##gff-version 3 ##date Fri Jun 14 16:34:34 CEST 2024 ## exported from the transgeneomics system molecule_59036526 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59036526 mpicbg region 9631 34246 . + . Name=dmel-5.43-3L;type=genome;start=21581436;end=21606051;strand=+ molecule_59036526 mpicbg region 34247 35201 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2436;strand=+ molecule_59036526 mpicbg region 35202 35308 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3813;end=3919;strand=+ molecule_59036526 mpicbg region 35309 54933 . + . Name=dmel-5.43-3L;type=genome;start=21606052;end=21625676;strand=+ molecule_59036526 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59036526 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59036526 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59036526 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59036526 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59036526 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59036526 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59036526 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59036526 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59036526 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59036526 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59036526 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59036526 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59036526 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59036526 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59036526 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59036526 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59036526 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59036526 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59036526 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59036526 coding_transcript gene 20153 35710 . + . ensembl=FBgn0261953;identifier=FBgn0261953;alias=stummelbein;alias=CG7807;alias=AP-2;alias=AP-2alpha;id=51198820;alias=dAP-2alpha;Name=AP-2;alias=lethal (3) 1215;alias=dAP-2;alias=l(3)1215;alias=DAP-2 molecule_59036526 coding_transcript mrna 20153 35710 . + . Name=FBtr0078418;id=51198834;parent=51198820 molecule_59036526 coding_transcript exon 20153 20633 . + . parent=51198834 molecule_59036526 coding_transcript five_prime_utr 20153 20576 . + . parent=51198834 molecule_59036526 coding_transcript cds 20577 20633 . + . parent=51198834 molecule_59036526 coding_transcript intron 20634 30713 . + . parent=51198834 molecule_59036526 coding_transcript mrna 29418 35710 . + . id=51198888;parent=51198820;Name=FBtr0078419 molecule_59036526 coding_transcript exon 29418 29675 . + . parent=51198888 molecule_59036526 coding_transcript five_prime_utr 29418 29630 . + . parent=51198888 molecule_59036526 coding_transcript cds 29631 29675 . + . parent=51198888 molecule_59036526 coding_transcript intron 29676 30713 . + . parent=51198888 molecule_59036526 coding_transcript exon 30714 30944 . + . parent=51198834 molecule_59036526 coding_transcript cds 30714 30944 . + . parent=51198834 molecule_59036526 coding_transcript exon 30714 30944 . + . parent=51198888 molecule_59036526 coding_transcript cds 30714 30944 . + . parent=51198888 molecule_59036526 coding_transcript intron 30945 31013 . + . parent=51198834 molecule_59036526 coding_transcript intron 30945 31013 . + . parent=51198888 molecule_59036526 coding_transcript exon 31014 31181 . + . parent=51198834 molecule_59036526 coding_transcript cds 31014 31181 . + . parent=51198834 molecule_59036526 coding_transcript exon 31014 31181 . + . parent=51198888 molecule_59036526 coding_transcript cds 31014 31181 . + . parent=51198888 molecule_59036526 coding_transcript intron 31182 32437 . + . parent=51198834 molecule_59036526 coding_transcript intron 31182 32437 . + . parent=51198888 molecule_59036526 coding_transcript exon 32438 32645 . + . parent=51198834 molecule_59036526 coding_transcript cds 32438 32645 . + . parent=51198834 molecule_59036526 coding_transcript exon 32438 32645 . + . parent=51198888 molecule_59036526 coding_transcript cds 32438 32645 . + . parent=51198888 molecule_59036526 coding_transcript intron 32646 33289 . + . parent=51198834 molecule_59036526 coding_transcript intron 32646 33289 . + . parent=51198888 molecule_59036526 coding_transcript exon 33290 33479 . + . parent=51198834 molecule_59036526 coding_transcript cds 33290 33479 . + . parent=51198834 molecule_59036526 coding_transcript exon 33290 33479 . + . parent=51198888 molecule_59036526 coding_transcript cds 33290 33479 . + . parent=51198888 molecule_59036526 coding_transcript intron 33480 33539 . + . parent=51198834 molecule_59036526 coding_transcript intron 33480 33539 . + . parent=51198888 molecule_59036526 coding_transcript exon 33540 33804 . + . parent=51198834 molecule_59036526 coding_transcript cds 33540 33804 . + . parent=51198834 molecule_59036526 coding_transcript exon 33540 33804 . + . parent=51198888 molecule_59036526 coding_transcript cds 33540 33804 . + . parent=51198888 molecule_59036526 coding_transcript intron 33805 33907 . + . parent=51198834 molecule_59036526 coding_transcript intron 33805 33907 . + . parent=51198888 molecule_59036526 coding_transcript exon 33908 34075 . + . parent=51198834 molecule_59036526 coding_transcript cds 33908 34075 . + . parent=51198834 molecule_59036526 coding_transcript exon 33908 34075 . + . parent=51198888 molecule_59036526 coding_transcript cds 33908 34075 . + . parent=51198888 molecule_59036526 coding_transcript intron 34076 34138 . + . parent=51198834 molecule_59036526 coding_transcript intron 34076 34138 . + . parent=51198888 molecule_59036526 coding_transcript exon 34139 35710 . + . parent=51198834 molecule_59036526 coding_transcript exon 34139 35710 . + . parent=51198888 molecule_59036526 coding_transcript cds 34139 35311 . + . parent=51198834 molecule_59036526 coding_transcript cds 34139 35311 . + . parent=51198888 molecule_59036526 CLC cds 34247 34306 . + . Name=2xTY1 molecule_59036526 CLC cds 34313 35029 . + . Name=SGFP molecule_59036526 CLC cds 35036 35077 . + . Name=V5 molecule_59036526 CLC cds 35078 35101 . + . Name=Precision cut site molecule_59036526 CLC cds 35102 35122 . + . Name=TEV molecule_59036526 CLC cds 35123 35194 . + . Name=BLRP molecule_59036526 CLC misc_recomb 35202 35235 . + . Name=FRT molecule_59036526 coding_transcript three_prime_utr 35312 35710 . + . parent=51198834 molecule_59036526 coding_transcript three_prime_utr 35312 35710 . + . parent=51198888 molecule_59036526 coding_transcript gene 36150 39721 . - . id=50555728;ensembl=FBgn0037105;alias=S1P;alias=CG7169;identifier=FBgn0037105;Name=S1P;alias=dS1P