##gff-version 3 ##date Wed Jul 24 04:10:20 CEST 2024 ## exported from the transgeneomics system molecule_59024245 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59024245 mpicbg region 9631 27295 . + . Name=dmel-5.43-2R;type=genome;start=9850391;end=9868055;strand=+ molecule_59024245 mpicbg region 27296 27368 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59024245 mpicbg region 27369 28357 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59024245 mpicbg region 28358 53904 . + . Name=dmel-5.43-2R;type=genome;start=9868056;end=9893602;strand=+ molecule_59024245 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59024245 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59024245 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59024245 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59024245 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59024245 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59024245 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59024245 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59024245 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59024245 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59024245 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59024245 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59024245 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59024245 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59024245 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59024245 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59024245 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59024245 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59024245 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59024245 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59024245 coding_transcript gene 11413 12119 . + . Name=CG42806;ensembl=FBgn0261975;identifier=FBgn0261975;id=50754658 molecule_59024245 coding_transcript gene 15092 16647 . + . alias=Pts;alias=FRS;Name=Aats-phe;alias=PheRS;alias=Phenylalanyl-tRNA synthetase;ensembl=FBgn0020766;id=51470651;identifier=FBgn0020766;alias=CG13348 molecule_59024245 coding_transcript gene 16655 17902 . - . ensembl=FBgn0033887;Name=CG6704;identifier=FBgn0033887;id=51478633 molecule_59024245 coding_transcript gene 18346 19576 . - . id=51478738;identifier=FBgn0033888;Name=CG18568;ensembl=FBgn0033888;alias=anon-WO0140519.113 molecule_59024245 coding_transcript gene 19744 26910 . - . alias=EP2054;alias=EP(2)2054;Name=CG6701;ensembl=FBgn0033889;id=51478756;identifier=FBgn0033889 molecule_59024245 coding_transcript gene 27107 31281 . - . Name=Ctf4;ensembl=FBgn0033890;alias=CG13350;identifier=FBgn0033890;alias=anon-WO0140519.180;id=50903813 molecule_59024245 coding_transcript mrna 27107 31281 . - . parent=50903813;id=50903820;Name=FBtr0087606 molecule_59024245 coding_transcript exon 27107 31281 . - . parent=50903820 molecule_59024245 coding_transcript three_prime_utr 27107 27292 . - . parent=50903820 molecule_59024245 coding_transcript cds 27293 31042 . - . parent=50903820 molecule_59024245 CLC misc_recomb 27369 27402 . - . Name=FRT molecule_59024245 CLC cds 27410 27481 . - . Name=BLRP molecule_59024245 CLC cds 27482 27502 . - . Name=TEV molecule_59024245 CLC cds 27503 27526 . - . Name=Precision cut site molecule_59024245 CLC cds 27527 27568 . - . Name=V5 molecule_59024245 CLC cds 27575 28291 . - . Name=SGFP molecule_59024245 CLC cds 28298 28357 . - . Name=2xTY1 molecule_59024245 coding_transcript five_prime_utr 31043 31281 . - . parent=50903820 molecule_59024245 coding_transcript gene 31459 32700 . + . id=50903784;Name=CG8067;identifier=FBgn0033891;ensembl=FBgn0033891 molecule_59024245 coding_transcript gene 32622 38493 . - . identifier=FBgn0020620;alias=CG8085;Name=RN-tre;ensembl=FBgn0020620;id=50449535;alias=tre oncogene-related protein;alias=CG13351;alias=DRN-tre ##FASTA >molecule_59024245 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACTGCGACTTCGATTTTTGCCC CCTTCTATTGCATATATATGTGTGTCCATGGTTCCATTGATGATTGGGCC AATCATCCTTTGTCTCGCAGCCTTCACTTGCAACTTCGTCTGCTTATCAA TGGTGGATTGTCTATTGATTAATTGAATGCGCCCCTAGTGTCGTCTAATT CTTATCGCCAACAGTCAGGGGTCGTGATTTTTTCCATTATTTTACTGAAT AGTTCCGTGCCAAGCGTCATTAGCCCCAAATGGGGGCGTACAAATAATAA TTAGCTGTTTGTGCAGAGATCTCATGTGATAAGGGGGATATATGTACATC TCTATATATGCATATTGGTTTAATAACTTTGGATATTTTGCCTTTGATGG TTTTATATTCACTTTTCGAATTCAAATTCAAATGCACCCGCATATGCAAT ATATGCATATAACTTTATTTCCCTTCCTTTTTTTATCTGCTGTTAAATAT