGTTTTATTTTTCCTAACTGCCC TGTTGGCAATTTATAATACAACAAAAAATTAGTAAATACATGGCTACATA TCGATTTGTTTTTTCGCTGGGTGTTACAAATTTTCAGCTTTTGATTTTGA GTTTCAGATCTGCTTTGTTGGTTAGCAGCCAAAGTTCAAATTTGGAAATT GAACCAGATCACATCGTCGATAACCGATAGCTGTGCAATCGGAGCCTTCT TCAGGGCACGGTCACACTGCCCCGAAAGTGTAAATAAATTTCAATCAAAT ATGAATTGCTGCATTTGTCAATTCTCGGTACGCGTACCGAAGGACATTCA CACCGATACCGTCGGACATCCGCCGGTGCTGATCAGCGAACTGGTACTGC AGTGCACCCGGGGCACGAATTACGTCCTCACGGAGGAATCGTCGACGATC TGCAAGAAGTGCTGCGAGAAGCTCGCCAGATACCACAAGTCCATACAAAT AGCGCGCAAGCTGCGAGGGGAGATCCTGGAACTGATCCACAGTCCCTACA TGTCCAAGGACCACAAGCAGACCTCCTACAAAGAGGACGATCTCGACCGA GAGACCACCATAAGCAAATTCGATGGGAATATTGAGGAGGCACAGCAACA GGACGAGGAGGAGCAGGAACTGGAGAGCGTGGGCACCACCGTCACCCTGG TCGGTCCCGCCGGCATCGTGGAGGAAGTGGCCGAAGAGGAGCACACCTTC ATTATCAAACAATCAGAGGAGGAGGATGAGTTCCACTCCGTAGACTTAGA GCTAGATATCGACAACGAGATTATCATTAACGAAGAGGAAGCCCACGAGG TAGAGGAGGTGGCCCACGAGATAGAGGAGGTGGCCCACGAGATAGAGGAG GAGGATCTGTTGCCACATGACAAGCAAGAGGCCCAGGAGGAAGACTTTTT TAAGGAAGATACCATGAGTGACTTTGACGAACATCTGGACGGCGCAATAG AGTACATAATATCCGATGGCGAGGACCAGGAGCAGGACAACGAAAGCTCC GGCGAATACACGGTCAACATACAATGCCCCAGCTGCCCGGAGAAGTTCAG CAGCCGGCGCGCTTACAATGTCCACACGAAACGCGAGCACTTTCCCGGCT ACGTCTGTGATCAGTGCGGCAAGACGCTGCAATCGTACTCCGGGTTCATA GGGCACCTGCAGAACCACGAGCCCGTGAAGCAGTTCGCCTGCCCAGTGTG CCCGGAACGCTTTAGCCGCAAGTTCCGGCTGAAGCACCACATGGCCTGGC ACTCCGGCGAAACGCCATACCAGTGCGATGTCTGCTCCAAGCGATTCGTT CACAAGGTGGCCCTGTACAAGCACAAGATGATCCACGACAGCGAGACCAA ACGGCTGGAGTGCCAGGTGTGCGGCTTCAAGACCCGGACCAAGGCTCACT TGGAGCGGCACATGCGATCCCACACGGGGGACAAGCCCTTCGCCTGCCCG GTGTGCAACAAGCGCTTCTCCCAGATGTACAACATGAAGGCCCATCTGCG GGAGCACGAGAGTCCCGGAACCAACCGCCATCGCCGCTTCCACTGCTCCA AGTGCACGCATACTTTCATCAACGAGCAGAACTATGATGCCCACGTTCAG AGAGACGACTGCACGCCAGTTTAGCCCACTATATTGAATATATATAATAG ATAATTATATATTGTGTAAGGCCCAACCCATCATCGACCATCATCGTGAT CACCACCCAACCGAATGCAAGCGAAATCATTTGGATCATTACGTTCTATC CATGTACTTTTTTATTAAATCTATATGCATTTTGCTCACAAATAAAATAT GTTTGATATAATAAATTTATCCGTTACTTGCATATTTCTGCGGTTATTTC AGTTTTCTTAAAAAAATATGTATAGTAAGTGTGTGTGTATGCATTAACTT ATTTGAATAAATCAATCGATCGACCTCGTCCGTTCCGGCCAAGGGCCAAT AAACCACCCACCCATTGTATTCCAGTATTGGTCGCTGCTGGACTGATCGA GCCCCAAATGAAATGTGCCTAATGGTAGATCGGTAGATGCAATTGACGCA ATTACAATACATTGTATAAATACATAAAGTTAAGTGTGTATGCTGTGCTA TAGATATACAAAAATAAAACAGATTATCTTTTGATTTTTTGTCGAGTTGA ATAGAACTTTGTTAATATCATCATATCATCATCATAAAATGCACATTACA AAAATATTAACAAAATTTATTGCAGGCAGTCCGTAGTTAGTAAAAGGTAA CAAACAAATCCCAATCGAGGTAAACCCATAAATCTTCCTAATAATGTGAT TTTGTGCAGTAGTTCCTAAAGATCTCAGTCCCTGGCTGCGGGACTGAAAC GCTTTTCGGACTCTGAACGTACGGCCGCCAAGGTGTGAACATAAAGAGGA TCGTTCTCTCCTACCAATAGCTCCGAATATTCTCGTTATGGATTTACAAA CGTAGAACCAACCACCACCTTTGTTTGGGTGGCTGGTGAATAGATCAGTT TTTGTTGTACAGAAAAATACATTGCCCCCGCAGAGAGTAGTTTGTGATGC TTACAAAAGCCGGTCGCCCGTACATATATAGCTTTTGATTTGTCGGAAAT AGCTTCTCCAGTTGCTAGCTCTAAGATGCGTACACTTGGTGCGTTCGTTA TCGTATTCGTATCTTGCCGAGTGCATCAGTGCACCAAGCCACACTCACGA TTTGCCTTAATACAAAATCTACGCTAAATGCTTAATATTAATCGGATGGC TTGACAAGACCCATCGCTTTGTCTCCGAATAGCGGCAGTATGTCGGAGTC GTTAACAAT