molecule_59036526 coding_transcript gene 39995 42230 . + . Name=CG11307;id=50555861;identifier=FBgn0037106;ensembl=FBgn0037106 molecule_59036526 coding_transcript gene 42357 48004 . - . identifier=FBgn0037107;id=50555801;Name=CG7166;ensembl=FBgn0037107;alias=CT22143 molecule_59036526 coding_transcript gene 48623 50673 . + . identifier=FBgn0037108;alias=2-mannosyltransferase activity;id=51446488;alias=putative alpha-1;Name=CG11306;ensembl=FBgn0037108 ##FASTA >molecule_59036526 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACTTCTAGTTTAACAAAGTCAT GGATTTTTAATATTTAAAGCCCAGTCAAATGTACATTTTTATATCCCCTT TGAAGGCGACTCCATATCTCAGATTGTAATCGTTTTCATCCCTCAGATAT CGTATTTATCCTAATGAGAGAATATCAAAACGTGACAATTTTACTTTCAT ATCCCGTGGCTATCTCAGTTGTTTGATAAACAATTTTCTTCAAGTGTTTT GTTCGAATTGAAGAGACGATTTGAGTTTTGCATATGCGGAAAGTGGTGTG TTCGAAATTTTACATTAATTAATTCCATATCTCGATCAGAACAGGAAAAC AATTTATGTATATTTTTAATTAGAATCACTCTATTCAACCAAGTGCGTTG GTCCGTAAAAACTCTTCTTTTTATTGGAGTTTATGTCGAAAATTCCGTTT GTATACATCAGCTTTTTGGCAAAATTCGTTTTTCCAAATTTCGGTTATCA AATAATCAATTTTTTTGTATCACTACTTTAAAAATAATTGTCTGAATATG ATATGATTACGATTAATTTTTTGTGATATATGATTAAACATGCGCCGACA AGCTGGTCAATACAGTAGATTTTTGTAACTAATTAGTATTACTGCGTAAA ACTTAGCGTTCTTGTTTCGAATTAATTATATTATGATCATAAATTTAGTG GTAAAAGCTATAACATTCTGTCGTTTAAAATCCTATGTAGCAATAAATAC AAATATTTTTCAACAAAACGATTTCAAAACAATCATATTTCTGAGCTATA TAAAAGATTAGCAGTTATTGATGGGATTTCGGTTTTGCAGGTTTGAAAAA TAGTTTAAATAATAGAGTGCGATTGTCATCCTTTTCCATTCATGTTCTGT AAGCAGGACGAATGGGATTATTCCAACTGGGTGTTCTTTTCCAAAAGAGC GTATGCTTATCTATAACCCTAACCCCAGGATGGAGTACACCGACCCCCTT TGCATCTCATTTTCAGTTTCGTTGAAACTCAGATTGGCATGCTCATGGTT GCCGCCTCATCGCCGAGATCAAAATTCGTAAAACACCAGAATTTGTATAA TCTAGCGGAAGTAATGGCATTACCAGCACAGACGTTGCCCACGGAGTCCA TTGTAGTTAAATGCCAATTATATGCATAAAGGGATTTGCGAGATAATTAC GGAATAGCGCCACGACATCCTTATCCACATTATCCAATGTTCTGGGTAGG CTAATAATTCGATATGTTAATACTTCGCCCGTTTGCGGCTTGGGAATCGG CTTCGAGTTGCATCCTGGCCAAAGAGCTCCGAGTTCGTCCATAATATTGG CACGTGACCATATTTATGCCATTTAATACATGACGAAACACTGCCTGTCC CAATGCAGCGAACAACACTTCGAGGCATATCATCCCATTTGCCCACTAAA ATGCACCCCCGCCTTTCAAAGCGATGCTGGGTACACTTGGAGTTGAGTTT TGAATGAATATTATGCGTAAATATAGTGGGTATAGCTACAATGCATAGCT CAATTAAAATATTCAATGAACTTCCTATAAGAATTCAGTTGATCCTATGA TGATCCCATGTATCCCTGAAATGGGTAGTATAACTCATCAGCAAATTTAC GCTACGCAACGTGCTTTTTTCTGAGTGTTCCTGGGATAATCTCTCCGTTC CCGACCAGCCTCCCTGCCAAGTGCGAAACTGGGCCGGGCGATGGGCGGAC GAGCACTTCAAGCTAAAAAGTGAAAAGCCAAGTAGTGCGAGTGGCATCGA GCGGCGCTGCGGCGACACGCATATGTTTTTCCTGGGGCCGTGCGGCCGTG TTTGTTGCTTCGCAGGATGCGCACACCTGAGTGCTCCTTGATGGAAGCCC ACAGCCCACAACCCACGACCCATGAACCCGACTGGAAAGCAGTGCGGAGC GGAGCGGAATCGATAGCTGGGGGCTCAAGTGGCCGAGGAGGCTGGTCGGA AAATTATATGGCAAACACACTACAAACACGGAAGGATATACATTACGAGG GTGGGCCACGTGTCCCGAAAGCCGTCGTTTTAATTAAGTTTGTAAAAAAA CAGGGCCACGATCCGCGAGCGTCTTTTGTCAGCAAATTTCCCATTTGATA CTTTATTTACCTTTTGTTGATATTTGTTGATACGTTTACGTTTACGTCCA TATTGGGATATCGATTTCAGGTAACTAGCCGCAGAATTATCACAAGAGAT TACTTTTTATACCGGTTACTTGTAGATTAAATGGGTATACTACATTAGAT CCGTTGAAAAATATGTAACAGTTGGAAAGTTGAGAATGTAGATTCTAGAT TAATAAAGTGAAGATTTAATAGCTAACCAAGAGCTTATTATTTATTGACA GTGCTGTATATTTAAGTATCTGTCTAGCTTAAAATTATAATAATAATGTG GCTGGCTAGCCAAATTGAAAGTGGGTTACATTATGTAAGTGAGGTTTTTT ATTTAAGTAACTACTGTTGACTTTCGTATGAATATAGTATCATACATAAA TTAGTACACTCAATTTTAGATTACATTTACATTAGTATGAAACCAAAGTT CCTTTATATCGTGAATATTTGCAGAATAGAAATATACCTTATGCTATTAT GCTTAACAAAATATTAATCATGAACTTGCGTGTATGATAACTTACTTTGA CTATATTCAAGTAACTTGTCTCAAGTTAACGTCTATCTAAATGTAGTTAA TGTAGTCTTTGTAACTAATAGTTTTACGATGTTTAACTTAAGCAAGAGAT ATATTCAGGTAATTTCAAATTTATGAGAGGGTGCTCAATCAAACATAATA CAGCTTGTGGGTTGGAAGAGAGGTAGGTTGCTTATGTATTTATTTAAATC ATTAGTCATTGCAGTTCCATCTAAAGGTAATTGCACACACGTTTTAAGCG CATTTGGGCACATAAATTAATACATTTCAATGGAGGTCGTGTCGCTGGCA AGGCAATATCACTGGCACTGGCAATGGCAATCGGAGTTCGAATGCAGATA CGTGACGGGGTCCTCGCAGCACTGTACTTATCACGTGATTTATATTAATG GCGGCATATCATGTTTCACGCGTGCTCGCTCGGCGCTGGTTTTGACTCCA GAACAAATTTGTCAGTGGGGGTCGGCACGCGCTGCACTTTCGAATAAAGT CATCGCCAACGACAGGTCGGCGCGCAGCAATGGCAAATCCGCAGATCCAG AGACCCAGAAATGCACATGGATGCATGGATGCATGGGATGCATGGTTGCA AGGATCCAGATGTGAGTGTGCCCCGACTGGGACAGACCTGGCACCTATTG AGAGCTGGGCTTTCGCCATAAAACAAAGAAATATGGGCGAGAAGAGCCAG TTGTTTATGATGGAGATGGACAAAGCGGCTATAAATCTTCATCCGCAAAT GCCAGATCGACTTATTGAAGTCCAGGGATAAGCAGAGGCATCATTTCAAC GATCGGCTTCTAGGCAGCCAAGTATCTGCATCTTTAAGCTTGTGTTTCTA GTTTGGAGGGCCTATTATAAAAAGCCATGGTATCAGTATCTCGTAAAGCC GTCACATCTGCAAATAAATTTATTCACTCTGTATTGGAAGTATGGCTCTT TCCTTTGCACCCAAATATATTCAAAGCACCGAAAGGCAAATTATGTTAAT TGTACGAGATTCCGCTACTGTTGCTGAACATCGGGGCCGTGTCATTAGCA GACATGCTTAATTATGGCATGGGTTTGGAATCGTATTGGCTTCAGAACAT GTTGAAATATCTCGTATCAACACGTTTTCGTGCTGAAAAGGCATTTTGAG ATTTGTTTTTGGTTTCGAGAATGCGAAGTGCGTTAACGAATAAGACGAAT TGTTGTCTTAGCATGCTCAAAATGTTTCGTCTTAATGCAATCTTGGCCAT CTCCTCCGAAGACCACTTCTCTATACACTCGCCGAATTACTTAAGAGTGC GCGCAGAAATGAGGCAAAATGCGAAGCCCTAATGATAGCTGCGGGCGAGT GGCACACTAGCTATTCTCACACGGGGCCAGCGACACCTACTCGTACTACC AGGCCAATCCCCGACTCCACAGTCGAAGTCCACCAGCGGATACCGTTCCG CGCCATCTCGCCATCTAGCCACCTAGCCACCTAGCCACCTAGCCATCTCG CCCTCTACGCACTTTTCAGCCCATCTAGATTCAGAAACGCATCCGCGGGC ACTACACACTCGGTTGTCCCTGCTCCACAGATCGCAGCTGTTTAAGTGCG TATAACTAGGTAGAGTTGAGATACATATGTAAATAGGTAGGTACAAATAT ATGCAAATAGGTAGGGGTGCTTTGGGGGAAAACTCTGCGTTCATATGTAC ATATGTGCGGCATTAGGAGTGATTAATGCGCAGATCCGTATCAATTTAGT GAAAACTGTGTTTTTACCCTTCGAGAAAGCACCAAAATATACTATTACAT ATTTCAAACGTTGGTAATGATTGGTATTTGTTTATATTTTTAGCAATAAC TCATTAGTTAAATAGTATGGCAATGTATATCATTATTAGAAATCTGGTTC AAAAACATCTTTAAAATTCTGTTGGTGTCACCAGAACTTTGCTTTTATTT ATGTAAGATAGCAAAATTACTTGAGTGACTTTTTAAAGGTACACAAACAT TGACATTTATTATTATTATATCCTAAATCTTAGGTTTTAATGGACTAATG CGGAAGGAGTTTCTAAATCATTTTTAAGAGGAGCTTGAGAAATGAAGTTT TGGAATACAGTAGCAAGATTTTTTTGAACTAGATTTCAAAATCCTTTGAA GTTGAGTTGATTAATTTAATAACACTATTGGATTGCAGGATAAATCGCAT TGTGGCTGAGATTGTGCCCCAGATATTGGTCTCATTTCGTTTTGTTTTAT CGCCGCGATGGCATAATTACACCATTTTGGGAGCGTAAAAACGAGCGAGG AATTAAAGACAGCTAATCATTATTAAGCGCTTTAATGATTTTATAGTCCA ATTTATATTCCTTAACAACCACTTGCACTCGGCCAAATGCTTACATCTCT TATTTGGCTGTTTGCTTTTAATTTTCGAAGTCGGAGTCTGGAAACCAGAA CTCACAATCCAGGATCCAGAATCCAGAACCGAGAATCCGTCTCCGCAGTT ATTTATCGCAAATTGGATGCGAATGTGTGTCTGAGTATCTGAGTATCTCA AAGTCTGCGCCACTGATGCTGATGCGATGCCACTCGGTTGTGGCGATTCG CTTGATTTAATAGTGGCAATTTCGTTCGACTCCAACGCACTGATAATTTT CTCACATAGAAATCCGTTTTTTATAAGCTAAAAAAAGGCACCGCACGCAA TTCGGCATTCATGTTTTATTGCCTAATTAACTGGCGCTGACCATTTCACG ACCTCTTGTGCGTGACGCGTGAAAGGAGTTACGGAGCCAGGGAATCACTT ATTCCGACGAGAAGTACCAGGAGTAGGAGGCGGAGGAGCATCAGCCGGAC TCCTGTCCGCACATCCTAACCACCTAATGGCATAGGGGAAATAGGATTAT AATTATACGCAACGCTCAAGGGTCATTAAACTTATCTCTCGTTTGAGTAT CGCTTGGGTGCATACACATAGGTTCTAAAAATATGTATTATGTATATTAT AGATGAATAAGTTGATATAGTTAATAAGTTATTGTTCTATACTCAGGTCT TAACTTCTAGCCAGTCAGAATCCCATTATTTTATAGGAATGTGATGGGTT TCAATGTAATGCATTTAATTTACAAGTATTACGAAATGGCATAGATTATT TTAATCAATAAAGAATCGGTATCTGAAACTTTGGGCTATCTTAGGATAAT CCTTTCACTCGATAGTGTGTGTGTGTGTGTGCAGGCGAGCGATATGCTCG CAATTTATGTACGCAATCGCAATCTACGGTGGGTAAACACAGCTGCAAAT GCGTTTCCTTTGACCTCGAATTTAAATGGTCCGCCCTGGTGCTCCGCGCT