CATATTCAATTGAGTGACTCATTTGTTAGAGTAAGCACAGAGTGGTGTAT TAAATTATTGTTTATAAATAACAAAGTCTGATCAACTGAAAGAATAGGAA TCATATTTATGGAAAGAGTTACTCATCCTTAATTAAAAATAAAAAGAAAA TCAACTAAACATTTGCAATTTCCCCACTCATATATTATTTACCTAACTAA ATTTTCTTTGATCATCTAATTTAGTTTAGATTTAGTTTTCTTTTTTTTTT CAAAATAAACTCACAATTACTTTACATTTGCCATTTTACATTTCGAGACC GTTAGGTGTCATGTAGAATACTGCAAACGCTCGGTCACACTGCTGCAAAC AGTGCTACCCATGCTTGCTTGGGGAATGAAAGGCGCGCAATTTAAATGTG ATAACGATGCCAACCATTAGCTCTCACTGCTTATAGTTAGTTAATAAAAA CGACATTATCTGTAATGTGTGTGCAGTCCAAAGTGCCACAGTTGTCGGTT GCAAATGCACAGCTGCAAAAGTCAGCGTTGAGCAACTGTGGCACTGATAA GCTCTAAAATTCCAGATTAATGCGTTTTAATTTAAGCAGCTATTCGCATA GTTCGGCAAATATTCAACAACAATATTTAAGAACAAGTCGTGCGGGGGGC CGCGAGCATTTTGGAAATGACGCGCTACAAATCGGCGTTGCTTATCAAAT TGCCATTTTTCGCTGGCATTTCCGAGAGCCGAAAGAGATTTCTAGCATTA ATTCCCCGAGTGACAAGTGCACAAACAAATCGGCTGCCGTAAATAAACAA GCTGGGAAAAATTTCGCTGACTTGCAAAAGCAGCATGCGGCTCTTTTCTT ACATTTTTTATTAAAGATACATAAGTTTCTGTTTTTTTTTTCGTTTTTTT TTAAATCTGTTACTTCTGCTAACCGGTTGGAGCAAACATATTTGAATAGC TCGCCTGAAATCCTTATAAATCAAAATGAAACCGGTTCGCCTTTTTGAGC AAACCCACAATGCGCGCGCTGCAAAACAGAAGGAAATATACGAAAAAGCA TAAGAAACAAGAAATATATAGAGTACGCCCGCCTGCCATCCTCCAAATTG GTTGGCCTACGTAGATTGGGCTCTCATTTCGATTTCGGCGATACGAAGAA AGAGTGTAGAGTGTGTTGTGTGCGTGTGTGAACTCGGCTCTTTTTCGCCC CGCCGTCATGCGATTGAGTTTGCGTTTGCGAGCGGACCACCACCATCACC ACCACCACCACCAAAAGCGAAGCAGCCAGCTCTGTCGTATTTTTGTTATT CCCGAACCGACGCTCCACGCCAACGGAACGCTCGAGCAGCCAGCGGCAGG CAGTAGCAGCAGCAGTGCAGAGCGCAATATATAGAACATTTGAGAGAAAA GAAATAAAAGGAGCCAAGTCAGACGGGGCCCCCAGCGGTGGTAGTAGAAG TACGGAAAAGCACGCGCGTCATCGTAAAAAACGTGCTACGAAATCGCAGG GAGACGGGCGGTAATAGCAAATAAATTACATAAAAACCACGGAGGAGCAA TCACAGCATAAGAATGACCGATACCAGTGCAAATAATTTGGATGTATCGG TGGATGTGGTCTGGCCGACGATAATTGTCCTGGCCATGCTGGTCATAAAT GGCTTCGTTTTCGCCTACATTATGCGCAAGCGGCGGGAATACAAATGCCA GGAGGAGGAGCTGCAGCAACAACAACAACCTGTTCCACATTCCTCCTATG CGGCCACTTCGACAACGGAACGGCATGCGGATGCGGATCAGGAGGACGAT AGCTGTGCCATCGAGATGGAGCGACTGTAGGGATGGAGATCGCACTAGCT AAGCTCTCTGATACTCAACTACTATCGTCCAAGCTTCTCAACTGCAACGA AGTTTCCTAAGCCACATATGTAGTATATCTAGATTGATAGATACAAAACG TATACGTCGAGTGCCTGGATATCACATCGGATCGCACGTGCATTTAATTA CGGTGTTTTTAAGTTGTTAACTCTATCTGCATATATCGCAAATTCAAATT TTCTACAAAAGTATACAATAAATGTGTGAATTTTATCATGCGGCAACGAG AACCAACGACGTTTGCAAGGAAAATCAATAGGTCAGTGTGCCGGGAGGCG CCTCTTTTCTGCCGTTACCACCTCCTCCCTCGAAATCACAACGGGCGGGG TTTCATTTTGCTGCAAGACTCGAATTCGATTCAATTATGTCAATTATAGG AGTCAACCACGGACCAGTGGACCCCATCCGGTCCATTTGGGGCGACAATT GCTGATGCTGGTCCGCTTTGATGTCCAAAAGTAATTACACATGCATGTTT CTCACATGACAGCGCCACTCGACTGTTCAGTTCAATGTGCCAAGTACCCT GGAATATTGCAAAATCTACTAAGACTTGTGGTGAGCCACTTAAAAAGCGA TTAGGTTTGGGTTTATACCCATATTTCACTGAGAAAACATGCCACTTTGA GTGCGTTGAAGAGTCGCAAAAAAATAACCAGTTTAGCAATAAACACTTTT GGAAAATGCATTTCAGTTTAGCATGTTTGCTATTTGGATATTCGTGAGCA GTAATAATGAGTTTTGTTGAATAATTCTATATACTTAACTTAACTTTCAT AAACTTTTCGATTCTATGCAAAGCCGCTAATTTGGTATTCAGACAAGAGG AAGTCAATTTTTATTCACAAATTTCACTTTGAATCGAAAACTACCCCCAT ATAGTGGCATTTGCCGAATCTAATGGATAGCAACCTAGTCGACTTCTTGC CCTGGCCTTTCAATTCCCTTTATAGCTATCATTTGTTTAGCGTTCGTGCT ATTTTCGTGCTGTGGCTGTGTCAATATGCGGGTCGGACTAACAAACAACC CCGAGCTGGGAGAGGAGGTCTCTTATCCACGGGACCACTGCAGGCAGATG GAGCGCATTTCCTCGTGCTGGCCTCGCTTCTCCTATTCCTACCTGCAGTT TGGCTCGTTTGTTTACTACCTGGAACATTAACACCCGTTTCAAGTTCCTG TCGTTGGGCAATCGTTAAACACAATTTTATGACCATGTTTTATAGATTTA TAGAGCTTGCTACTGTGGCCGTTCCTCTAGAGCGTTTCGCTCGTGCCAGG TTGACGGCGCTGTGATAAGGTGTAATCTGCAGATTAAGAACTTTTGCCTC AGCGATCGTAAATCCATTTTACGTAAAACATTTTATTTGATTTTTAATAG AGTTCCCAAAAATGCGTCTAAAAAGTTAACTTTTCATTTGGTTGGCTTTA TCTTATCTTGAAACAAGTACACGAAAGTCAATCGATAGTAGCACTTACCT TTGATAAGAGTGCATTATCTAACTAATACTAATACTTTTCATTATGCAGC TGGAGCACCGCAAGAACTATCAGGATGAAACCGAGGAGCGTTTCCGCCTC AAGATCTTCAATGAGAACAAGCACAAGATTGCCAAGCACAACCAGCGATT CGCCGAGGGCAAGGTGAGCTTCAAACTGGCGGTCAATAAGTACGCCGATT TGCTGCACCACGAATTCCGTCAGCTGATGAACGGCTTCAACTACACTCTG CACAAGCAACTGCGGTAAGTTGGGATCGTTAAGGATTATAATGTGCACAT ATTCAACTTTGCATTCGCTTTCAGTGCCGCCGATGAAAGCTTCAAGGGAG TCACCTTCATCTCGCCGGCTCATGTGACGCTGCCCAAATCTGTGGACTGG CGCACCAAGGGAGCTGTGACCGCCGTCAAGGATCAGGGACACTGCGGCAG CTGCTGGGCCTTCTCCAGCACAGGCGCCCTCGAGGGTCAGCATTTCCGCA AGTCCGGTGTCCTCGTCTCGCTGTCCGAGCAGAATCTGGTCGATTGCTCC ACCAAGTACGGCAACAATGGATGCAACGGCGGTCTCATGGACAATGCCTT CCGCTATATTAAGGATAATGGAGGCATCGATACCGAGAAGTCCTATCCCT ACGAGGCCATCGATGACTCGTGCCACTTTAACAAGGGCACAGTCGGAGCC ACCGATCGTGGATTCACCGATATTCCCCAGGGTGATGAGAAGAAGATGGC CGAGGCTGTGGCCACCGTTGGTCCCGTTTCCGTCGCCATCGATGCCTCCC ACGAGTCGTTCCAGTTCTACTCGGAGGGCGTCTACAACGAGCCGCAGTGT GATGCCCAGAATCTGGATCACGGTGTGCTGGTCGTTGGCTTCGGCACCGA CGAGTCCGGCGAGGATTACTGGCTGGTGAAGAACTCGTGGGGCACCACCT GGGGCGACAAGGGCTTCATCAAGATGCTGCGCAACAAGGAGAACCAGTGC GGCATCGCTAGCGCCTCCAGCTATCCCCTGGTCTAGAGCAGAACTGATGT AGTTTAGCCCCAGCATTCATATGATATGATTTAGAAAAGAAACAGAAAAG ATACCAACGCAAGCATCTCAAAAATGAACTTTAATAATTTAGCCCAACCT CATATTTAATGAACTAATTTTGTAATGGGTCCATTGTATTCGCGTTTCTC TGCCATCATGTATGATATAGGTGAACAACAAATCTGTTGATGTTTGTAGA AAAATAAATAAAAATTATATAATTTTAAAAATTGAAGTTTTTGAATTGGG AGAGAAGTTATTTTGGCAAATCAAAGTTTTGCAGTCAACTAAGTTTGGTT TCTTTTCACTCAAGACATCCCTTAAAAATATATTTTATGTATTTTGCTTT GAATTTGTAATATTTGATTACTTATTCACAATTTTTAGTTTTGATTTAAA AAATACATTTCAATTCATACAATTTCATACAATTTCTGTTCAACACTTTC GCTTTCCGGCAGATGGCGCCAGGTGGTTATCCAACAGCTCTGTTAGTGTG CGCCTAACAGCACAGTCCGTGCTGCTGAAGCCTTGCGACTGCTGTAGAAA ATTATCGATATGTTAACATAACATCTGATAACATAACATAACTTCCAAGT TATAACAAAAAATGCAATAAATAGTTGCATCGAATCAATAAAGTCCCTCC AATATGCTTCTGACGCTTCGAGTGCAGGGAGCACGGCACTGGTTGAAGTC CACCCGCTGCCTGGCCAGCAGTGCGGCGCCCGCGAAGTCGCCGTCATCGC CACCGCAGCTGGAGGTCAGTGGAAGCACGTACGCCACCGACGGATGGACG AACGTAACGCCCAAGATACTCTCCTACGTGGGGGCCAACAAGCACCTGCA GACGGACCACCCGCTTTCCATCATCCGCCAGAGGATCGTAAACTACTTTT ATGGAGCGTATCGCAACCAAAGGGGCAATCCACTATTCTCCGTCTATGAT CAAATGAATCCGGTGGTTACTGTGCAGCAGAACTTTGACAATCTGCTAAT TCCCGCCGATCATGTGAGTCGACAGAAATCCGATTGCTATTACATCAATC AGCAGCATCTGCTGCGCGCCCACACCACCGCCCATCAGGTGGAATTGATC TCGGGCGGGCTGGACAACTTTCTGGTCGTGGGCGAGGTGTATCGACGGGA CGAAATCGATAGCACCCACTATCCGGTATTCCACCAGGCGGACGCTGTGC GGCTGGTCACCAAAGACAAGCTTTTCGAGCGCAATCCTGGCCTGGAACTC TTTGAAGAGACGTGGTCGGGTACGCTGGCCGACCCCAAGCTGATTCTGCC CTCATCCAAGTTCATGGACCAAACCAAACAGCCCTGCCACACGCTCGAGG CCGTCAAGTTGATGGAGCACGAGATGAAGCACGTGCTGGTTGGCCTGACC AAGGATCTGTTTGGGCCGCGCATCAAGTACAGATGGGTGGACACCTATTT TCCCTTCACCCAGCCCTCCTGGGAGCTGGAGATCTATTTCAAGGACAACT GGCTGGAGGTCTTAGGCTGCGGCATCATGCGCCACGAAATCCTGCAGAGA TCGGGCGTTCATCAATCGATTGGCTACGCCTTTGGCGTCGGCCTGGAGCG ACTGGCCATGGTGCTGTTCGATATACCTGACATCCGGCTCTTCTGGTCGA ACGACAGTGGCTTTCTGTCGCAGTTTAGCGAAAAGGATCTGCACAATCTG CCCAAGTACAAGCCCATCTCCCACTATCCGCAGTGCACGAATGACTTGTC GTTCTGGCTGCCCCAGGACATTGAGGTGGATGCCGGCTTCTCGCCGAACG ACTTTTACGATCTAGTCCGCTCTGTAGCTGGTGATATGGTGGAGCAGGTT GGTCTTAGCTATCCCAAACGTATCATATGTTACGAGTATTTCTCATATAC TTTACTTTTCTTACAGATCAGTCTGGTGGACAAGTTTAAGCACCCGAAAA CGGGGAAATCGAGCGTGTGCTTCCGCATTGTTTATCGCCATATGGAGCGC ACCTTAACCCAGGCGGAGGTCAACGAAATCCACAAGCAGATCGCTAGTGC GAGCGTGGATAGTTTCAATGTGCAAATACGTTAGTCATAGTCTAGTTCCG TTTCAATTCAAAACCAAAAAAGAAAAACACCAGTAAAGATAGCCAACAAA GTCAGGTATTTCATATGGTCTTGAATGATTTAATATTCTGTTCCACCCAC TCGTTGGCGCTCTTCAAAAGCTTCGGATTCTCCACGAACTCCTGTTGCGG CTGATACGCTGTCTTGGCTCCGCTGCGCACGAATCCTGCCTCTCCTTTGT TGAGAACGCCAACGGAAGCCATTTCGTGCATGTTTACGGACTTGTTCTCA CGGAAGCTTCTGATGCTCAGATGATCGAGTAGCCTATCCATATCCTCGGG TTTCGGTGGACACTCTAAGAAGCTGGCTATGCTGTTGATTGCACCTGGCA GATCAGCCAACATGTCTTCGTAGCGCAGAAAGAGTACATTGGACAAATGG GCATGCTCCCGCGCCTCCTTAACGTGACTGTAATAGGGCAGCCAGGGATC TGAAAGATAGTTGGTTAAGGATGGCAACTCCATCGAAGGATCACTTACTT AATCCGTTTTGGAAATAATGCCAGTAACGCTCAAAATCTCCGACGTATCC TTGGGTGCGGAAGAGTCTGTTCAAATGGTAGTAGGAAACTGCAACATCCT TGGGATCACGAACCACATAGATCACCTTGCACTTCTTTTCGAGAACACTA GGCGGCATTAGAGAAAAGGGGAAATGCGTTTTGATAAACCGTCGCTGCGA GCGTGGTATTTCGCTCAAAGCCTCGTAACCCGGTCGAGCTATCTTCTCAA TGAACTCCAGAGCTTCAGCCGAGTCTCGGTTTTCCTCCTGCAGCTCTTCC TTAATTTTGGGATGCACAAAGAGCGGAAATCTAAGGGCGGTTGGAGTTCA CTTAATTAAGATAGGATCGCGCGACAAGCACTCACTCAAAGAATGGAAAG CGTTCGGTTAGTGGTCGCTCCTGGGCATGCTCAAAATCCAGCCCATTGGC CACCAGCCAAATGAGCTCCTGCGTCCAAGTGGTGCCCGATCTGGGCACCG TGGCTATCCACACGTCATCCGGCCGTGCCTCAAAGTTGTAGTACCGCTCG GCCTCGTCCTTGTACTTGTGCGGAAAGAAGTAACCCTCCGATCCGACCTG AACGAAGCCAGTTCGCTCACCTGTTTTTTTTTTTTTATTTTTTATATACT AGGTGCATCACAAGCCATTTGCGCGCTATAAACATACCATGGAAGTGATC CAATAGCTCAGCATTGGTGGACTCCTCCACATCGCGAATTTCGTGTGGAA ACTTGAGAGGCGTATTTTCCATTGCTCGCGCGATCAGTTGCCAGCGTTGA CTGAAGAACCGCCCGTCATGAAAGCGTCTTGACCCCGCTTTCGGCCCAGA GAGAAAGTGTCAGCTGCTGGTGCTGGTGCTGGTGCTGGCCTGGCTAGTAT GGCACTCCATTGCCGCTTGGCTAAGCTCAATTTAAATACGACTTCAGTTA ATGTCTGTGTACTTGCTGACGCTGAATTTTCCCCAAAAGGTGTGGTTCCA AGCCATTAGTTAGCTCAGACGGCTTTTATTGGATCATAAACAGTGGCGAT ATAATGTTGTTGGAGTAAAATAAGCCTCAAAGTTATAACCTAAATAACCA GTTCTTAAACGTATATATATATATATTCTTGATTTGTATCGGCAGTTAGT CTCAGTTTTGAAGTCCAAAATTCTTTTTTTTTATAGAACATACCACTCAT ATATCATAAAACCCAAGCACCCATTAAAAGTCATAAATGACCATTGAATT GAAAAGGACTACTACTTTACGTGCACGACACAGACAATTTGATATAGAAT TTCCTATAGTTTTTAGATTATTCGTTTAGCTCGACGTTGTCGAAGAGCCT GAGCAGCTCCTCTTCCTTGCGCTTGATGCGATCCTGGATGGTGGACACGG ACTCTGATTTGGGCATAGAGTTTTGGACCCGGCTGAAGAAATCGTCCATG GACTTGAAAACGTTCTGATACTGATTATCATAGCGAGCGTACTGGTGCGT TGGTGGCTTCTTGGGCGCCCTCTTGGTCACGGCATTCCGGAACGAGAACT CCTTCAGTTCGTCCAGATGCAGTTCCTCCTGCTGCTCGTGAGCAGCAAAC CTGCGCGATGATTGTCGCTCTCTTTCCTCCTTAAGCTCGAGCCGTTCCCG