CTATCGCCTATCTGCTCGTACGCCGAATTGCGAAAAACAGAGCGGATTAA AGGTGCACATGAGCACAGCCGTAGGAAATATGCTGCAAACATCCGCCATC CGCCATTCGCCATCCGCCTGCTGCAACTGCATCTGAAAACGCACACACCG CCGCACAGAGAACCTCGGTCGGAGCTGGGGCACACTGAAAGAAATAAGCG GTGCACTGTCCCGCTCAGGCTATCACAATAGATTTTGAGTTAGTTCGTAT ACATAACATATATACGCTTTTCATGTTATGTCGTGCATTAGCCAGTCACA GTTTTTTTCCAGTGCAGGTAGGGGCAAAAGCTGGGCAGCAGTAGAGGACA GGAGGCTGGAGGAACCCAGGACTGCGACGAGCGCGGCTCACTCGCTTATC TTCCCCGCGGCTATTGGCGTCGTGCAACATTGCAGGAGCCGGAGCAGGAG CCTTTTCCTGGGCCTGCGCTGCTGCTGCTGGAAGACCGGCCAGAAGAAGA GGAAGGAGGACCTGGCGAACGGACGAACTGGCGAACTGGCGAATGAGCGA AGAAGCGACCATGGGCCATGGGCCATGGGCCACGACCATGTCGCTGATGA TTCGCATTCGTGTATCGCAAGCGGGCCACAGCCGCAGCTTTTGGCTTCCC CCGAAATTTGAATCTGCCTGCATCTGAGGACTTAACGAATATGAACGAAA TGGCCCGGGGCTGTTTCAAAATATTACCACACTCGAGTATTCGAGCAGGG CTACGTACTACATATACATGCGTTGGACTCCGAGCCCAAGTGAATGCGGA AAATTATGGCGAGGTAGTTGCAGATACAAACACTCAATCACAAGGGCTCC ATTTGCATACGCCGCTCCCCCCGCCCAAGTCCAGTCCAGAAATCCATGAG GTCTAAGCAGTCCCATTAGCCATAACCCCTAGAAATCTTAGGCTCTGTCC TGGAAGTGCCTATTCCTTTCGCTCTGAGGGATTGTTCCATTTAAGGGCCT TCTGCTCTAAAGTTACGTTCGTTAATTAGACATTTTTCTAGATGCATTGT GAGCGGGGGAATTTTTAGTGGGCTTATTCAGAATAAATCTTTGGGTTATA TTCTACTTATTCGAATATATACTTACTTCTGTCTGTGTGTAATCTTAGAA GGAGATCAATCGAATAAGCAATAGATGATCGTGGTGTTACACCATATATG TACATAAATTCTTTCGAAAAATTCAGAAATGTAATTAGATCTTCAAGTGT ACGGTTTTTAAAAAGATTGTATTGTAGTAAATATATCTCAGTACTAGATT TAAAAGTGATGATTTTTGTTGAATTGCCTAAGAAAGTAAATACCTTTCAA CATTATTTCCCATGCTACAATCTAATTACATTTTTGGTTGCACATCGTCT GTTAAAATTTTCGGAAAATCACCACTCGAGAGCTGATTGTGATTTGCATG TGGAATGGATTGAAATGGAATGCACTTGTCTGCGGCCGGCAAGGCGGACC AAAAAGAGCGGCTTGCCGCTAAAGGAGTCGCTTGAAGTCGGAGTAAGTGC CACGAAGCCACAAGTCTGGGCAGTAGTCATGCAAGTCCTGCGGCATTCAC GAGTTTCCCCCCGGCGATCGCATTTAAGACGCATCTTAAATGAGGTGCTC AGGCCGAGTCCTCCACTCTTGGGCAGTTGCGATCCCCAGCTCCTCGGCTC TTGGGTTAGGAGCCTCCCGGTTAAGAGCCAGCTTATGACTGGCTCAAAGA AAGCTGCCATTTTCGGGAGTGCACTGGTATGGGTTGGGATGTGGATGTGG ATGAGGACGTGGATGTAATTGTGGCTGCAATGGTGTAGGTGTGCGGGTCG GTAGTTGGTAGTTGCACAGAGGTGTACTTGGGTGCATTTACCATGGGCAC ACGGACCACTGTGCATCACGATTTATGCCCGGTGCTGCGGGGAGGACTGG GAATTAATTGGTAATGCGAGCAGTGCATCAGTATCAGTATCCGTATCAGT ATCGGTTTTGGCTTTGCCTCGGCATCCGAATCGGGTCTGAAAATGGCGGA CCGATCATCGATCGATCGATCGATGGATGGATGGATCGATCGATCGTTCT CTTGTCGTGGCCGCAATCAAAAGTCGTGCCGCCGCAATGAAATCGCTGAA ATGGAGGTGGGTCGTCCGGCATTCCACCGCCGCAATTGGATAATGCACCT GATCGCCGCTTCCACTCCACTGCACTCCACTCCACGAAATTTACTGTTTG GCCAGCTCCTCCGAGGTGGCTTCGTGAGTGGCTCCGCGTACATAATGTGC ATGTGCAGTCGGCGAGATCACGGTTTCACATCTCATTTCGCCCTGCCACA AATTCGGACTTAATGACTGCGTGCCCGATATACTTTTCCTCCGAGCTTCG CTCCTTCTTTCTCGGCTGAACTTTGCTCTGCTCCCCTGGCAACAGAAGAT AGGAGCCCGAATCCATTTGAGTCACTTAGAAAGCTAATGGCATAATTCAA TTGGGGCGGACAAACATTCAAAGCTCGGGTTGGGCAATCCGCCGAGTGAT TCAATTTTCCACAGCCGCTAATCCTTGTCCCGCTTACTGGCGGATCTAAT TGTGTAACCTGAAAACAAAGCAGGAATAAATGAAATGAATGTCTCTTGAG GATTGCGACGCTTACTTTCAGCTTTTCAGCGTGGTTAATAGAACAAGGAA TTCAAATGATGGAGATTCATACAGAACACCACGTTGATACTAAAGATTTA TTCCTGGTGCTCAAGACTTATCTAAGTCAGCGCCTTTTTAACCCAACTTT CACACTTTAACCAACTTTGTTGATTTCTATGGCCTACTAACACATGTAAC TTATAAAAAGGTCTGCTGGTCTAAACGGTGGCAATGGTTGTATTTTATGT TAATTGATTAAACTTTTTTTGCAAAGTCCATATTTTTGGATAGTTTGACA CAAAACAATATTGACGAATAAGAATTTTCAGTATGTTTCATTACCTTATT GCTATATTCATGAGTTTGAGTAATGAACTAAAGTTTGCAAAAAGTATTTC GATGCCTTAACAATATCATATAATCGATTTTCTTGCCATCCAAAATTTTT CCTTATTTTCATCTCTATTACTATATTTTTATGGCTTCGCATATGAAAAG TCGTTGACTTTTGTTATTATTATAATTGTTTCATGAAGTACTTATAAAAA TCTAACAAATAATTGACTAATTAGTTAACTATCAATATTTAATTTTAAAA AACATCAGAATGGGTAACTTCTATAGCTCTGAAGTTAGTGAAACATAATA GTGTTCCTGATTTGAAGTTGTGAAGCACCTGTCCTTAAATTAATTTTCTG ATTTGTTTCGATTTTTTTAATTATAATCGTTGTAAAACTAACTATACTAT TTAGATAAAGGTTATTAAAGCGGGACACAAGTAAGAAGTTTGCTTGTTAT AAGTTCATTGGCAAGCCAAAATAGTTTGTTTATAGTGAACCTTTAATTTT AAAGAGTGCTTTAATTGTCCTAAGTTCCTCTATCGTGTTATATATAAAAG GGAATTTGTAAATTAGAAATCTTTAAGCATGCGAAGTGGCCTGCTGTTGA TTTTCCGTTTGTTTAATCGTTTACAAAAATTTTACCCTCAAATGTTCGAA AGCTACAGCCATAGAAAAAATAAAAATCTGCTATTTTCAGTTTGTTTTGA TTATGGCGAGCAAGGACCCACACTCACGCCCTTACATATATGGGTAGATT TTTATGTAGAATATGTAAATCGGGCGGACAGCCTCTTTCACATGGCAACC CCCGAACGTTCGATAAGTACGTAGATACATACATACATAGGTGGGTCGCT TAATCCCCGAGAGAAGAAAGAACCCGGAGCACGTACCACTGGCGATTTGG GCGTCCAATGCCGGGGTTTTCCCAGTAGCAGCCCGGGCTCAGAGATCCAG CAACCCTCGGGGCACGGGTGCGTCGCCAACCCCGGCCATTCGCATGCGAT TCCACCCCTATGTATTCGTATTCGTATCCGTATCGCACTCGCATCTCGCG AGCATCCGCATCTGGCAGTGTGGCTGTGTATCCGCATCTGTGTGTCTGTA CGCGAGCTGCGCTGCCTGCCGCAGCCTCTGGGTTTTCGGTTTTCGGGCTC GGCCCATTGTCTAGTAGTCCGCTGGCGGGGCGTGGCTTCCGAAATATAAA TGGCTGTGCTCTCTTTGGGCGGCGGGCTCTCTTCGGAAGCCGCTCTTCGA TGCCCGAAAGCCAGAAAACCTGCTTGCCCGGCGTATCTGTGTGCGCCTCA CACCCATACAGACGCGCGGCGCACGGGCATAGGCTTTGGGCACTTTTCCT ATGTATTTCGCAGCTGTATGGGAGAAAAAACGGCAGCAGCCGCGGCAGCA GCAGCATCTGCAGCAGCAGCAGCAGCAGCCGCCGCCGCAGCAGCAGCGGC AACATCGCACATCCCCCGAAGGTTTTTGCGTCCAACCAGAAAATCCAACT TCAGTCGAGAACTACGTCTGGTGGCTGCGCAAAGGCGGAATTTCGATTGC GGGTCCTCGCTTAATTAACCAAACCAAACCAAACCGAACCGTACCGAACC AAAACCGTACCGAAACCGCTCCGTTCCGTTCCGAACCGATCCGCACCTAG CCGAACCGAAACGATCGTGGATCCGAACTGCAAATTAGTTCAAATACAAT TAAATCACGTCTATTGTCCTTCAATCGGGGAGAGTGCAGTGTATATAGCG GCGGATACGGAACTCTAGCTCCAGCACCCACAGTTGCCTTAACCAGTGCC AAAAATCGATTTTCAATAAATACTTATTTAGTGATCGTACCTGTTTTGCA TTGGCCCTGGCCCAAGTGTTCAAAAGAAAACCTATGCTCTCCAACTAGTT GATATCGCCGTCTAATTTGGATCAACATGCACATTCTACACCGCACCAAC GACCATCAGTTCGAGGATCAGAAGTTCATGATGGTAAGCTGCGCGCCTTT TGCAGGATACTTCGATCGGAGGAGGGTCGGGTCTATCTATCCAAATTGTC TGTCAGCCGAAATCTGCCCAGGCTAATCCCCGCCCGAGCATCGGCGCAGC TTTAGCTACTCAAAATACTCAAAGATATTGAACCATCGAGTGCCCATGGG CGGACGAGCTTGATTGACACTGAAATTTCTTTGGGCATTTTGGGGCACGC AAGCCTTAAAACCATTGGCCAATTACGACCATTGGCCAGCGATCCGGACC GAGAGATCTGCGCCCGTGATTCACATTCACACACAAGCTGATTACCATTC CGGGCCATTCTAGCAGCAAAATCAATGAGCAATTTACAGTAATGGGTTCT CCTGCGACTCCGTGTGGCACACTCTGCTCTGGGAATAATAAGTACATAAA CTTCAACCTGATTGTGCCCACTCCAAGAGTCCGGGGATCACTCAAGTGCC CAAGAGGGTGTGGGGCCCCGAAAGCAGACTGCGATCACAGGCGCATGCAA TTCTCTTGTAATTAGAGGTCTTAAACCTTGAAAATGCATCTTCAAATTTA AATTGACTTTTTAAAGTAGGCAGTCTTAAACCTCAAGGAGTCTATTTAAA AATTTTATTAAAGTCAGGATCTAAAACCTGAATACAAACGGTGTTTGTTT ATGGTAATCAGACATTCAAGAAGTCAGTTTGCTTTTTTTGTTATCCTAGT CGAGATGCATTGGACACAAATGGACCAAATCGAAATCAAATGTGCATATT CGTATTCAGATTAGGTAATGTTCGATCAGTATCAAAGTATTAATTTTAGT TTCCCAGTATCCTTATAGGTTTTCTTGGGCTGAAAACTCTTTACTAAATG CAATTCTCTATTCAAATATTATAGGGCGACAAGACTAAAGAATATAAAAT CTTATTGAAAAAGCCAATGGGTCTGTTAACTTATTTTATTTACTTGTAAT TGAGAAACATACCCTTAAAGGATGCAATGTTAGTTGCACTCATTTTTAAT TTTATTCTGTTTTTTGAACGGGCAATTTGGAATCATTTATTTTTTAAGAC GGCAAAAGTAGCCGTCGGAAAGACGAACCTTAAAACTGTAGCTAGCATAT GTATATGTATGTGTATGAAGTCCACTGTTTTTAGAGTAATGATTCTTGAA ATCTTTTTAATCTTCTTTTAAATTTCATATACAAATTTATCGTACAATAT TTACAGTCTTTGATCGTTTATAATATCTATAACTGTAAATGTAAATCCAA GAGAGAAAGCCATGTTATGCTTTCTATGTTATTTCGATTAAAGTCTCTAT AAGATTTGTACTCTTAGTATTAGTATTTGTATCATCAGACATAAGCCTCA AATTAAGCGGTTTGGCTGTTTCAAATATGTGCGTTATGGGAGGGAAACCG TATCTGAAAGTAAAAAAGGTCCTACATTTAATGCACTCACGATTTCGAGG CAGAGAGCAAAAAGTGACGGCGGTGGGAGTGATCAGACGTCAGTGGTCAA AATTCAAATGCGAATATGGAGGAATTCTTGAAATGCGTGGGTACACGCTC