ATCTATTTGATCGACCAGCTGCGCGGAGGGGCATACCATCTTCACCTCGC CAAGGATTAGCTTATGATCGAGGATCTCAGACTCATTCGTCTGGACGCCG GTCTCCAGTAGCTGCTGAGACTTGGACGCCTTCGATTCTGACTCCTCCTC GACATCCGGCAAAATATTGGAATCCTCTGGCACTGGCTGCCTATTCTTGC GGAAATTCGAGTTCAAACCCACGCCCGCCGGTTTGCTGGGCCAGAGACGA TCCCGTGCCGCCTGTTTGGCCGCTTGCGACATCACACGCTGTTTCGTTGG CTTCCTGACTTCCGTTTCGGTGTCCTTGGCCAAGGGCACCACTAATCTGG ACTTCTCATGTCCTCTCGCTCTCTCGAACTTCTGCTTGGCCGTCTGCCTG TTGCTGCTGGCCCTCAGCGAAGAGGCTACCGTGGGCTGGACCAGCCGAGA AGGTGGATTATGCTTGCCAAGGCGACGACCGGTCTGCTTCCAAGCCGCAT CGGTTCCCCCATCGCCCGCTCCGCCGTGAACAGTTCGCCGTGTTCCCGCC GTCTGCGTCGATAGAGGTGCCGCTAACTTGGAACGCACTGTGGCCCCGGA GATGGTGTTGGGTCCTCCACCTCGGGGTGTTGAGCCCGCACTTTGCCCAC TGCTCCTACCGGCTGAATGCATTACGTCAATGGGTTATTGGTATCCTGCG TTACTGCGGCAGTTGTATATACTTAAAATTTTTAGTTAGCTTTAATACTT TTATTTTTACAAGTTCAATTGTTTGAAATCGGTAACGAAAAACGAATGTA CTAAGCCATAGAGCTTAAGGCCCGACACTGAAGTCGTTATAAAGGCCTAC TTGGTATGGAATCATACTTATCTAAACCCTTACTCGAAATGCATTCAAAA CCCAAAACCTACCCAAATAAAACCTAAGCCAAATCCAATCCAAATCACAA GACAAAAAAAAATATAAACAGTTGAATTGTAATCCGATAATTTAGAATTT ATTATTTAGATAATTTTTTTAAGTATAAAATAGTTTGTCGGGCATATACA TATTGTTTTCTACATTGTCAAATTGTTTCAAGTCTTCAGAACCGATGACA CAAGGAGTCAGCAAGTTTTTACTTAAATATGAAATTGTTACAAAAGATAA TATTCTGTGCGGATTACATGTTTATTTTTTTGTGGGGAAATATAGATAGG TTTTAACCTGCTCCCCATTCCCCCTATTCAGTAAAATACTATTTTCATTA TAACACTCAAGGTCAAACCTGAAGACTGAAGTGCACACAATGCTTTCGAC TTATACTACGGTTAATGGGTTCGTGGTATAACTCGAAAGCGTCGGGCTTT TGCAACCGAAAAGTGTTCACTTTGAGCGCTCCATGTCTTTGCTCGAATCA ATTACACTCGCAAAGGATGCGTTCCATCGAAGATGGAAAGCCTCAAGCTT TTGGCCTTGTTCTTCGGATGGACGCACATCAGTTGCGAGTCTATTTGGGG GATTTTTTTTTGCTACTTGGCGCATGGATGATCGCAGATCGCACAAATGC CAATAGCAAAGTCAAAAAGAGGACAGCGAGATCACTTGTTCGGCCAAGCA ATCACGTTGTCCCTATAGATTGTGATGAGCTCCCAAAGAAGCCACAATTA TGAAATGATACAGTTGAATTTTTTGTTCCTTCGTGGAGGCGTTGGATCGC GTGGTGGCGGTGACCAACCGAAATTCGACCAGTTTCCGTGGGGCTCGCGA AATGGTCGAGCACGACGTTGATCATTGGCACCATTGAAGCGTCGAACCTC TTCGGGCGTGGGACGCACGTTCTCGAAACGAAAATTGCCACTGGGAATGT GATTGTAAGCCGAAGACCTGGTTGTCTTATTCTCCGAAGGCGGGACGGCT TCGATGCCACAGAGCACTCCGTTAACACAGCGCTCCGTGTTAGTGGAGAG CGGATTTGAGGACATCGAAATCGGGTGCTTGGAAGATGAAGGGATTTCCG GCATTGGAGATCGTGATTTTGCCACTGGAGTTGCTGCTGAAACAGTTGGC TTTCGTATTGCTGGTCTAGATACAGACGAAGAATGCAAAGCGGGCGTCTC CTGCTTCATCAATCCTGCTCTTGGTATTACTGATGGCGCAGCAGCATTAG TAACTGGAGCATTAGTAACTAAAATCGATGTTCCTGCGGCGTCCTGTTTG GTTTCCAATTGAAAATCTTTCAGTTGGGCCTCTATCGAACGAACTTCATC CAAATCGTGGTCCACAGACCTTGGAACCTTCGGCAACTCGTCGAATATGG TTTCGAGCTCAGATTTTTTCCGCTGACACTCATTCCCGAGGTTAAGCAGC TCATTCTTGCTGTAGAAGATCTTGGCGTCCTGGACTGGATTCTTTGCATG GTTCTCTGTTTGGGATAAGGTGCGGGTTAGAGGTTAGATAATATAATTTA AGGATGATCACGCCAGAGAAACAAGCAATCGGCAAATTAAAAGCTATTAT CATGCAAAAAGAGCCGACATCCACGACATGGGATTGTAATCGGCTTGTTT TGTCTGGCGACACTTAAATTGCTGGCGTTACTTACTTCGCTTGAGCGGTT GCCTTAGCCCGGATGCAGGCTGATCCCCAGCTGCTCCTCCTTTATTGACG TTGTTTGCCCCAGTCTTTTTATTCGTAATAAAATCTTCGTTAAGGTATTG CTCCCCAACCAAGGTCTTACGATTGCGGCACATTTCGATAATATGTTGGA AGTCACTGTTTTGGCTTAGAGTTCGTGGATTTCCGATGAGAATAAGCAGC GAAATCGGCCGCGAAAGCAGAACGTTCAACCGCTAAACGGGTGTGCAATA TAATTAATTTAATGGAATAATGTTTTTTTTTTTTCATGAATAGTTCTATT ATTTTATAAACAAATACATACCCGTTCATTGTTCAAGAATCCAAGTTTGG GAGTAAAGGAGCGCACAAATGAAACGATTATCACATGCTTCTCCTTGCCC TGGAATAATTCGACAGAACCGCAATCTATTTGAGACCAGTTTCGCATGTT TAGCTGCTCTTGGATACGTTGGTACTGGTTCTTGTACGGCGATATGATAC CGATATCAGTCTGCAATAACTTCTCGCCATTGAGGCCGAAATACATCAGA TCCTTCACGTAATCCATGACAACATCAATCTCTTTATTATTGCACAGGCT GCAAAATTGAAATCCCATGTATTAATATCAGATTTGGTTTTGTACACCAT TTTATGCACAGACCTCACAGAGCTCTTCGTGTTCATCGTTGTGCCAAAAA CGGAATGAAACATGATGGGAAAAGTCGCATTGGGCAGGTAAAACCAGTTG TGGAAGCGACAAACAATTTCTGAAATACGAATACGAATTATAATTTTTGG ATCCTATATGGTAACTACAAGCGCTCACCCATGGGTGCCTCAGTCCGAAG ATGTCCCTCGTAGTACATATTGTTGTAGAGCGATACTATCTCCGGATGTG AACGAAAATTGCGGATGAGTCGCGTCTGCACCGATGCGTTATAGCTGCCA TCCTCTTCCACTTGGTAGCACTTCCTCTGCAGCAGTCGCTCGAAGAGGGT CAGTCCAAGACCCCATTCGTTCGCCCTCTGCGATTGGAGCACTGGTCCCA GTTGTTTGTGGTCGCCGGATAGAATCAAATTCAACGTCGGCGATAGGGTG CAGGTGATGCCCATCAAAACCTCCGCCTCCGTGGAAGCGGCTGCTTCGTC CACAAACACATGCGTATACACATTGTTCGCGGCGAAGCCACCGGTAGACA GCTTTCCAGCTAAACTGAGTGTGCAAATCACGATCCGATATTGGTGCACC GCTTGCACGGCCGGATAAAAGTGCACAGTGTACATGTTCGAGTACTCCAG AAGCAAATCGTCGATATTGTCAATGCGCCGATCGCAATTGGCGCTAAAGA TACGGGTTAGCGGTCGTGGCTGGCTCTGTGGTGCTTTGGCGATTGCCCTT AAAAGTCGCAGTGCCACCTCGTCACAAGCCGTATTTGAGCCAGCCAGCAC TAGGATGTGCGTTTCGGGTCGATTTATGTACAATTGGTAGATGGCCTCGA CGATGGTCGAGGTCTTACCCGTTCCCGGTGGTCCGAACACGATGTAGGGA GCTTTTAGACGTGGGCTCAACGCTATCTGTCGAACCGCTTGCATTTGCTC CGGATTGGTCGAAATTAACTTGTTGTTTAGCTGAAGTACTCCACTGGCCA AAGGTGTATTGGGAATTTCACCGGGAAACAGGATCCGCTGAACATCACTG TGCCTGGTGAACGACAGCTGCTGAAGTGCTCGGTACTGATAACGCATCAC