CCCCATTTAATTAGCGAAATTATATGGTGTTCTTGCTTCCAAGAACTTTT TCGATGCCCGATAAAAAAATAGGGCAATTTGCGGGGCAAGGGCCAAAGAT CAAAACAAAAACACAGCGAAGAGGTAGACCAAAAGTCATCGCCCACAAAA ATCCGAGTCCCGCCAGCAAAGTGGGCATGTCGAGTGTGTTGGCATTAGCT TTGGTTTTGGTTTGGTTTGGTTTGGCTGGTCCTGGTACTGGTCCTGGACC TGTCCCTGGCACTCCGAAGACTCCCAAATCAGGTAAGATCCCACTGGGAC ACTCGCGTGATGCGTTGCCAAAATAATTTATGAGATTGAAGCGCAACGCA TCGTCAATTTGCGTGCGATCGCCAACTAAAAAAAGAATGCCATACAGACT GGCAGAAAAGTTCCCATAGCCCAGCTCCCAAATATCAAAAAGTATTCAGC ATTGGGCTTATTTATTAGCCAAACTCCGTTTCATCCAAGAGGTTCGGGCT CAAAGCCTGATTGATGGCTTCCCTTATGATTTATTGAATAATTTCTTTAT AATTTAGAATAATTGTTCCAATTTACAATGTGCACTTTGTAGGATTGCGA GGCATGTTGGTATGGTAATTGTGCGCAGGGCTAGGGATTGCATAAAGAAA TGAATAAGCGCCATTAAACTTTCCCCCACTTCCAGATGCAGGAATACTAT AGTCTTGATTAAAAGTAAATTATATAAATGGAACTAGAGGAAACTCGCAA TAAGATGAATGAAACAATTTCGATAGGATCAGAGTGTAAGACCGATCCGT GTTCATATTTGCATATTCGCATATCATATTTATTATTTCGCCAGTGCGGG CGAGATAATTCCGAGTCCTTTGCATCCGCTGGAAGGCATTTCCGCTTCCA CAGACATGCAGATACATCCTCGGAGGAAACTGGAATTGCATATGCACGCA TCAAAATTGATTTCATTTGCGGAGAGGAAATTAAAAAGTCCAAACAAAAC CAAATTGATTGGCAAGATAAATGTAAATGTTCATAACGTGGCCAAGATCC TCAGCACAATCCAGAATCAAGTGTCGGAACCTCGACGATGTGGACGGCGT GTGTTAGGCTCGTGGCAAACCAAAACCAAAACCAAAGCCGTGCAAAGCAC CACATCCACATCCTCGTCCGATGCCAAAAGCCAAGGCAAGAGCGAAATCA TCGGTTGGCCGACATGCGTTGGCCTTGCCTCCTCGGAGGCAGAATGTGGA GGATGGGGAGGCCAGACCTGCAGTTGGCTCACGAGGCTGCTGCATCGAAA GCCGGCCCTTTGGACGCAGATTGCAAACGGACGAGCCGAGCTTAGCTCAG TCGAGTTCGGAAGAAGCTACACAGGGAGAATCATTGGGTTGTGAGGAGCT CAAAAGGAGATCACAATGCCAGTGCATGTGGAGTTCTTGTAATCATAGTT TCCAATATTTCTTGTTTATCTTATAATAGTATAATATAGTATTAAAAAGC AATACATATATGTAAGTTTATCGCATGGTCATATTTCAATTTGCAGAACG AAGTAACCTTAGTCCTATGTATAATTAGTAGTGAATACTATATACGGAGA TTCATGTAACATATCGTATAATTTGCATACTATACAGCAGCCCATAAACA AAGTGGTTCTCTTACAACACTCTCGACCTTTTCTCGCAGTGCACATGCAT GGTCGCCAAGTGGGCACTTTCGGCTCGTCGTTCTTCTATTCGTCATCTGC ACGCTAGAAGATGGGACGCAGCTTTTCGATTTTGGCCGAGCAGGCTCCGC AAATACCCAGCAGGTTTAATACATTTATGAATGGGTTTTACTACTTCATT AAGGGCTCCTCCGCTCTTCCGCGCATTTGAGGGCCAAGGAGCTGGAGCTG GAGCTCGAGCCGAAGGAAGAGACTGAGGATCCAGCCGAGCTCCAGCTCTG CGGATTGGAGCGCGTGCGCAGCCAGGAGGAGGAGGAGGACGAGCAGGGCA GGAGTACCTGCAAGAATCGTAATAAGCAGAAATCGATTATCGTCCGCTGA ACATTTCCATTGTTGTTATGAATATTATATGCAGCGTTTGGAGCGAAGCT TCCTCTTAAATTCGTTTAATTTATAGCTCTTCCGACAGTTCCAACTTGCA GTTCCAATAAATGACAGCACCGGACGTCGAACGAGTGTGTAATCTAATTG GAAACGAGCGCGGCTTAGGGACCCACTGTACTGCCGGTTCGCGGATGGCC AGTGCAGACCATATGTAAATTCGCGCCCGAAATGCGCAGAATGGATTCTT TATTTACTGACAATATTATGACAATGCCCGCATGAACTCGGCCTATTCTA TGGCCGCAAGGCGGTCCTTACGCCACTCGATGTTTCCATATAACCTGGTC ACATCCCTCCAGAGTATTGAGGTCCAGAGGGATGCCCTCCTCCCCTTCCT GGAAGCCCACCATCATTCAACTTGACAGCGTAATTAAAACGACTGGTCCA CACGATGAAAGTGAGGAGTTTTATAAGATGTTAGGGCCTACTTGTTTTAT ATGTCGCAATATAATTGGTGGCATCCAAAACCCGGAGACCAGGTAGTGGC CGAAAAAAATGCGAACATCGAATCGCGCAGGCATGTTCTTTTCTTGGGCG GGCACTCTTCTGCCAGGCGGAATGATTTGGACCGGCAATTTTGGTAATAG CGGCATGCCGGGATCGAGGCCAGCTCCTGTCCATTGCACTGCTACTGTAT AAGTATCCAGAGTCATTACGTCATCGGCGAGGAATCCGGACGTGATTGCT CTTATGGAAGCCACGTGCTAATTTAATTATTATTTGCAAATACTTTCAAA GTGAGAGCCCCTCGACTCTTTCACCGCTCATTTTCGATTCTTGATTTAAT TTACTTTTATTGATAGCCCTCTGGCTGAGTTTTTTTTAAGGCGATATATT CGAGAGAATATCATCGTATTCTTCATAGTGGTTTGGTTCACTAAGTTTAA TGCTTTTCCTATGGATATAAACACTAATATCAAAAAGGGGCTGAAGTTAA GTTAGGACCAGAAAAATTTAAGCTATACTTAAGATAACTTTTGATATTCT ATTATATTTTTATATAATATAATTCCTATTTTAGGAATTATATTAGTATA TCTTGTTTTTGTGTTCTTTTTAACAGGATTTATCTGTTATCCCTACTGTA ATAGGTAGTAAAGTAACTATAAAATTTGTAATACCAAATTTTTCTCTGAC TTGCGCATTTGGAATTTCCAAATGGTTATTGCGATTCTTGCAACCAAACT CGATCCTTTAACAAATAAAAGAATATTTTTTAGCAGCTCCAACATAATTT AACTCCAACTGATACAATTTCTAATAAATTTGCAATTGCTTAGTCATTGC TTTAATACATGAAATTATTTCGCTGTACGTTAAATCATACAGCAAGGACT TTCGTCGTCGTTTTGGCACGTTCAAAATTTTGTGTTTTTTTTTTTATATA TTGCTGTAATTTGAATTTGTTCAAATGTACTTGGGGTATAGAGCCACCTA TGGGTGTGTGGTGGTGACCTTTGCTGGTTCAGTTATCGAAACATAGATGC CGCCCACTGCGTGTACGGTTGTGTAAAATGCATGTAAAGTAGCAGAAGTC CATGTATTTCTGCAAGACACGCCCATGGATACTTTAAATTCTGGATCTGG ATTGCTCTTTGAATCACGTTAAGAGAAATATGCTTTTCTGCAGAGATATT CACATTTCACAAAAAAAAGTTTTATTCTGAAGGAGATGTTTTCGTAACTT ACAAAATATGTTTTTGTATTGCTTCGTACTAACTGAAATCTAATGAAATT TGAATTAAAACGCATTTCCTTAATTGCAAAATTGCAAATTTCAAATGTAA TGCACAAATAAAGTGTTAAGGTTTGATAAGAAGGTTTAAAACGTTTTTGT AAAAATTTGCGTCGATTAGATCAAACAGTCTTCGCAAACGAAAAGCCGGC CTTCTTATACTACACCATTTATTTGCCATCTTCAAAAATGTGTGTCATTG ATTTGGAATGGGTAATTTTCCACTTCAAAAAATATATTTTGATATAATAT AATTTAAAGCCAATTGAATGGCTCTAAAGCGTAGGAACTAACAGAGGCAA CATAAAATGAAAACATATCAGCAATGATAAATTACAATTTTGAATATAAA TTTAGATTAGCTAATAGTTTTGGAAAGTTGTGTAGAACTAAATATGTAGA TGGAACCGTCAAACAAAACCATTTGTGTTTACAAATTATAATTAAGAACA TTATTTTATGTATCATGTTCTACATTAAACTCTCAAATATTATTGCTATT TAAATGAAAATTTTTCGGGCCAATATAAAGTTTTTTGTATGTATCAAGGT CGGACTATTGCTTCGCCAATGCAAAGGTTCTAGGAGTTTGCATTTGATTC AAAAGGTACGAAGCACGGGACTATCTCCAAAAATCTTTCAGAATCTTGTC CTTAAAATCTTTTTATATCATTATTATGGTTTACTTTTTACTGATATACT GGTAACATTGTAAATATTTAACTAGTAAGTAGGATGCGAGAAACGGCGTT AGAAAACGGATCCAATCCAGACCGAAATGAGACTGGTCCCAACATCGTAA TAGACCAGTTAGAAAAGTGAACCCTGGGTCTGGAGTCAAAACTCTTTTAA TGGCAATTGATCACTGGCAAGTGGATAACGTTTCATTAGAATATCGGGTG AAGTGCGCATTTATACACGACGTGTGTGTGGATTGTGCGTACATATGTGA GCCGAGATCTGCGAGCCAGGCTTTGTGTGTTTTTTGTATGACCGTCGTTT GGAACAGAACCCACTTGAGGTGAAACTATTTCGACCTGCCCAACAGCTTC CAACAGTCTACCTGTACCTGTGCCAGTGCCTTTGCCTTTGCCTGTGCCCC CCAAAACCAGATGGTCTCTGATCACCGAGCAGCATTTGAAACCTTTATAA TTTATTTATCTTTATCTTGAATTACGCCATGGGAGTATTGACCACCAGAG TAAGTCAGAAATTTCGGCACATTCATGTCTCGCAATGGCAGACAATGGGC TAAGGTTCTGAAACTCATGTGATTGAAAACCAGAGTTTCCAATCGCACAA TTAATAATGGAGAAAAAAGCCATGGCAAAATAAATAAATAAATAGGAATA GAAATAGCAGCGGCATAAAGAACTTTGCCAACTGGCGAAGGGTCAAAAGC ATTGCCCGAAAGCCACGCATACCCACACCACTACCACTGAATTCCGAGCG GGCCAACTCCGTTGACGGTATTGAGTGACGGCAAGAGCCGAGAATAAGCC GCGAATATCCAAAGACGGATGAGCAGACAGCCGCGTATTAGCGGCAGCCA AATATTAGGTAACATCGGGTTCAGTACAAGTAAACAAACCAAGAGGGAAT CTTGAAATCGGGGGCCATCAATGAGGAAGCACTTAAAGGAGCCGGAGGAT TCTGCGGAGCTCCACTCCAGAACTAATTTTCATCCAGAAATGCCGTTTTA ATTGTTTGAAGAGCTAATACCCAGATTTGGCTTTGATTAGAGCCAAGCTC GGATTCTTCAGCGCAGAATGCGCGAAATCTCCGGGGTTTCGAAAAAGAAA ATCACCGAGAACCCAGCCGCCGATAGACGAATATTCACGCAAAACAAAGG AGAACCGGTTTACCTGTGTTCCTAAATATTCTATTTGATGTTGGCAAATG ACAAGATAATCCAAAGTAATCAATCAAAATTATTTTAATTTATTAAACCA CAATAAAGTCGTGCCCGATCCGCAATTGCCACGTTCTTGGCCCAGCCAGC CAGTCAGTCAAAGACTCGCCAAAGAATGCTCCCTACCGAACTTAGGGTTT GAGCCCAACTATCAAGATTGGGTCATACTCACTCGTATAGGGAAACTTTA GTACTTCGGCAGACATTCCGCGGATATGGTTATTACCAACTGAAGATTTG CAGAAACTGGTTTTTAGGGAGCTGTAAAGGTACGATGATCGTAAATGGAT ATTATCTGAAATTTTTTAAGTGATGCAGTAGTCCATCTCCTGAAAGTTAC ATTTTTGCTAGATCTGTATGAAAAAGGCTCCAACTAAGCGTTTATCTATC AACTAACATAAGAACGTTGTCAGGGAAGTTCTGATAAGTTAGATAAAATA TTTCTTTTCCCTGCTTCTCCAAAGAACAGTTCGAAATATGCCCAGTTAAC TTGCTATTATTAATAATAAAACCAATAGAACCATTTTCATTTGCCAAGCT CGACACAAGTCTGCTTTATAAACACGAGCCAATGGTTATAGCTGCGAATG TCTAACTGAATCACCTATTATTCGGCCATTCACTAATAACTACTCCTCAG AGGTAAATAATTGAGCTGCTATTTGGATGTGTAAGCAATATGAATTAGTT GATTAAGCCGATGCACAATGATTCAGGCGATGGGGAAGTAGAGCGCTTGG GCAGGGCCTTCCTTGTTTGGTTCACCTGGAGGAGTTCCTTATTTGGACCA