TGCTCGCAATGGACGGAAGATCAGGGTGTAGGTGGTGTTGTCCGGTAACT GGCGTTCACAAGTAATGTTAACCCGCTGCGTTGAGACGCCAAGGATGCGG GCGAAGTAGACTCGTGGCTGCTTGTCCAGAGATCCGACCATTCCGTCAAC ATTGCGAGCCCACCGCAAGATGGAGTCAAAATCCTTGAGTGCCAACTCGA GCACGTTGTTGTTGTTTTCCAACATCTTGCGTACAGCCGATTTCGGGTTG CCCTTCTCGTTTATGATTAGCACATCGTCGCCAGGCGATAAGATATCCTC CACGCTCATACTGGTGGTACCCATTTGCATTTTCACGGAAAGCTCCCGCC CGAACTGATGCAGCTCCATTTCTGATTGTTTGAGCGAGAGATAATGCTGC AATCGTTCGATGTCCTCCACCTGGAGCAATGTGCGCAGTGTCCCGGTCAG ATTTTCCTGGGTAATCTCTCTGCCCCGCTCGCAGTAGTTCTGATATTGAT TATCAAAGCTAGCCAAACACATCTGGGCATCCTCGTGCTTTAGAGCACTC AACACCTGAATGGGTGGATTGGCTGGCGGAAGACCCTTGCTCTTGAAGGT CTCCTTGCTAGACAGCCGGTAGGGATTGATGTTGAAGCTAGCCTTGGGCA ATGCCTCCGTGCGCATGAAGTGATGCTGCTCCACATATTTCTCTCCCTGA ATGGTGAACCCGATAACGATGGGCTGCTCCCGAAGGATCATGAAGACGTG AGAGTCCACGAAGAACACAAGTTCACCGCTCCCATTCACCGGCAGAGGCA TTTGTGCACCATACACGTAGTAAAACTGTCGTAACTGCACTATGATGAAC TTGTCCACCACCAGATCCTTGCGGAAGGTCTTTAAGGTGAATCCAAAGTA GTGGCTGTCCACGCAGGTCTGATAGGACAGGGACACAATGGGCGTTGGAC TGCGGAAAGGAGGCACTCATTGTACATTAACCTTTTTCACATATGTAGAG ATATAATTCAATTTACTTACTATTTCTTCATCTTTTTGAGGGACTGAAAA TCAGACTCGTCGCCATGGTACTCCACATGCTCCTCATACTTCTCAATTTT CTCGAAGTTCTCCTGGCAGATATAGCAGCCCAGGGATTGGAGTTCGAAAT CTTTATCTGACTGCAGCAGCAGCCTCTTTTGAAATTTTAGAAGCGTAGGC TTTACGTCTGTGTCAAGTTTGTATTCTGCCAACAAAAAAACTCTCACGCA TAATGAGAATATTTTTTTTCTTAATTATGGATAGACTACCTTCGATTATC GGTTTGTTGCCCTCAGCAGGTGCTCCTCCGGGCACATCGGTCGTGGAGGC GATTCCCCGCAATCGGTGCTGTTCGTCCAGCAAATTGAACTTCTCCTTGC GAAAGTCCATCAAGGAGAAGTTTTTGATGCGATAGTTGGGGTTTCCACGA GGCGTGTTGATTAGAAAGTTCGTCCTATGCAGCAGGGAGCCAATCTAATG AAAATGTTGCATTTAATTTCGAATGTTATAGTTTATATCAATCGCCGAAA AGGATTGTTATATCTCAACGGTCAGAAAATTGCACTGGCGCAATAGGCAC TGTATGTATGCACATATGCATGTATGGGCATTGAAATACCAATGAAAACG GGGAATCACTTGACTCCACATATCGAATTTCACCATACGACCACCAAAGA GAAATACACAATGACAGATTTTCCTTTTCTAATTTTTGTGTTCTTTTCCT AAAGCTGTTTTCCCAAACGAGTTGCGATCCCTTTGAAATGGAAAACCCAT ATGCAGGAGATGTAAACTTGTTACTATGTACTTCATTTTAACGGCATAAA TAATTACAATGCGCTATAAGTGCGGTATGTCACAACAATAGAGCTATAGA TATACGATCTTGACACAATATAATATTTCTGTTTTTAAACTGAACTCTCA GCATTGAGTTGAGTTGAAATCCACTTAAAGTCATATACAAAATATGCATG TACATTTGTTAATGTTTATAATTTATAAACAAATGATTACGTTTGTTTAG ATCAGATTGCTGCTGTACCAGCAAAGATTCCGCGCATCTGAGTGTAAAAG AAAGAATAATCCGGCAGGGGAAACCCAAAACCCAGAACCCAGATGACTCA TAGACTCAAGCGAGCAAATCGCGATCGCACACGACGTCGATCGTATGTAT GTGCAAATAGTTGTAAAGTTGCTCTGATAATACGGGGAAAATGTTTGGAC TGGAGCGAGACAAAGGAAAGCCACATACATACATATATAGATACATACAG TACGAAATCAGTCTTATCGCGCTTTGACTAGCGAAATCGAGTGGTCTGCA ATGCAATGTCGAGAATATTGAGCAACTTAAGGCATGTTTACATTTTGTAT CCGATTATACTTATCCTAATATATTATATTTCATATTTTAAAGAATGACC TACACATGTACATATCGGACCAACAAAATGCAATTTATTAGTTTTCTAAG GCAACCCCGACCGAAGCTCATTTGGCAGTGCTCACTGTACAGGAAATAGG ATAGCAATAAGGCATTATCAATGTGATTCAACTTACATTCGTAGCTCCCT GACTGCTGAGCTTCTGACGAATCTCGCTACTGTTGGGCAGGGCGTTCAAG TGCACCTCGAATAGTTTTCGCATTTTGGCCTTGTCCACGTACCACTCCGT TTGGGCGCTTATCACCTGGAGTCTGGCCATCTCCAGCAAAAACGAGCCCA TCAACTCGCGCTCTGTGCCCGTGAAAAGTGATCCGATGTTATGGATCATA TATAGTATATACATAGTATATAGCTTACCCCACGGAACCGTCGGCTTGCG AGGCATTCCATTGGCGTAGGTGCCGGGCGGTTTGATACCGGCATTGATCG GTGGCGTCGGTGGCGGTGTTGGGAAGTCCGGCGGGGTTGCGTTGCCATTG TTATTGTTGATTATGTTCTTTTTATTTTTTGTCATTTTGGCTTGATGTTC TTTATTTTGTACTGATTTTTTCCTGTTGTTTTTTTCTATGTTTTTGTTAT TGTAATACACTCACTCAAACAAAAAGGGTAGGATCGATAATTGTTGTTGC GAATAATCGCAATTAAGTTACTTATTTGACGCGAACAAAACGCAAAGACG CAGACACACACACACGTTGAAATATTATATATGATATAGTATGTACTATT CAGCTGACGATCGAAATGCACGGCGTAACGTTCAGGTAACAAATGAAGAG AGTGATGCGCGAGCGTTGGGTTTTATATGCACGGGTTACCCAGACGGGGA TTTCTTAAAAAAGTTGTTGGGTTAAAAAATGGCTTCAACGAAAACTAATT CAACATTAAATTGGAAATAGAGTCTCTCCATCTTTAGATTTTAACGATGT CCCTGTGTGTTTGCCTGCTTGTGTGTGTGTTTGCGTCTGCAGCAGAGAGC CTTCTGAATAGCGGTGATCAGTTCGCTGGAACTGGAAATTCATTACGGAG TTCTTTAGCTTTCTTCCAGTGGCGAGAATTTCGTAAACAACGCAAAAGGA AGCACTCGCTGCCGCAATACTTACATACGTGTATGTAACTGTCAATTTAG TTTGTTATTTAAAAAATATATATATTTATTTTTTTGATATATCTAGCACC TTTTTTGCTTATTATTTCTAACCTTTATATTGTGTTTTTTCCTATGTGTA TGAGTGTGTAATTTTATGTTGGAATTTGAGCGTGTAACACTTATTTACAA AATAGAATTAAACGAACACATAACTTTGACTTGAAAGTCGTGGAAAATCC AGCCTAAAATGATCGTTTCGATCGATTAATGTCATTTACAAAGTTTGGTC ACACTATTTGGTTGGTTTAATTCCAAAGATAAAAATACCAACGGTATTCT TTGGAGACCAGAATGTTTAATTTGTAGAATTTTAAAATATTTAAAAATAT ATTGATCATATTTTAAATAAACTTGTACCCTCCGCTTTTTAAAGAATATA CATTTTAATATAAATAAAAGTATATTTTATTCTTTAAATTTAAATAAGCA AATTAATCCTTAACAATTCTGTTCCATAAAAAGCTCAAATAAAAATTTGT TATTTTACATGTAGCTCACAGAATGGGATAAACGTTACACATTATTTATA TAATATATTTATCTTAAACCTACTTATCAATCTACAAACAGACTACTTGT CGTCGTCATCCTTGTAGTCAATGTCATGATCTTTATAGTCTCCATCGTGG TCTTTATAATCTGTCGACGAAGTTCCTATACTTTCTAGAGAATAGGAACT