CAATGAAGGCCGATCCTCCGCGATCCGTGGTCCGCCCGCCCAACACACTC TTGCACAATCGAATAAACATGTTCGATTTGTGAAAACCTCAACGTTTTGT GTCAAATTACTGTCATTCTTTTCCGCAATCCCCGGGCACAATGCTGAATT AAGTAGCAGGTAAATGAGAGCAGCTAGCCTAAGCAGGCAAGAGTATAAAT AAAATTTGTTATGGAATGGCGCGCAGCGGGCAAATTCAGGGAATCAATAG CCGCAGTTATGGATACCTAATGGGCGTACCCCACCGGAGCGTCCTTATCG CGCGCATCGCCCATTGACACTGCATCCTGCGAGTCCTGGCAATTCAAAAG CGCGCGACTGGGCAGGATGTCAAATGGCTTGTGTGATACCATTCACTAAG CCGAGCTTCCGACCTCATTATGCGACTCCTTTATGCCGCACACATTTAAA TGTGCTTTCGCCCACCACAAAGATCTCAAATCGGCGACAATCTCTCCCTA TAGCCGCCATCCATCCATCCATCCGTCCATCCGTCCATCTATCCGCCTAT CCGACCTCTAACGGTAGCGACTGCGAAGTGAAGCCGGCGTCGCCGGCGAA AACCTTTTCGCCTTTTTGGCACACTGGCGAGCGACTAGTTCTCATTTCGC GTTCGTCGCTCGTAGACTACTGATGCTGATGCGTCGGTGCGGCAAAGTCG AAAAATTCGAGAAAGCGCGAATCGGATTTAGAATTTAGAATTTACAACTT GTGATTGTGATCCGCCGTGATATAGCGAATTAGCGAATTATTCTGGAATA TATCGACTTGTGCCCCAGAACAGCTGGATAGCCCCATCGATATGTGTGCA TAAGGTTTCGGCGGACTTAAATATGATAACATGACTTTAGCGTATGTGGA TATGCCAGCTGTAATTCAGGTTCAGGTATATTTCGGACTTAGGATCTCAC TGGGATTAAGATTGATGAGATTGACAGTGTGTCGAATTTCGCGGCGCTTT AAGAACATGGCCTCAGAAGACTTTCTGTGTTTCGGATCGGATATAGATGG TGCATTCTTGAATGTTATATATATGAGCTCGCAATTTGAGTTCGCTGTGG AACCTCACAATGAAAATATTGAACAAATATTGTGGTTTTGCAATTCAATT AAAAAATGAAATCAATTTTAATAGCAAACCCAATTTTAACCAAAACTGAC AATTTTTGGTCGAACTATCGAATTAATCATGCATCTAAAAATATCAGTGA ATTATTGGTTCCCATGTCTGACAACTGGAATGTTGAATCTCATTAAAGCT ACTTTCATGTGATGTAAACGATCACCAGTAGCCAACCCAAAAAGCCACGC TCAAAGTACCTGCTTCATGTTGCTTTTCGGTGTCTATTTAAGTTTTGATG CGAGGAAATTGATATACAAAGTGTTACAAAAACTGTGTTACCGACGGGAT TTTACTTTCAACCACATACTAAACTTATCTTAGGAACCTGAAAAACGCCC TCAAAGGAATGGGATTCTTTGTAGTCGTTTTGACTTAAATGTACTAACTT GGGAAAATTATATTCTTCACGAAATGGATTTTACGTTTTAATAGTCTGAT ATTGAGAGCCCTCATAACATAAACTTATCAGTTTAATCGTCATATATACC GCCATAACTGTATAATCTACACCAAATCTTCGACTTTTTCCCGGAACTAT GTACGTGTTTTGCCCACTCTCGGCCACAGGACTAAACGTATCTTGAGAGC ATCCAGTATTATATGCATATGCTTCGCCAAATGTGATCCCAATAATAGTA ACTGACATCCCATTTTCGACAACTGCATAACCTTATCTGGGAAACTCTAA ATCCTTCCCACCACTTATCCTAATCATCAGACTTACAATTGAACATTTGG TGACTGTATCCACGGAATGTTTTCGCAATTCGAGTAACCAACAATTCCGC TTGTCTTCCCCAGGAACGCCTCAGTGGACATGGGAGTCTAGGGCTGTCCA GCGGCAGTGCGGCGTACACAACGCATTCCGGCGGCCACACGGGACGCAGC GGACCGGCCACGGGGCACAGTGGGCACAGCAGCACCCATGGATCGGCGGC CACCATGCACCACCAGTCGCTGCAGTCCGACTTCCAGCCGCCGTACTTCC CGCCCCCCTTCCACCACTCCACCCAGAGTCCTCCCCAGCAACAGGTAAGC CACCACCTCCGCACGGCGCTCCTGATGATCCCAAGCGCTATCTAGATATC CGGCTACTTGCAGAACCATGGAGCCCTCGAGTACTTGGGCACGGATCCGT ATGGCCAGCCCCTCTCCTCGCTTCACCACGCCCCACTGCACCACTACAAC CAGCTGGCGGGACTGAGATCCACGCAGGACCAACTGGGGATCCACAGGAC CCACAGAGAGGCTGAGCTGCAGGGACATGTCGTAAGTAGTTTACTGAAAA GGACTTCGTTTGTATTTACTTTATGTCATATGCTTCAGTTTTATTGGCTT AAGGGAAAAGGCTTACGTTTGAAAATGTGGGCGTGGCAGTCTTTTAAAGA CTTAAAAGAGTTACTTTAGAATGGGATACATTAATATTTGCGAAATAAAA TAAAATAACTCTAACAACTAAATGCTTAAGAAAATCAAAAAGGAAAACAC GTTCACATTTTTATTACATTATAAATAGGGATCGCAGGGATAACAAAATA GTAATCGATTTAAAAGAAAAATTTTCATATAAGCATCTCCTTGGCAATTT TAGCTGAGTTAGGTTAAATATTTTAGCCCTCGTATACGCCGATTGCCGGC AAATTACAATAACTGCTAACAAGAAGGCAGGACTCAATCTTTTCATCCGT TTAAGAATTTGCGTCTTGTTCCACATTATTCTTGCATATTTTGCTACATT CTTGGCTTCGCAGGCCATGGAACATTGGGGGGTGGAAGCTGGCTCGCTCT GTGAAAGTTGTCGAAGTTATTTTGGAATGGATTCCATTCGAGTGCATTAA AAAACATACTCGGGAAAATGTGAAAAATGTTCTTGGGATTTCGCAAGAAA CTCTTCCCAACAACGATGAAATTCCTAGCTCAGCCTTAGCCCGCCGAAGG GAGTCCTTCAGCATCGCCACCCTACCGGTCGTTCCCCCGCCAAGCGGTGC AGCGAAACGCAGCCTTGTGCCCCGAAAAGGCGTATCCTCACAGGCTCTGT GCGCATCTGTCCGCCCAAAGGACTCTCACACACACGCAGCTCTGTCGAGA GTCCGTCAGAGTGTGTGTGTGTGTGTGCCAGGCAGTTGCCAGCCGGTCTG CATACATTAGCGGCAAGGACCTCGGATTGGCTATGCGGCGACTTCAACCC CTTGGCCAAGCCGAAGCCCCGATGTATTAATAATCTCGCAGTTATTGGCA TCATTTCCACCATACCCTTGAAAACACTGAACTGCAAGAATTACGTTTCC GCTTCAATTGAGGCACTGTGTGAGGCAATTTATAGATGAATGAATATGTA GAAGTTGTATGTATTATTGTATAGCAAAATGGATGTATCTGGGTATCGAA ACTTTAGATTTTGCCCGAACTTACCAAACCTAACTGAACAAAACTAAAAC TTAAGGGTAATAAATATAGAGACACTCATCTAGTTGGTAGATAACATTTA GCTGCAAAGCGGAAATTAATCTTGAAAGCCTTTGCAGACCCAATTGTCAC ATGGATTTCCGTACACGGATAGGAGGAGCGATTACGGCAGTGCAATATCC GCGGGAGCTGCCCACGGAACGAGACTTGGCCACGAGCACGAGTCCCTGGC GCTGCACCAAGCCCTTCAAAACGCCGTCGATGATGTCCAAGCTCCTGCCC TCGACGACAATGTGGCGTTCATGTCAGACTTGCCGCTCATAAAGAGTAAG TTATAATTCCCTAGATCTATACACTATCATAAGAGGGACCGACAAGTTCT TATTTACGATTAGTTGTGATATTTTACATACCAACCCAAAAACATCCCTT TGAGTAGTAATCCTAAATGGTCGTACCCATCCACACGATTTCAATAAAAG TTAAGTTGTATATGCATATGCTCATATTTTTTTGGATCGCGGATTCAATT ACTTTAACTTATTTACTTTATTATTTCCTGTTCGATTAATGTAAATTATG TTTAGATACAAGTTATATAAATATTACTGCATTTATATTGTAATGTTATC CAAAATATATATTATTATTAGCATATTCATGGCGAACTTGCAAGTTACAT TCCACTCCATGTGGCGTTCGAGGCGGAACCTCGAACACGCCTAAATAACA ATACGAGGACCTACCCCTGAACATATCGAGTTTGTGTGCATTGTGAAACT CAATCTTGCGCTTCTAATTGGCAGGATTCGGGTAAAACGATGCCCACGTC CTGGTTTCACACTTGGCACCGTCGGAACAATAACAACAAAAGCCATAATA ATATATTTTCCCTAGCATATGAACAATATGGTGTACTATACATGCTCATA CTCATGGAGGCTAATTTTCGGTGTTGCGTTTATTTGCAGGCATGAAAAGC GGAAAAGAAGCCGGGAACATTGGATCGGGTTCGCCCAGCGAGGTATTCTG TGCAGTTCCTGGTCGCCTCAGTCTCCTATCGAGCACCTCGAAATACAAGG TCACCATAGCCGAAGTACAGCGTCGACTCTCGCCGCCCGAGTGCTTGAAC GCCTCCCTGCTGGGCGGAGTGCTCCGAAGGTGGGTTCAGATGGCATCCCC ACCTGGTTGGGTCGTTAGCTAACCAATTTCGCGTTTCAGGGCTAAGAGCA AGAACGGAGGTCGCCTGTTGAGGGAGAAGCTGGAAAAGATCGGCCTCAAT CTACCCGCCGGTAGACGGAAAGCGGCCAACGTCACCCTACTGACATCCTT GGTTGAGGGGGAGGCAACGCACCTGGCCAAGGACTTTCACTTCGTTTGCG AAACCGAATTCCCCGCCAGGCAGCTGGCCGAGTACATCGTGCGCCACCAA ACGGAGCCGCAGGACTCGTACCGTCGAAAAGAGCTCATTCTCCACTCCCA GCAGGTATATTTATATTTATAACGTATAAGTCTTCCACTAAAAATAAGTT CTATTGTATCAGTGCTGATTAAAAACTACACATATTAACTCCGTAAAAAT ATTCCAGATAACAAAAGAGCTTATGCAGATCCTGAGCCAAGATCGAACGA CCCACTTTGGGACGAGATCACAGCATCTGCTGGAACCATCGATGCAGCGC CACTTGACGCACTTCTCCCTGATAACGCACGGATTCGGATCGCCCGCGAT TATGGCTGTTCTGCACGCTTTTCAGGTGAGGATTCGGTTGTAGTATTCGA GAAATGGCAGCCACTAGGTCCAAAATCTCTCATTGCAGACATTTTTAAAC GAGTCATTAAACTACTTGGAAAAGCTGTACCCTTCGAACGGCGGAGGGAT GGTGTCGTCGTCGTTGGACAAAAGTAAAATTGACAACGAAAAGAAAGAAG TGCATACCAATCAGGACCCGCTGGACGAGGTTCACACAAACCAAGATCCA CTTGATGAATTCATGGTGTCCAAGGGCGAGGAGCTGTTCACCGGCGTGGT GCCCATCCTGGTGGAGCTGGATGGCGACGTGAACGGCCACAAGTTCAGCG TGCGCGGCGAGGGCGAGGGCGACGCCACCAACGGCAAGCTGACCCTGAAG TTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCACCCTGGTGAC CACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCGATCACATGA AGCAGCACGATTTCTTCAAGAGCGCCATGCCCGAGGGCTACGTGCAGGAG CGCACCATCAGCTTCAAGGATGACGGCACCTACAAGACCCGCGCCGAGGT GAAGTTCGAGGGCGATACCCTGGTGAACCGCATCGAGCTGAAGGGCATCG ATTTCAAGGAGGATGGCAACATCCTGGGCCACAAGCTGGAGTACAACTTC AACAGCCACAACGTGTACATCACCGCCGATAAGCAGAAGAACGGCATCAA GGCCAACTTCAAGATCCGCCACAATGTGGAGGATGGCTCCGTGCAGCTGG CCGATCACTACCAGCAGAACACCCCCATCGGCGACGGCCCAGTGCTGCTG CCCGATAACCACTACCTGAGCACCCAGAGCGTGCTGTCCAAGGACCCCAA CGAGAAGCGCGATCACATGGTGCTGCTGGAGTTCGTGACCGCCGCCGGCA TCACCCTGGGCATGGATGAGCTGTACAAGCTCGAGGGCAAGCCCATCCCC AACCCCCTGCTGGGCCTGGATAGCACCCTGGAGGTGCTGTTCCAGGGCCC CGAGAACCTGTACTTCCAGGGCATGGCCAGCAGCCTGCGCCAGATCCTGG ATAGCCAGAAGATGGAGTGGCGCAGCAACGCCGGCGGCAGCGGATCCTCG GGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGTCGACAGATTATAA AGACCACGATGGAGACTATAAAGATCATGACATTGACTACAAGGATGACG ACGACAAGTGATAGGCTATGTTGTATATTGCCACAGATTGAAGCAAGCCG TACTTTAAGATTAACTTTCCATACACTAGGCACAACATTAATAAAAATTA TAAAATTCCTGTAAATTAATTTATTTAGTTAAGTGTAAATTATTGGACAT TTTGTATATCTATAACTGTAATTTGAATGTACAATATTCAAATATATTAA ATACGTATAATTTATTTAACTTAGAAAAATACATCGACATTTTGTGAAAA GCACAAAGCTTTTTACAACTAATTCAAACAAAATCTTTACAAATACACTT ATTTGTATGTAGAAACGATTGAAATGCTCTCATTTTTAATTTTTTAAGTA ACTTACAATTTAAAGATTTTAAAATTATACAAATGAATAAAATGTGTTTT TAAAACTAAACTCGATAAATCCGTTAAAATAAAGGCATCTGGCTAGGTAG GAATAAAACAAATCGTCAAGTAAGTACAAGTAAAATAGGGAGATAGTCGA TTTCCTTCACCCTTCTGATCAAGATGTGAGGTGTGAATTTGTTGAAATAT TTAGTGCAATTAGCAAGAAAAACATTCTTGAAAATTGTAGGTCTGACTTA TGAACAACAAACTACAAATCAAAATATAGTGTTTGTAGTGTAGTGTTTGC ATAGCGTTTTCTGTCCTCTCGACGTTCATACGGACAGACAGACGAACAAA GCCAGATCGATATACTTAAATGATTCGGAAACGCTTCCTCCCACCTAATC TGGTATAATTTTTACCGAATCTGGTATAGCCTGGTATAATTATGTTAGTT TTAAATATTGCTATTCCCTGAGAAACCCAGGAAAGATATTTTCGAAGAGT TTTACCGTTTTTTAAAAGTGGAAGTATTTATTTACAAAATGAATCGACGC TTTAAAAATAAAACAAATAACATGATAACAATTAGGCTTAATATAATTAA GAATATAATTGGAGTCATTAGACTATCCGCGGATTGCATTCCTGTTAAAT AATCATTGTTTTGCCCTAGTTTTGCGATCTCCTCACCCAATAAATTTTTG ATTAAATTTATCTCGTGTTCTGAAACAAACAAATATGAGACTTTGTAGTT GAACTAAATGTATATAAATACCTTCATTTTCCAGTATGGTTACGTCTATT ATAGAAGATTTCCTTTCCTCGGCGTTATTTTGCTTCGTCGGTGCAAGCCA CTTAAATTGTTCACAATTATTGTCCTGTGAACGAGATTTTATAATACTTT GCGATATCCTAAGGGGTAATGGTGCTCTCTCTAATTTGTGAAATTCAGTT ATACGATTTAGATTCTGCAATAAACTTGATTTGTGCGAGTTTATTGCAAA ATCTAAAAACGTTATTAGCAGCCAGTAGCAAGCCTTCTCCAGATGCGTGG AGTCGAGGCAGTTGGAGTCCCCATATACGGCAATACGTCCTTCATTCTTA GTTTCATGATTATTGCTTTTCGCAAAACTGATACTTCGTTGCTTCGTTCG CAGTAGCAAAACCCGGTTCTTAAATGTGGAGTAATCTGTGGGTATAGCCT CTGCCAAATTGCTTTCCGCATTGACCACGATTTCCTCGTTGCTTTGAATA CTGTTCGCCTTGGTTTGGAACATACCAAAAATAGGTACATCTAGTTTTGC TACCTTGCTGGGTGTTTTAGAATTAATAATCTGGAAAAGGCAAAGTTGTA TTCTGTGGAAACTAAAAAGGATTATATTAAATTTACCGAAAGTCCTTGGT CATTCAGTTTTGTGCCCACTATAATATCTCCTGGATTCATTGGAAACTTA ACAATTGTGGCTCCACTAGCATAGTACATTGAATGGTCGCCCAGTTTGAA ATGTCCCTCACCGACAAAATCGCCAAAAGCAATTCCAAATGGCTTCAATA AATCATTCAAGGCTGGAATATTTGCGCCACCAGTGTCGGGTGTCCACCAT TGTCGGGTGTTCTCGTCAAAGAATTTAATTTTTTTCATCACAGTGGTGTT ATACCAGTCTCCGAATACGACGACATTCAAGCCTCTTTTATACACGTTTT CCTGTAAAGCGTTTATTTCCTCGTCGCCAAACCCTCTCTCAGGGTCAACA ATCAATAACGCGCCATAATCCGAGGCATTGAAGCAGGTGAAGGGTTCTCG CAAAACATCAATGTAGTAGCCAACATTTCGTAAATGTGTATACATGTCCC TAAAGTTTGTGTGTATATGGTCTGCCCTCCAGTCCAGAGGATCTAGTTTA ACTTTGAGATCATCTCGTGGAATATAGCGCGGTGGATACCTTAGGCTGTG GTACTGATCCCATAAAATCCTCTTGTTTCTTGGCGGTTTTGGAGTAACCT TTATTGTTAAAGGAAAGTCGACTTCTGTAACATGAGTTTCGTTGGTGGTC TGTTTAAAGCTTTCCAAAACTAGGGTGATACTTCCTTTACAAACACCTTC AAAGTTTTCTCCTTCCTTTTTTACAGCTGGTAAACAAAAATTGTTTGGTA TAGAATGGCTTAGCACTTTCATATCAATATGTACCCCATATATCCTTTAT ATAGCGTTTGCTATTTTCATACTCACCAATAAAAACTGACATCCAACCGG TCCACGGCCAAACGATAGGCGAAACTTGTGCAGATACTTGAAGAAACTGA CCTTGGTTTTCGAAATCGGGAATCCATTTAGGGATGCCAACTATATGACT TGTGACAGAGATACCATTGAGTATGGTAACGTTTGCAATAGCGACGGAGC TTCCATAGTACAGAGGTTGGGAGCTATAAGGCCACATATAGTTTTGGGTG AAGTCAAGGTATGCCGGAATAAGGGTTATCTTTGGTTTGTATGACAGCAA TAGCTGCATACTCTTCAGCAAATTCAGTTTTCCAGCTCCCTGCTCAAACA TGTTATAATGCGGCAGTTTCTCGGCACCTTCAATGAGTACCTGCTTAAGA GATGCTGGGTTTATGTAGTCGATTTTCTGAAATGCACCGCTTATAAGCAG TGCAGCAGCCCCTGCAACAACTGGAGAGGACACGGATGTTCCAGAGAGTC GTCTGCACCCCTTGCGCACATCACTGCCTTCCACTTGACTTCCGTACGTG ACAATATCGAGTCCCATACGTCCGTAGCCTAAGGGAAGTTCCCACGTTGT CATTCCTCTCGAACTAAACTTGGCGATTTTATCATCAAACTGAATGCCAC CAACGCCAACTACATCGCTCTGATCGCCAGGATTGTTTAGCGTGCCGTAC AAGGGACCATCATTTCCTGCTGCCGATATCATTATGACATTATTAGCCGA CAGTTCCAACACCTTTTCAACGAACGGCGAGTCCATAAAGTCGGGACCCC CAATGCTAAGGTTGAGAATGTTTATTTTCCTATATATCGCGTAGTTGAAT GCATCCAGGAACCAGGAAGTGTAAGAAACCTGCCGATGTAGGGCTAATTA GATTGGCTTAGTTAATTTCAGTTCTACGTTTGCTCACTTGGGAGTTCGTA AAAACTTTAAATATGTAAAGATCGGCGTCGGGAGCGAAGCCTAGGCATTC CCTGGAAGAAGCGATTACCCCGGCGACGAAGGTGCCATGACTGACTCTGT CGTCAAGTGACTTTTCATTCGTCCAGTTTGTTCGTTCCTTTACATTTCGA AAGTGTGGATGGTTTTTGGTTAGGCCAGTGTCGAAAATGGCCACTTTAAC TCCCTTGCCTGTGATACCCAGCTTCCAAAGGATGTTGGCGTGGAGTACGG AGCACAATTGTCGGTGGCGATCGTTGTTTGGGTTTCTGTTCCTTAGCACT CCTTGGGGATGGCGGTGAATATACGTTAGGTTGCTATAGGCGTCATAGTT TAGGATCCTTCGTACGCTTCGCTGGGGAACTACTGCCTTTACTGATGGGT GAGTCTGAAGCCTTTCTATAATAAACTCTGATGATGATTCATAACCGTCG CAAACTCGTAAGATATCAAAATCACTTGGATATTGCCAAGCCAAATTTAG ACGGGGAACAATTCTCCAGTTCGTTACCTAAAAATGGAAAGGGATATAAA AGAGCTTGTGAAAAGTGTTTAAAACTTTAAAAAGGTACTTTTCTGTCAGA AAAGATGCGTTTGTGTCTTTCAAAAGAAGCAGGCTCAATCCGTTTGAAAT AAACAGGAGAATAGACATTTAAGGTATAAATATAACCATTTGAATACAAA CTTACGTTTGAACCAAGAAGTTTTGCTGCGATGTAGGATTCTCGGACCGG GGCAAAGTATTTTGAATGGAAGTGAACGATGAACTCATTTGGAACAACGG CTGTTTTAAAGGCGTCGAGGCTGCAAATTGCGCTTATTATAAATAAGAAA GTAAACACATTCATTTAACTTTGCGAAAGGAATAATTTTTACGAAAAGTT CAACAGGCTTCGTCTGTGTAGAAAAATAAATAAACAAACCGTAATCAGCT GTTAGCATGAACGAAAACGTTTATATGAAAAATACCATGAAATTCGGAAA TGGGAGATACTAACCTGTAAACGTGTAAGAAATAAGATTCATTTCAAAAA CTTATATTTTTACCCCATAGAATATTAATGCAACAACATTCAGTTACTTT TAACAAAAAAAAAAAAACGTTTACGTTAGTTTAGTTCGAACATGTTTTGT ATGTTTGGTGTATCAGCAATGTTTATTCCCACATTCCTGCACATTGAAGT TCTGGTCACACTGCGTCTCGTCCGGCAAAGTTTTTAATCAAGTTTAAGTA AGATATGAAAAGCTAATTAAAATAGATCAGGAACTGCGAACCAGCGGAGT CTCTGCATTTCAACAATAAGTGATTTATAATTCCTTTGCAAAAGAAATGC GAATAGTTAACTGGGGCGTTCAGTAGTAGGTTTTACACCTTAGAAAAAAT TATTGCAATTCGGTTATACTTAAAGCGGCATATTCACAGGTACCGAAAAC ACAAAGTCTAGGCGCCAAAATTGCCGTATTTTCTATTTTTTAGGGCACTT CAATTCAAGTTGTACAGTCAATTCACTTGCCATTTGCCTTCGGGTAATGT ATTGAGTTGTCCAACATCATAGAACTACTCACTACTCTTTATTTAAATTT ATTCGGAACCCATTTTAATTGCATTTGAAAAGTATATTCGCCTACGAATA CCTGCTAACCAATATTTCTATCCTACAAATAACTTGCATGAAAACTCCAC ATAAGAACTGATAACACCAGCGAAGCAATATAATCATCGGCTAGCTGCTA GCTCGATTTATCATATACTAATAAGTTAATCAAACAGAAGCATTTACTTT AAAGAAGATCTAAATATGAAATGTAAAGAGTTATCAACAACGAGTTAGTT ATATTAATGGAACTTTGTCGAAAGGCTTCATTCATAAATTTGCGTATTTT TCAATCGCAGATTGAGGCCCTATCATGGAGGAGCTGTGCAACAATTCCGG ACACTCGGCTACTTCCAGCAGTGGCAGCAACTCGTCGATATCGGCCAAAA CCGCGCTAAGTGAATGCTCTGCTGCTTGGATAAATTACTTGAGCGCCTTG AACAACCTATGTACTGCCGGCTCCAAATTGGCGCACTCTATTGCAGTTTT GGAACAGTGGTCGTTGAGCGAAAAGCCGTTGTTCAATAATTATACAACGA CTTATTTAACCAATTCATGGAACGACTTGGCAAGGTAAGGCAATTGACCT ATTTACATACTTAAGATATACTTAAAGATATTTGTCTACACTAGAGCAAC AACCGTGGCCACAGGAACAGTCAAGACCCACATGCTGGCCTTGCTGCAGG ATTTCGTCACCATATCATCCATGGACCAGACCTCCAGTACCGACTTGGAT CAAAAGCGGCTCAGGGAGCACAACGAACTGATTGTGTTAGAGAATGCACA GGCTGTAATCAACATTCAGCACCAGTTCTGTGCAGCCAGCTATGATGCCT TTTCGTCCCTAACTTGCTGCTTTGTTTGCCAATCGCCAGTTGGATTTCCA CATGAACAGGACTGCAGTGTTATGAAGCAGCGGTACATCACGATTAATTA TCCAATTTGAACTTAACAATTAATTTTTTCATTTTTTGAAAGCAATCAAT ACGACCAACGATCTCAAACACCTTCGCCCAATTTATGTGGGCCGAGTACA AAGATGGATTCATCCAGGGGAAACTCATTAACTGATCAACGCCCAATTGC CACTGCAATTTCAGAAACAGGTTGCTTTAGATATTCGAACTTTTATGTCC TTATATAAAAGGCAATTTCCTTTCACTTAAGCCGACCAGCCCAGAGGTCC CTCGCCTCAACTGAACTTTTGCGATGCCAATCCTATGCAGGCCATTTTCG AGCATACACGAGGTCCCTTGCCAAACCCCGGCCAATTACTGTCCATGAAG ATTCCATTTCACCGGAACGTCAAGTCGTCCTTAAGTTTTCCATTATTTCC CCTGAACGGTCAGCGTCGATGGTCGGAAGCAGCTGCTGCCGAGGTGATCG