TCCCGAGGATCCGCTGCCGCCGGCGTTGCTGCGCCACTCCATCTTCTGGC TATCCAGGATCTGGCGCAGGCTGCTGGCCATGCCCTGGAAGTACAGGTTC TCGGGGCCCTGGAACAGCACCTCCAGGGTGCTATCCAGGCCCAGCAGGGG GTTGGGGATGGGCTTGCCCTCGAGCTTGTACAGCTCATCCATGCCCAGGG TGATGCCGGCGGCGGTCACGAACTCCAGCAGCACCATGTGATCGCGCTTC TCGTTGGGGTCCTTGGACAGCACGCTCTGGGTGCTCAGGTAGTGGTTATC GGGCAGCAGCACTGGGCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGAT CGGCCAGCTGCACGGAGCCATCCTCCACATTGTGGCGGATCTTGAAGTTG GCCTTGATGCCGTTCTTCTGCTTATCGGCGGTGATGTACACGTTGTGGCT GTTGAAGTTGTACTCCAGCTTGTGGCCCAGGATGTTGCCATCCTCCTTGA AATCGATGCCCTTCAGCTCGATGCGGTTCACCAGGGTATCGCCCTCGAAC TTCACCTCGGCGCGGGTCTTGTAGGTGCCGTCATCCTTGAAGCTGATGGT GCGCTCCTGCACGTAGCCCTCGGGCATGGCGCTCTTGAAGAAATCGTGCT GCTTCATGTGATCGGGGTAGCGGCTGAAGCACTGCACGCCGTAGGTCAGG GTGGTCACCAGGGTGGGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGAT GAACTTCAGGGTCAGCTTGCCGTTGGTGGCGTCGCCCTCGCCCTCGCCGC GCACGCTGAACTTGTGGCCGTTCACGTCGCCATCCAGCTCCACCAGGATG GGCACCACGCCGGTGAACAGCTCCTCGCCCTTGGACACCATGAATTCATC AAGTGGATCTTGGTTTGTGTGAACCTCGTCCAGCGGGTCCTGATTGGTAT GCACTTCTTTCTTTGCCAGCTTCAGCTTTTCGGATCCAAAGATGACTCCA GTGTCGCCCAGTTTGCGCTTCATAGCAAAGGGATTAACCGAATTCAAAGG GGACCGGTGATCGGTGGCTTTACCCATGGGAACCTCGGATTCCGATTCGC CGAATATGTTTTCCTGGGTGTCCAGCGGAGAGGGTGTGATATCCGGAGTC GAGGGCCGGGATGCTGCCGATGCTGCTGCTGCTTTAAACATATTGGGTGA ATTGACCAATCTCTTCAGGGTGCCCCGTTTGGCCGAGCTCAGCTCGATGG CCTTGGGTTTTGGGCCGCTTTGTGAGGCCGATGTGGGAGTCATTGGCAGA ACAATGGTGGCCGCAATGCCGCTGGCACCCAACAAAGTCTGCTGCTTGCG TGCCTCCTGGACCGCCTCCAATTGAGGTAGCAGTTCGCACAGACGGTCGG ACAGGTGGATGCGTCCACGTTTCGTGGCGTATTTCACGGCCAGTTGAAGC AGATCAGTGCAGGCAATCGATTCGATCAATTCCCTAGCTCGCGTCTCGCA CTCGCTGCTGCAGGCCAATGCAAACAGCTTGATGGCCGTCTCCTTTTGCA TCTTCTCTGCCCCATCCATTTGCATCAGACTGGACCGCAGCAGTGCATCC TCCAGCTCGGACTTTTCCACTTCGACGTCGCAGAGCGGGATCTGCATACG CAGTTCCTGGAGCATGGGACGCGGATTGGTCATGGGATAGGAGGTACCGC GGCACAGGACCGCCTGGACTATCTGACGTTTCTCGGATACAGCGACCACA AAGAAGTTGTGCGACACACTGGTGCTTTGCTTCATGGTGTCGCAGATGGG GAACCAGGCGTTGCTGCTCCGGCGATACAACTGCAGCAGACCCATGTTGT CGGCAATACTCGGCGATCCGGTGTCGCTGTACCCAAACCAGGTGAGCTGC CGGCCTGGAGTCAGCGGAACGGGCAGATATTCTTGTCGCAAACTCAATCC ATTTATGTTCACCAACATCGCGGCGAGATGCTGCTGCGTCTGACTGGGCG CGGAACTGTGGTAAACAACCATTAGGCTGTGCTCGTGTCCAGCAATAGCC ACCATTGGTCCTGGTATGGTTAGCACCTCACGCTGTGTACCCATCACGGT GAAGATACGCAGAAAACTGGAGCTGGTGGCCACAGCCACTAGAAATCGCG TGGCCACAACAGCCTCTGCACTCTCGCAATCCGGGAGGCTGAGTGACCAC TCTTTGTTTCCGGCGGCGGCCAGAGCAATGACTACTAACTTGCTGGATTC GTTGGAGGCCAATGCCAAAGCTCCACTGCTCACACTGGCCAAATTGTGCT GATTGTAGTTACTAATGTGTAGAGCGTGGTGAATACTAGCGTCGTGGAAC TCCACATCGATGGAGCTATCGCCTGAGGGCTCCACATGGGCGGTAACAAT GCCCACATCATTCCATGCCATGTAGCGATGCTCTAGATCGGCCGGTGTGG CACTGGGCTGAAAGGCCGTCTGCTGCTTGAAGAGCTTGATTTGCGGGGCA ACGGGTGCAGGTACAGTTCGGCTACTGCTGTCCAGGGATTGGTTGGAGGC GTCATCGTGATCTACGGGATCCGCAAAGTTCATCACCTTGCGCTTAAGCT GTTCCAGACTAACGCCATCGCCGTCGTCTGCTGCAGTGTCCACGTCATCG CCGGCCTCAAACTCATAGTCATCGCCCAACAGCTCGGCTTGGTCGTCCAC CAATCCATCGCCGTTGCCTGTGTCGACTGCATCGCCAAGAAATACGGTTC CCAGCTGGCCAGTGGCATCGCAGAAGGCCACCTCCACCTCTCCGGACAGA TTCCAGGCAAGGCATGTTATGGCATTGCAGTCGCTTGGCGGAATCTCCAC TGTTACTGCCTTCCGTTTCTTTACATCGAAGATGCTCACCTCGCCCTTGG TTGTTCCGGCGGCCAGGCGCTCACCATTGGGCGAGAACTGGCAGCAGCTG TAGTTACTGGACACCGAGTCGTCGCGCAGCTTAAAGGCCACTTCCCAGTT GGCCGTGTTGAGGACCACAATCTCGTTGTCAACGGCATAGGCCAGAAGTT CACCGCTTTGTGGCTCGAAATGCGGAGTGCCATACAGGCTGGCGCTCTCG AAACTGTTGACCTTTGGCAAGCCCCCAATGGTCTTCAGCTCCTTGCCCTC CTCGAAGTTCCACACCTTCAGTTGGCCATCCCCGGCCACGGAAACCAGCA GCTTTCGCTCCGCAAACAAGTCCAGTGCCAGAATGGGACCAGTGTGCCCC TCCAGCACCGTTTCGTTGCCAGCTGTATCTCCCTTAAGCACCTTTATAGT GGTATCCTCGCTGCCGGCAGCAGTATAGCCACCGGATACCTTGAGGCACG TAGCCGGTGCCGTGAATCGCATGAGGATGCCATCGCTGTCCATCTCGGGA AAGGTGTAGGCATGGATCGTATTCCGATCCGTCGAGGCCAGCAAACGGGT TCCCGTGTGGGCTATGCACATGACGAACTCGCCCAGGCAACTTGAGCGTG GATCGTCGTCACTAATGCAGGTCCAGTGCCGGATGTCTCCATCTGTGCCG CACGTGATGATGAACTCGCCGCGCGGAGTGTAAAGGAGTCCCGTGTAGCC ATTGGTGTGGGCATAGCGCAGGGCACTGCGCAAGAAGCTCATGATGTGAT TTAATGCTTAATTTCAATTGATCTCTCGCGATGACCTCCCGTCACTTTTG GCGCCAAAACAAATAGGCACTACCTAACAGTGTAAGCCAACGGCCGAATG GGAATGTCTTGATGTCGCTCTTTTCCAGCACTGGCCAACAGCTGTTCGTT CAATACTCTTTCTTTTTAAATATTAAAAAAAATATATCACCACGTTCCCG TTAATAATTTAAATTCAATAATACGTGAAACATTGTATACATAATTTGTA AATAGTCACACATGACGTTTCAATTGTTTAAACAACATTGGTATTACTTT CATAAATAGAAAAATTTAAGAATCCACAAGATATAAGACATGTAGGGTAT ACATACTTCGACTTTCCATTTTAAAAATGTAATATTTTCATTTTCCCGCA GCCGGTTGCTTATTACAGCACTGCTCTGATCAAAAGTCGGAATATGTTAA GAAAATTAACAAAACTATCGACCTTAAAGGTCAAATGTGAACTCCGCGCC CTATCCTCACTCACCCAAACATCGCAACATATATTTGACCGCAATGCCAA GAGATTACAGAAGGAAAGGGCCGCACTCAGGTGAGATCTTCTCGCCAGGA TTAGAGTATATATTCAATTAGTAAACAATATACGTATACAGCGAAGACGT TGGACTATACGATTACTTGAAGGAGGAGATCGGCTTCCGCCTGGCTGACA GAGTATTCGACATTAAGCGGGAGTTCAAGGCGGCGGCGGATATCGGATGC AGTCGCGGCTATCTGTCCAGACACATTCTGGCGGAGAGTGTGGAGCAGCT GACGCTCACGGACACCAGTGCTACGATGCTGGAGCAGGCACAGGGCACTC CGGGTCTGAAAATGGTGAAACTAGTTAAGGACGAAGAGCAGCTGGATGTG GGTAATTAATCTACTTAGACCAAAGTTGCAAGTCTAAATGAGAATCCCTT TCAGTTTGAGGACAATTCACTGGATCTGGTCATCTCTAGCCTAAGTCTGC ACTGGGTGAATGATCTGCCGGGCTGCTTTGTCAGAATTAAGCAGAGTCTG AAACCGGATGGGGTCTTTATAGCCTCCATGTTTGGTGGAGACACCCTCTA CGAGCTGCGCTCCTCGCTCCAATTGGCCGAGCTGGAGCGCAAAGGTGGCA TATCTCCGCACATCTCGCCCTTCACTCAGATTAGGGATATTGGTTCCCTG CTTAATCGCGCCGGCTTCACCATGCTGACAATAGACACCGATGAACTGGT CATCGGCTATCCCAGCATGTTCGAACTGATGTGGGATCTCAAGGGTATGG CAGAGAACAATGCTGCATTCAATCGACCCGCTCATCTTAGTCGAGAAACG ATGCTCGCGGCCAGTGCCATCTACCAGGAGCTGTATGCAAAGCCCAACGA GAAGGGGATACCTGCAACCTTCCAAATCATCTACTTTGTGGGCTGGAAAC CCGGTCCCAATCAGCCACAGCCTCTGGAAAGAGGAACCGGTGAGGTGTCG CTCAAGGATCTAGGGTCGATTATCGAAAAGGGCGGCAAGCTGGACACCAA AGCGGGAGATTAGCTTAGCTTCAGTTGACAGTTTTATTTGGAGACGTTGT TGAACATAATTTAAATTAAAATATACATAATTCCTTTTGCTGAGAAACTT AAACTAGTGATTCATGTTTGTGTAAAGTTTAATCATGAAATTAATGGTAA ATACTCAATTCATTTGTCAGTTTGCTCGGTTCGTGTACTGCTATGAGGGT ATAACTATACATAAATCTAGCGTAATCGTACGATTCTGTTATCTATAGTT TTCAATTAATATTTGGTTGCCTTTCGCCTTTACATTCGTTTGCATTTCAT GGACGTAACTTTTTAACGTTGCTTTGTATTTTGTTTGGTACGTATATACA AGTACAATTTACAACAATTTCTATAATATATATGCTTGAGTTGAATTCAA TTTGCAATTAAATAGACTTCTAACCGCTTTGTAGTTGTATTAGATACGAT TTGCTCTTGCTTAAATATTGTTCCATTAGCAGTTTTTATGTATTTTATGT AATTCTCGATTGCTTTTATCAATTGTTTAACTCGTAACTGTTGTAAATTT AATTTGGCGCATCTAAGTCACTACCAAGTCGTGCCCCAAGCTTCCCGCGG TGTATGTACAAAGTGTGTGTGTGTGTGGTCTCATTCTCTCGAAGCTTGGT GATTGCTATTGGCTGCACCCATGGAAGGCCTAGCTCTAGTGTTTGCAGCG GTGGCAGGGCTTGAAGACTTAAGGCTAATCAAAGGCAGACGACGGCTAGT ACCAGGAACTAGGTGATCCCGCTCCGGTTGGCCGCCGCCTTTTGCTTTGC TAGTCATCCCAGCGACAGCGGAGATCTCGGCGGCACGGGCGGCGGTGTGG GCGTAGCTCTCGGTGAGGATGTGGGGCTAGCTTCCGTTGCTCCTGCTACT GCTAATCCCGCAGAGGTGGCTGTGGTGAGTGTTTGGCGATTCTCTGCAGC TGCCTGCGCCGCGACGGACGCGGGCGGCAGTTGACGTCAGGTGCCCAGGA GCATCTCGCGCTGCGGAGTGTTCTGCAGCATGTTGGCGGTCCTCAGGTGA ATGCTACAAAGGATGTGGTCGTAGAAGATGAGCCTAACGATGCTTTCAAG GAGTTACAGTCAAAATAATATGGAAATTATAGATCTTATAGATCTGATTG TGACCAAGATTATTTTGACTGTAACCGACTATGGATATATACTCACTTGT TGTCCTCCAGCGACATCGTTTCCGAGGAGCCGTGCGAGGCAACTGAAGTA CCTGCAAGCGAACTTCGTATTGAGTGCGAATCCTCGGGAACGGTAAGCGT AACTAATAAATTGCGTTTATAGGAATTTCGTATTTTTTGTCGATTTGGTT TGACCAATCCCAGTTCGTCGTGTTGCCAATGCGTTGGGAAAAAAATTTGG TTTTTGGAAAATTGCATTTAGTTTTCAATTGTGGCTGTGATTGTGGCAAT GTGAAATTTTTGTTAGCTGTGTTAGTGTTCTTGTGTTTTTTGTACTTGTT TGTGAGGTGCAAATCGAGTCGATTACTTCGTACTAATACTGTTTTCTTAG CCTGAAACATATATTGTAGTACAATAAACTGTATATATTGGGCTAACTGC GAAATCAACCATGCTGGCAAATGTGTTCTTTTCAGTACAAAATCATATTT ATTTGTGTGGTACGTTTCGCTATATGTATAATCATATATAATTATTGGCT AATCAATTAGATTACAGCTACAATTTTGGCTTTAACATAAACTAAAAGTT GAGTTTTGTTTGTAATGCAAATATAAAGTAAATGCAAGAGCAAAGCTTAA GTTACCTAATCAGTTGGTTTATGCTAGTAGGTATTGTGGAATTGTGGGTA AGAAGTTAGGCGGTTAGCAATAAATATTAATCGTTGTACGTAGTTTCAAA CGGAATAGTTGGAGTCTTAGGAGTTATAAGTATTTGGAATATTAAGTTGA GACTCTCGGTTGGATAATATCGGAGAGCGAGGGGAAAAGAAAGAGTGTGG AAGAAACACTAAATACACACATCGATGAATGCTAGCAAATGAATAACAAT TTCAGGTTTCTGTCGGTTCGACAATACAAAAATTAAAGCTAAGTACATGT GGATATTACTACCGAATGTTTAAGGGGATTTTTGAGGGGGGGGGGGGGGT AAGGAATTCGTTATTGGCATATGCGTTTTACAAACCAAGTGGGCAAAACA AACATTAACTACATAAAGAAAGAATACGAAATACGAATCAACTAAGATTA AAGGCGTGTGTTCTCCACGCTCAGCGCATCATCGTCATCATCATCCGCAG CATCCCGATGCCCGTCCATATACCTGCCGCCTCCGCCTCCATTTTGCACG ATATACACCACCTGGCTGCTGGGAGTCTTCGGATGGAGGGGCAGCTGCTG TCGCTGGAGCACTTCCAGTGCCTGATCCAGATCGATGCGATTGCGACTGT CGCTATCGCTGCTAAAGCTGTGCCGCATATGCTGCAGCCCGTTGGGCGGC AGAGCTGGATGCGTCTGCAGGTAGCTGAGATTGTGGATACTCTGGCTGCG GGCGGGATCTTGTTCACTATCGATAGTGGTCACCACAAATCCATTGCTGT ACAGCGAGTAGCTGCTATTCGCCGGCGAGGTGGCTAAGCTAGTGATACTC TCAAACGTTTTCATTGAGTATCCATCACCTAGGAACAGAATTACAGAAGC GATTGCAAATTAGGTCAGATCTGATTTCGAGTTTTCTTTTTTTTTTTTTT TTTTTGCAGCTCCGATTGCCGGCAAGACGCAGAAGCGGTGGCTTGTGATC GAAACGGATATATATGTACACGCAGCGGACAATGTTAGACAATGGTTACA AAATGGATCATCCGATAACATGAACGTCGAGGGGCGTATTTAATAAGCAT GAACTGGTTTTTGTGGCTGCCTTGGTTATTTGGCCCTTAAATGCTAATAA TTTACATATACAGTTAGAATTAGTGCCCATTAGATCCGCTACGTCTAAAA CTTGGTACTCCATCCAGAACCACTTAAACTCGTCCCACTGTTTCGAGCCA TCCATCAAATTACACAAATAGGAATAGGAATTCCCTTCTTAGTTCCCTCC AACGTGCAAAAGGTCAATATTAGCATATTATTCAATTAGTTTAATGCTTC GGCCAGCGAGATGGTGACGCATTTGGGTTGGACTGCCAACGATGACTCGC TGAAAGTGGCTACGATCTTAACGTATACTCAAAAGGAAAACTATACATCG CTACTCAAATCAAACATAATACATATGCCATATATCATAGTCTAGAACTA AACAGGACTTTGTACATAGGATTAAGTCTAGGGCAACACCAATTCAAGTT CGATTTGAGGAACTGCTCGTGTTTCGGTTTACATATACATACATACATGA TATATATACATACAATTTGTGATAAACTTGCACCACACAATACAAAATAA