ATGGCATCTCCACGGATCCCGAAAGCCAAATGAGGAGGTGGTCAATGCCA TGGGAAGCATCTAAGACTGATAGGAACACTGTCACATGGAACCAAACCAG GATAATGCCAATGAACACTTTGAAAACCTCTTGCTACAAGATGTCTAGCT CGGAACGATATACTTCCCACTCCGGTATTCCCTCAAATCATTATAATTTC ATTTTAAAATCTAAAACCTATTTGCTGCAGATGGAAACTGGCCCCTGGCT TCAACCAGTCAAGATGGGCTGTTAGAAGCTATTCAACTACTATCCATCAA ACCCACCACCGTCCCACAAATGAGTACTCAGCCCTCAATTTTGTCGACTT CTCCGGATGGAGCATCACTTGACTAAATTTCATCTAAACTGAAACGAAAA TAAAAATAAATATCAAGCATATTATACATTAAAATAATCTCAACCACTCA ATTAATTTCTTTATTTTCTGGGTTTATAGAGGTTATTGCGCGACGTTGGA TATAAAACACACCACTTGGGGGCCAAAGAACCCGTATCCACAAAAATATG TTATCTACTAGTAAAATGATTTATTCGTGCTTTTTAAGTTTGTTATGTAT AATGCCATTCATTATTAGTAGGTAGATCTTACACGCTTAATTTAAAGTAA ATCTTTTTTATCGAAATTATAACACTAATGAGATATTCTCTATTTCTTAC GATTAAGAACACTTATAATTAAAATAAAAGATACTTTATGTTTATCATTA TGTCCATAATACGTTCCAAATTTTACGGATATTGCGCACATACTTGTACG TATAAACTTACAAAATAATTATTAATATAATTACTACTTTCAATATATCC CGGTTTAAAAGATTAATTTTGTATCATACATTTGTTTTATTTTTTGTTAA TTTTATTAAGACTATTAATATGTTAATGTTTGATTATGTATCTAAGGATT TCTCTAATAATATGGAGTTTTAGTATTCGTTTAAGATGTGTTAGTTTAAA CTAATAGAGGAATCGTCCTACATCTTCTTTAAACTTAGAAATTATTTAAC TAAACTCTTTAATTCAGGAAAAGTGAAGACAGCAATCATACATTTAAAAA GTGAATTAAAATATTTTTTGTTAAACAATATTGCACAATATTATATATGA ATATATTTTCTGTTTGTAAATTTAATTATAATTAACATAAACAATCCCAC TACACAGACTAATTTAAGAAACTGAGGAAGTTTCTCTTCCAGACCGATGG TTCTTATTACATAATTATTTAAAGTTCTATATTTAATTTTTAAGTTCCTT TTATTCTACAATCGTTGAACGATATTGCAATATGTATTTATGTATTTTAT GATTACAGGAGGGTATATACTGTATTCCTTAAAGTTTCTATATGAAGTTG GTAAGCTTTTTTCAGCTTTGAATTTTAATGGTGATCTATAATGTTGTGAA TGTTCTTTAGGTTTTGCATATATCCACTACCAATAATGGGAGAAAAATAG TGGTTCCATTTAACAAAGGGGTTCAATTTACAATAAAATACAAATTTTTT TTCCTTTCAGGTGAACTGGTTTTTGTACCACGATGAATGAATTCCCAAAT CGGACGAGAATTATAAAGGTTAGCTAGTAAACTATCCAACTCAGAAATGA ATAAAATGAATGTGTACCCAACATGGGAGATATAGGGATATGCATCGTAT AAACGTGGTATATGTTTTAATCTGCTTTGAGATATTAACTCCGCCAATCA GAATATGTTTGAAACTACGAGTACTTGTGCTTATGTACATATGTATATCT TTGTGCCAATATACGAATTTTTCGTATGTACTATTCGATTTAATTCGCCG ATCGTATTTGGATAAGTGTATTCTAATCAATGACCTACTCTTGCATCTAT TATTTCTTATCAATCAGCTGCTCGTTCAGGCTGACTTATTATATCATTTC GAGAGAGTAATTATGATATAATCCGGTACTCAGTTCATGGATCGGGCAAA TGGGATGCTGAGCTTAACAATTTTCCCAGATTCATTTCCTTCTTTAAAAC ACTAAGGCTAACGTTATTTGGATTTGGATGAGATACCAAAATAATTTTAA ATGATTAAACACAATTGTTTCATAACTCCAAAATATTCATACATGACTCT AGTACATAATGCAAACCGAATAAATTGATTGATGATTTGTTGTTCTGATA ACAAATCACTCTTTTGGTAATATTTGTGAAAAAAAATAATAAAAAGTTAA GATCCGTTTCTTATCTTAAACCATTGCGGAAGTACATTCATTAATTTTCT ATTGAGAGAAGTATTCTATTAAGATTTTAATACATTTAATACGATTTCTT AATGTACATACATGTAAATTTAATTATTTGCTAAAGTTTTAGTAAGGCAC CATTTAAATTATATTTGCAAATAAACCCTACTACTTGTTGTTCCTTAAAC ACTAATGATGGGATAGAGTACTAAAATAAATGCAGACAAAATTATTCCGG AGACAGTTGGAGATATTCTAATATTGCTTGAAATGCCCATTTTGTATTCC ATGTCGATATCTAGGAGTAGATCATGATTTCGCGTGTAGAACTGGTGGAT ATCGCTTATCTAGAGGAAGTTTACAAGGATGTTTAAAGGACACACCTATA CCAAAGAACCATTTACGCACCTCGTTCCATCCGTATTTGTTTTTAGCCTG AACAATCGCTTCATAGACAGCGTTGTGTTCCAAGTTTTTGACGAGATACG ACATTAGAAAGTGGGATCCATCAGTTCTGATTGGCGTTGGCTTGATATGA TACTCGTGCCATTTGCCAGGGTGCTGGTAGGTTTCATTCATCTGGAATGA TAATAGAGTGATTTTTAACAGCTAATAAGTATTATCTAATTACTTAACTT ACCAACAAACGGCGATACAACAGCTTAATCTCATCAAGCGGCGGTATTGA CTCAATTGTCCACGTCAAGTTGTAGTGATCTAGGAATCCACTCAACGCGG GAGATATGAAGTCAGCAGGACCAGGTCGTCCAGACACTTCAATATACTTT TTTGTTCTCCCCAAAGCATTATCCGCAACACAGCTATAATTTCCGAAATC CGTTGGCTGGAAGTTCCGGATAATCAGGCTGTACCTATCATCTCGTGGAT ACATAGATCTCCGATCGGTAGCATCAAGTAGAAATGAGTTCTGGTACCAC AGCATCTTAGAAGAGTAATTTTTTTTTTTAATTTTACAATTAATATAAGT CTAAGCAGTATAATTGCGTATTTGTACTTACTTCTGAGTTTACATCTCCA TGAACTATGCAAACGAGCTCCACATCGTATCCCTCAGATGCGTGGACCCA AGATTTCTCTACCGTTATTTCGGGGGGCGCTATAAGAAATATGTTATTAT TAAAAATTAAAATCGTTAATGGCTTAGCTGTGGAGTATGCTGCTTACAGA GAATGGTCAACTGAATGTCCATGGATACGCGATCTTTAACCCCGTTGTCG GCTGAGCATTGATATGTGCCTGCGTGGTGCCTGTCCACGTTTTCCAATAT GAGTGTAGAGCTATCCGACAGGTGTGTTGGCCCGGAAAACACATCCTTCT TGAACCAAAATATGGTGGGCACCGGGTTACCAGACGCCTTGCATTCCAGG GTGACGGTGCTTCCCTTCCGGGCAGTCACTTGGCCGTTATGAGGCAGAGC CCTCAGGGTGGGCGGAACTATAGGGATACATCCAGCATGGGCAAATACTC TCAAGGTACAGAATGAAATATAAATTACCCAAGATTTCCACCGTGTGAAC TTGGTCACGGTTCTCCTGATCTCCCAGCTGGCATATATAATCTCCAGCGT CTTGAGTCTTTACTCCATTGATCTGCAAGTTATAGTCGCCCACTATCTTA AAGCGCTGATCCCTTGTTATTTTCAAATGTCCGGCTGTGAGCACGGATGA GCCCTTTCGCCACAGGAGCACAAAGGAGCCGAGGTTCTGTACTTTGCAGG GCAGCTCGATGGTCTCCCCCACGATGACCTTGTACAAGTGACCTCTGGAT AAGAACTTTGGCGCCGTTGTGGGAGGGTCATTCTCTGGCAATATGAAGGA GCCGCCTGAAATGAGGTTCGCATTGGTGTCATATTTGAAATTTTGTTCTT TAAAATCATCGTCTCTGCGATTGTGTTTTTAGCAATATTACCGAATAATT TTCATAAGAGTGTTTTAAATATTTATTTTCCCCTTAACCATACTTACCGA TCAAGGAAAGTGAAAAAGAAAAGAGGTAGAGTACAAGTGTCCAGTATTTC CTTGTATAGGTAGTCTGTAATGAATATTCAAATAAAATATATTAGTGCTG TCGATTTAATGCAAACTTCTAGTAAGAACTACTAAAATGTATTCATATAA AATGTTATAGCTTTTTATGCTACTATTTTTATTTTTTATTAAATATGTTT TAATGTGAAATTAAACTAACAAAGCGTTTAGTAAGGAATCTCTATATATA ATTATAACAATATTAATTACAATATATAAAGATAATTTTTCACTTAATGG GATCACGTTTTCTAACGGTTAATATACAGATTGTTTCGATTTATAGTTAT TTATTTAATAAATTATTAAATTTCAAAATAAATTAAATTTTTCAGAGATT TAAAAGTTCTCTTTTCCATTTTTTTTAATTCTTGGGTGACCGCCAATGTG TGATCGATATACACATGAAATAAATACAAAATAAAAAAGAATGCCTGAGC TGTGGTGGTAACACAGATGAGTTTCACAAATATATTGTAACGTAAAGAAA ATATATATATTCGTATTAGAAAATAACCGTCACCTGCGCTTAAGAATGCG AACTTTCTTCTATATAAATATTATTTCCAAAATACTTGATCGAATACAAT AAATATACCCAATATATTATATAACAAATATTATTTTAATTTATTCATAT TTTTGTTTATGGTTATCTTAATGATAATCTGTAAGCTTTAAAAGTACAAG TATATTACTTTGTTTTTTAACTCTGACGCCCTTGCCAGGCAATGAGTTTT GGATCTAATTTTATTATAACTTTTCAAATCATAATACGAATAAAATAAAT AAATAAATAATAAATAATATATTTTAAAAAATCATCATTCTGTTCAAAAA TATATATCATCAAAGTGAATTAAGCCTGAATCGTGAGATACATCGAGATA ATCGTTTCAGTTTGGGTAAAAAACCAGGTGATGGAATATTTCATTTTGAA TCTAAGATATTAATCAGTCCTTAACATATTTTAAGCTCAGTAAAATTGAT ATTAGACGAGAAGAGACAAACAACGAAATCAGTTTTCGTCCTTTAATTCA GAAAAACCGGTTATTTGAATGCGCCAACTCGCTTTTGATCGTTTCACGTA CTTAACAAGAGTACGCATTTTAGTTCCACAATTTTAATGTTGAATTTTTG AGTACGCTTAAAATAAAAACTGTTTGTAATTAAGCAAATTTAAAATTAAA TTTTTATTAAGGACAATAAAGCTTTTAAAGGTAAACTAGTTAGCCCGCCC CAATTTTCGTTAATTGTGAATCTCAACAAACTGCTTAATACTACAATATA CACTATATAATTGAAAGGATTCGTATATATGTATGTACCTATGATACAAG TTACATCTGTTATTATAGGCGAACATACACATAGGCGAACTAAACGAATT GGAAACTAATATATATAATATAATATAATATACTTTGTATATTGTATGTA TTAGTTAGTCTGTATTTTGCATTATTATTTTTTCAGACTTATCACGAATA CATAAGTGTGTCTATATAAATAGGCGGTATATATACACGCACATACATAA TATATGTATCTTATTTCAAGCATTAAACAATCGTATCTCATAGATTGCAG CATTTCTAGTGGTTGATCAACCAATATATACATATCTATATCCTTTTCCG AGGCAAGAAAAACTTTCTTTCTTTTTGTTCCACACTTTTTATAATTTCTA ATGTGCAGCACCCATTTTCATCCTTACCATTTTAATATGTATGTATGGCT TGCAATTATTTCGTTTTTCCTCTGATAAATTAAGACGTTCTTTGCTTTGA GTTGCCCTTTGAAATACTGCCGATTCACTTGCACAGACCACTTAATTGTT TATCAGATTAATATCATTTTTCCAGGTTTCTTATAAAATAGTCTCGAATT TAAGACTGGCGAGTATAATTGTATTTATCCTTAAAAGTTCCATTAATTGA GCGCATGCTCAGTGCAACATTATTTTGTGTCAAAAGCTTTCCCGAGCTTT AAACGCAGAGCAGTGTCACAAGGCAAACTTCGTCTTTGCGCATTTACTGA TTCTAAAAGACACCACTCTAAATCTGCTTTAAAAATGTAAAAGTTGGTTA AAAACTTAAATCTATCAAATTGTTACTGATGCTAAAATGTCGAAGTAGGA AGTACTCATAGCCGCGTTAGAAATTATGAAACAAGTGGAAATAATAATGA AAATATTTTACAGGTTTGACGTACGTATTTTCGAATACTCGGATGTCGAA ACAACTTCGTAGTTATTTTATACGAAATAAGTGCTCATTCATTAAAACTA GTCTGATTTTTTAACTATCAATTATTTTATTGGGTTACTAATAAATCATT GATAACATTTGCAATGAATATTGTGAATGGCGCATTTATGGTTCATTGTT GTTTAAATTAATATCTTTATATCATGTACTGAAAAAAACTAAAAATTTTA ATTCGATATTCTTATCGATAAATATTACTTTTAAAATACTTTCCCAAAGC GCAGATATCGGCTTTTATTGATGAAGTTGATACCGAACGGCCATCCCTAA TTCGAGATAATGCAGTATTGTCAATTTACGTGTAATAATAATGCATCGTT GAAGAACAGCCGATAATGTTTCTGTTTCTGTTTCTGTAAGAATAGTTACC CTTTTCCCGCCAGATATACTGACTCTTGTTGTCCGCAGTCTCTGGTTGTT GTTATCGCTTGTGTTGGTGGCAGTACTCTCTTTCCTTTTCCTGAGGCAAT GGTTGCTTGGCCGGAAGAATAAGTTGCACACATCGTCGGAAAATGGCATC AACGTGGGCATTTTTCACCCGTATTGCAACGCGGGTGGCGGCGGAGAACG CGTCTTGTGGTGCGCCGTGAGAGCACTACAGGTAATATTGGAAAAACTGC AAAACCTACATTCACATGCATTCATACGTGTCTTGTTGATCGATCACCAG CTGAAAGAATAGTTATCATTAGAATGAGTTAATTACCTTCGGCTAAAAAC TAGAAGAAATGACATATAATAATGCATGGGAGTAGTTCCTCAACAGGGTG CTAACTTTTCATTCTGTTTGCCTTTGGGTATCCATGTATGTAAATTACAT GTGAATACTATAGCTAGAGAGCCAATTATTTTGATCTACTTGTTTTGTAT TTTCTGGCCACTTTACTAATCCTTTATATTTGATATTGTAATTAAAAGGA AAAGTACCAGAACGCCAGGATGGTAATCTACACAGGCGACATAGACGCTT CTCCCAATTCCATACTGCAAAAGGCCAAGAATGTCTTCAACATTGCCGTC GATAGTGACAATGTGAAGTTCGTCTTCCTGAAGCAACGCCACTGGATCGA GGCCAAGAACTATCCTCATTTCACTCTGCTGGGCCAGAGCATTGGATCGA TGGTCGTGGGTCTGGAGGCACTCTGCAGGTTTCCGCCCGACATCTACATC GACACCATGGGATACGCCTTTACGTATCCTCTGTTCCGCTACTTGGCCCA GTCCAAGGTGGGCTGCTATGTTCACTATCCGGTTATTAGCACCGATATGC TGAAGAGGGTTCAGCAGCGACAGATGTCGCACAACAACAAGAAGTACGTG GCGAGGAACCCCTTTCTCACCTGGACTAAGCTTGCCTACTACCGCCTCTT CTCAAGAGTGAGTGTTCAAATTCGAATTAGTCAATGCACAGCTGTATACC AATTTACCCTTTTTTCAGATGTACAAGTGGGTTGGCTGTTGTGCTGAGAC TATCATGGTGAACTCCTCGTGGACCGAGAATCATATTCTGCAACTGTGGG ATGTGCCCTTCAAAACACACCGGGTTTACCCTCCGTGCGAGGTTAGTCAC CTAAAGAGCCTTCAGCACACGGAAAAAGGCGACGAATTCATCATACTGTC TGTCGGACAGTTCCGCCCGGAGAAAGACCATCCCCTCCAGCTGCAAGCCA TATACGAGCTCCGAACTCTCTTGGCCCAAGACGAGGCCCTTTGGAACCAA ATTAAGTTGGTTATTGTGGGCTCCTGCCGAAATGAAGATGACTACGAGCG GTTGAAAAACATGCAGGACCTGACAAAGCATCTGTCGCTAGAAAACAATG TGCAATTTAGTGTGAATGTCCCTTACGAAGACCTTCTTAAGTTGTATCAA ACTGCCCACATTGGCATTCACACTATGTGGAACGAACATTTTGGCATCGG CATCGTCGAGTCCATGGCTGCTGGCCTTATAATGGTGGCCCACAAGTCAG GGGGTCCTTTGCTTGACATTGTCGAAACTTCCGCGGGAAGTCAGAACGGA TTCCTGGCTACTGACGCCGTTGAATACGCAGAAAACATATTAAATATTAT TGTTAACAACTCAGAAATGAACGGCATTCGAAACGCAGCCAGGTAACTAG ATAAACATTTACAGTTTGCACACTTTAATATATTTTGGTTCGCTTTTAGG GCCTCCGTGGAACGGTTTTCTGAGCAAGAGTTTGAAAAAAACTTTCTTCG AGCTGTTTCAACGCTATTTACCAACAATTAAAAAATAATAGTACGCCCGC ACCTAAATAAATATGCAAAGCCCAAAAATCTCCAACTGAATACATTTATT ATACTCTACAACATATTTAGAGCGATTTTATCGTACATATCGCATCGCTT TCCTTAAGATTTACCTAATGCATTTTTAAAGCATAAGGTGATTTCGGTTT GATCGACTTAACAGAATCGGGAATAATCTCTGAGATTTTGTACCAAATTC GCCATCGTGTTGTAAAATTTTATTTATTTCCTTTGGAGTTTTAAATCATT TTTCTGCCAATAAAGTTAAGAAATTGCCTAATAAGATCCTTAGTTTCTAT GCATCATAAAACAAAATCGTGTAACTAATGGCTTTAAACTAACTCACTAT GCTAGCTTTAAGAGAAAATCGCATAGAGCAACAGGAATATCTCATGACGG CTGTCTTTCTTCTGTCATTCGCCAGCCAGGCTAGCCAAAAGCTCCTCATC TATCCCATCCGCCGATGGTGTACCCGCCGTGCTGCTAAGATTGAGCAGTC CTTCATTGCCAGACTGCGAAGGAGGCACCGGCGGCTTCGCTTCCGGCTCC GTCAGTCCAGTAGAGCTGGCAATAGGTCCTAATATCGAAGATGATGTTCC CGCTAAAGCCGGTTCTGAACTGCCACTTGGCGTGCTGCGTCCACTGGTTG TATTGCCTCCGCTTCCTCTCTGCGATAACTTTGGGATCTGGAATTTGTTG TGGAGCCCCTTGATGAAGCCTTCCATGCTTGCGGCCATTGTCGGAGAAGC GTATTGGAGGATGGTCATCATATCCGTGTGGTGATCGAATCGCGGCGGTG GCTGCGACATTGAGCCGCTAAGGGCCGGCGATACCGACCCCGAAGATCCG CTGCCTCCTCCCGAAGCGGAGCCTAACTTTCGCTGCCCGCTGCCTCCTCC ACTGCTGCCGCTAGCCAAGGCTCCCATGCTGGGACGCCGCCTGGGGGCAT TGTGCTCTTGGAAGGAGTTAGTGCTGTTGCTCTTAGTCAGCGGAATTCCG CCACCTGATCCCGACCCACTGAGCTTGCTGCTGAGATTGCCCGAGGAGTT TGCCTTCTGGAAGAAATGCTTGCTGGATGATGCCGTGGCGGACGAGACCG CTGCGGTGGCCTTCTTGGAAGCGGGTCCGCTGTTAACGCCCGGCTTGAGT CCGGTATGCTGCTTCTTCGTGGATCCAGTGGACCCAGCGAAGCTCGTGGC GCCGCTGCTGCTGCTCTTTGCCTTCGCTTGGAGGCCAGAGGAGGAACTAG AGCCGGAGCCGGTGCCGGAGCTCTTGCTGCTTCCCGTCTTGTTGATGGTC AGCTTGAGGCCCTCTTGGCTGCTGGGCTTCACCATGTATTCCGTGGAGGC TCCGGCCGGATTGATGCTCCCGGCGGAGTCGCTGCTGCCCCCGCTGGTGG TTAAGCAGCTACTAGTTGGCGCTGCTCCCGGCTGTGGCTGCTGCTGCAGA ATTGTTGCTGTTGCCAGCGTTGCTGCTGCCGCTGCTCCCGCTGTTTCCTG CCCCTGACCCACTACCGCTGAGACTGGAGACACCAATGACGCTGCCGAGC CCGCTGCCACTGTTGTTGTTGGTGCCGGAATTGTTGGCGCTAAAGCTGCC GTCGACGTCATCAAACTAACCTGACAAAGTAAGCATGTGGTTGTGTGTGT GTTAGGGACCAAAGAAACCAAAAATAAACCAGAAAAGAAATTATAACAAT CAAAAAGGGGAACATCACGTGTAGCAAAAGAAAAAATTGTGGGATTTCAC AACCATTGGTAGTGTAGGAAGGGAATACAAACAGGAAGAAAGAAGAATGG ACCCCGTTAATAATTAGCTTTATAGTTAAGTCGGATACGAAATATATTTT TGAGGAGAAAATGTATGAGGCAAACGCTTGTGGAGCTACTTTCAAAGTGT ACATCATAAGCACATTAAACACTAATTTTAAACGTAGTAAATATTTAAGT GAGAAGGAACTCTTGTAACTAAATCTAGAAAAGGGGAAACAATCAAATTA TAATACTCGTAGAGTCAAGATGCCAAGCACTACTAATTTACACATTATTT ACTGATGTTCTTAACAAAGCTTAAAAGTCATATGCATACACATTCTTATA AATCCAGCAATACTGTAGACACTATAAACTTGGTGAACCAGTACGCCATG GTTTTCTACATGCCACATGCTGGCCAAACAACTATACAAATCAAACAGAT TAACTAATAATAAAAACATACGTTCTCAATGCAGAAAAAGAGGTTTAAGC TGGTGTTTTGGGGATAAGCCCCATTACCATACGAGTTTTGGGTTTGGTCG AAAATAAAACGGATGCAGCAGTATATATGACAAATAATTGAATCATATGT ATTTACAAAAATTAGAAAAGGCAAAACGAAACACTAACAAAAATAATAAT CATAGTACTAAATATAATCATTTTCAACTACAGCAGAGGTAGGCAAATTA CAAATCGTTTTATAGCTAAAGTAAATACAGCATTTGCATTAGTTTAAAGA TAGGTTCGCTCTGAGTTTGATTCTGCATTGGTTAGGAGAGGTGGCAGAGA GTCAACTACGTGTTAGGCTTCCAGTGGGAGATGCTGGGGGTGGGTTGGTG TGGTGTGGAGTGGAGCACTTATAATGAAAACGGACTTACCGCACCTCCCG CCATGCCCTTGCGCAGGGCACTCAGCTCCAGTCCGGAGGCCCCCGCTCCA GCGCCAGCTCCTGCTCCCACCACCACTGCGGCTGCACCAGATGCTCCCGC TCCCGACGGGGCCGCATAGCTACCCAGTCCCCCGCCCGCCGCCAGATGCG AAAGACTGGCGACTGACTTCATCTGCTGTTGTGAGGATTTCAGGGCAGCT ACTGCAGCAGCCACACTTGCCGGTGAAATACCTCCGCCAGATGCGACACC TGCAGTTGCCGAGGATGATGTGGAACTGGAACCGGATGCCGAAGAGGTTT TCTCCTTCTTTAAACTCTGGCTGCTGCTGATAGATCCGCTCGAGCTCGCT AATGGAGGAATTGGAGGTGGTGGAGGCGGAGCTCCAACGCTGGCAAATGA CCTCACCAGGCCAGTAGCTCCGCTGGATCCTGAGGAGGCGGATGGTCCCG AAGATGTGTTACCCACAGCTGACGAGGACTTATCGCCCTTGGGACTTAAG ATGGTGGCAGCTGTAGCTGCACTTTTAAGCGTTGACATGCTCGGCTTTCC GGAAGAGCCGTGTTTGGGTGAGTGTGTGCCAAACGGCGACTTCGGGCTGT TGGAGGCGGTGTTGTGCTTGGGACTGCTATACACGGGAGAGTGCTTGGGG CTGGGACGGGCAGTCGGCACTCCGGCCATTAGACCCTGTCCACCGCCACC AGCTTTGGGTGACGACGAGGGAGAGGAAAACTTGCGAACCACTCCACCAG TTGCGGAAGCATCTGCGCCACCTGCAGGCGAGTTTTGCCTAGAATAGATC TTCTCCGGCGGTCCCATGGGCGAATCGTCGCGCTTTTTCTTGCGCTTCTT TTCCTTCTGCGTATCTGAAGAGCCGCTGCTGGCTGAAGACGACATGGAGC TGCCAGAACCACTACAACCGGACGTAGACGAACTACTTGTGCTACTTTCG TGGGGACGCTTTGCGGCCACACCTACTCCAGCTGAAGCAGCGGTACTTTT TTTGGTTGAGTCCTTACTGGGATCCTTGCCAGTTATTGGGGTAATAGTTA TAGTCGTGGGAGTGGCACTGGATGAGGCTGTAACACCTCCTCCGGCTATA GCCGCCTGGGCATTCAATGGAATAATTTCGATACCACCCGTTCGCTGTAC CTCGACCCCGGACACTCCCCCAGCTGATCCAGACTTTCCATCTCCTGGGA TGGGGGTGATGCTGACGCAATGCTTCAAATTTGGAGTCTTGTCCTTCCAG ATATTTTTGTACTTGTCAGCAATGTCATGGTCACTCGTCTTGGCGGAGCC GGATGAGCTGGAGCTGCCGCTGACCGTGGTGCCACTGGCCGAACTACCAG ACTGTGGATCGGTTTCCCGCTTAAGATTGATCAAACCCGCTATGGCCGCT GCTGCCGAAGTAGAAGCGGCAAAAGCATCCGCTAGAGATCGCGACTTCGC ATCCATTTTAAGGTTGTTAATGTTGGCGAAGCCACCTCCGGGTAGGCTTC CATCGGAAGGCGTCGGCGTATCCATTGAAAACTGGCTAAAGTTATTGCCT ACTCCTGAGACAGGTCCACCACCACTCATGCCTCCACCTCCGATTGCTCC AGAACCAGATCCAGGTCCAATCGCGCCATGCAG