GAAATAAATTTTCAATTATTATTGCAGATTATAGTTACAGTCAGCAAGTG GGGTAAGTGGATTGTTTAAAGCAAGCATTAGGATTAGTAGATAAACAGTG TAAGGACTTGTGTGTGACGCATGACTCACCCGTTGCGCACTCCGAAGTCT CGTAGGACACTGTGGACTGAACGTCGATCGCGTTTTGTTCTTGTCTAATA AAGTTAAAAAATTATTATAAATATGTTAACGTTAACAACGCCAAGAGATC CCACCTTGATATCACATCTGTTATGACTTGCTTCTCCGCGTCTGTATAAT CATTGCGTCTGCGCCCGATCTTCTTCTCCATATCCGCCTCCACGAAGTCA CCTAGTTTGCGGGTGGGGAACTCGTTTGACTTGGCTGGCGGCGGCACATC CAACTTGAGGTCCTTCAGCTTCTTCATCACGCGTTCCAGAGCCTGAATGG CATCATCGTCGCTGTAGCCAAAGTTCTTGTGCAGCCGTACTTGCAAGTAC TCAATGATGGCGTCCATGTCCTTCAGGCGCAATAGTTCGTCTTTGTGAAG GTACAGAATGGTGATGGCCATGGACAGTATGACGCGATCGCCGTCTAACA TGAATATATCCCACACGCGCAGACTCAAACTAAAAGGAACCTGCAAAAAA CAGATCTATTAAGTATTTTTGTAATAAATACACCTTGTGGTTTACATACG CGTTCCACGAAGACGACAAAGAACCACTTAATAGCGTACAGCAGGGCGTC AACGTTGTGTTTGGTAAAGTGCTTGTGTAGTTTTCGCATTATTTTCGACA TGATGCGGTCGTGGTGATCGATGAATCGCGTCAGCTTCGGGAATCCCTCG ATAAACAGCCCGTGCATGCCGTATTTTTGGTCTGTTATCAGGGTATTTAA TGCCCAAAAAGCCTCCTCCTCGTGCAAATAAAGCAACAGCACGCCAGCCA CACAGGCCATGCCCTGGCAGTAGCCCAGCTCCGAGTTGTAGATGCTATAG GCGTTGAGCACATTGAATAGCGAGCACTGCTTTACGCTGTAGCGCTCGCG AAAGGCAAGATTGTCGCGAAACTGACGATTCACATCGGCATCGATTTGTC GCGTCTCCGTGGAGTACTTCCTGGCCAGCTGCAGCATTCGGAGGTAGACG CCAGCATTGTTGTTTATCGATTGCTGGATGTCGAGCAGCTTATTCCAGGC CACCATACGCACGCGATCCGGTATGCCCTTGTAGACGCGCTTGTGCAGCT TATCCTGGGGCGGCGGCCACTGATTTAGCATCTTCATCCACTTTTTGTCC CGCTCCATTTCAATCTTGTTGCGATGCACCTCCTGGGCATCACGCGTCGA CGGCAGCCGCGAGTCGTGCAAGAAGCCATATCTGTGGGAGCATCAATGGC ATTATTGGGATTTTTTCTGGCGAATGATTAATATTACTCACTTGTCTGTC CTGTGGTAGATCTCGAAGGTGGGATTCTCCCAGGAGTCCACCACATTGCT GGGATCCAGCCCGAGTTCGTAGCGCCGGAAGATGTCCTCGCGCTCGTCCT CGGCCCGCTTGACCAGCGCCTCCTGCTGTTCGCCGTCAGTCATTTGGAGC AGGATCAGGATTTGGCGGGTGGGGGAGGGGATCGGGGACAGGAGCAGGAG CCGGATCCGGAGGAGCAAGTGGCCAGAGCTGGTTTCTCTGTGCTCTCAGT TGGGGAGCGGCTGCTTCTGAGCTGACTGGGCGATAGCGCGAAACTTTGAT AAAAAAAAAATGGAATGGAAAAAATAACACACAAAAGCATTAACATGCGA AAGCGATCCACAATAACAACACTCGTATACTATATAGCTGATGAGCGAAT GACGCACACGAACATTAACTATTGTATATATATATATATATATTCAAATG CAGTGAAATCAACATGATCTTTGTTTTTGGAGAAGGAGCGTGGCATAAAT GACGTGATGTTTCACCCATATTTAGTGCAGCATCAAAACATAAAGCCATA TAAGACTTGGTCACTGATCTAGAAAAACGCCCCCTGATCTGCGTTGTGTG AGTGTGAGTGGGCCAGAAATGTGTGGATCTGCATGCGCCCCCGGGTTTTT GTCGCCTATTTTAATGCGAAATGTGCAATCTTATGCTTTATCGTTCGTAC ACTTCCTGTTTTCGCTGCGATTTGTTGTATTTTGTCAACACAGACACATA CGCACACACGTAACACACACACACACAGACGCTCCGACGAAAGAGAGTGT TCTGGCTTTCACTGGCCACTCTCTCCGCGTTCCTATGGTTGAGTTTAATT AATCGCGCCGACGTTCGTTTACCATTTAATTTTGAATTGCCAATTCTTAT TATCCGCACTGATCGGTTATGTTTGGTAACTAGTTTTTCACTATTTTATC TCGGCTGCATGTTTCCGATACATTTGGGGGGCGACTGAGTGTGTGTGAGG GCCAGAGTTGCCAGACTGATGTAATTGCCGAATAACGTAACGTAACAAGA GTACCAGGGATGCGAGCCAATATTTAAGCGATACTTTAGCGTAATGTTAT ACGAGTTTAAATTTTAGTTGAAATGTTTGTGATGTCAATGTACAAATATG TAAAATGTTTATCTATTTAAAGCTGCAAATGAATGCTCATTTATAAATAT TTAACAATGATATTTATTTACTTATTATTTAAAACCTATTCAGTTACTTA ATTGCGACAAGTGGCACTTAATGAATTAAAACATTTGTGGAAAACATTTT CACTTCAAAATTTATTTCTTGATAACAAAATCGGCTTTTTAATTCAAATA TAATTTTTGTGACTAAATAAGCAGTGCTGCCATACATTCAACTGGAAAAC ATCGTCAGCAACAGAAGGATAAGTAATCGCTTGATCGATAGCGTTATCGA TGTTTTCCCAGCCATCGTTCCACCACTAGCGCCTCTCAAAACAACAAAAA AACAGCGGCAGTCGGACGCGGTTTTTATCATCGAGCGCGGTTTCTTTGTT TTAGCGCTCGAAAATTGTCGAGAACTCTCGTAAAAAATACACTGTACCAA ATAACTAAGGAGTGCATGCTAATTGAACAAGCAAATGAATTAAGGTGTAT ATCAAAGTGAAAAGAAGTCAAACATAACCGATTTTGTTGGCGGCTTTCTT TTATTTTTGTTGAGATACCGTGTTTAATTTCTCCAGTTTTATGCAAACAC ATGAATAACATAACAGTGGAAATTTCTAAGAGTGCATTGTGAGATAAAAG TAAGCAAATAATTAATATTATGTTTAACATAAAATGCAACCCTCAACAGC GTCCTTTTTAAAGGTGTGCGTTTATATATATATATATATATATATATATA TATATATATGTGTGTTTGTGTGTGCGTGTGAGTGATTGTGGATTTTGTGA TGCAAAAGAAAATTGCCGCGTGTAAATTTTTGATTTTCAATTCGAGACGA GCAGAGGATTTTTAAACTGCAGCTCTAGCATTTACCGTTAGGGCAAGAGT AAACACATTCAACATGTTGCAGTCACTAAAAACTAAAACAAAAGCAAAGC GGATCACTCTCTTTCTCATTCTCTCATTCGCTCTCTTTGAGTTATAAGTG TTTTTGCCGTGTTTTGTTTTGATTTTTGCACATACACGAAGACATCGAGA GAGGAGAGCGGAGAGTTTCTGCTCTTTTGATTGTTGTTGCATTGGCCAGC TAATAAAATTGTGCCGTTCTTGTTGTTGTTGCAGTTGGATTAAAATTCAA AGCATTGGATAAATGCTAAGTTGAAATAACAACAGTAATAACAAATGGAA AATAGCAAATAGCAAATCAAAGGAAATCAAAATCAAGTTGGATTATCAGC ACAGCTTCTGGGTAAGTAAGTTAAGTCTCTTATCGCCTAATTAGTTTATA GCGTTTTAGTTTCGTGTGGGTGGCTTTTTGCATTTCAAAACCAGTTCTAT TTCGGGTTTTCATATGCCTTTTTTTCTCTTCTCATGTTGATAAGACCTTG AAGCGCTTTTCGTGTAGAACTTCGCATGATTGATGTTTTTATGTTTGAGG GGAGCTTGAGTCAAAGCTCGGCTTTTAAAAATGGATCAAGACCAGTTTTT CGAGGCTTTGGAATTGCCAAATAATTTCCTAAGCCCAAACTGCAGTTTGT TGTGGTTGTTGCTATTGCTTTTGCTTGCATCGCCTAGAAAATGATGGATG CACACACCTCTCGCTCTACCCTTGCCGTCCCTTTCGCACATCCAGAAGTT GTCGGTTGAGTTTTTATGGCCGTCTCTTTTGTCTCTCCATTTATTTGCCT TTGTCTTTGGACTGATGACTTTGTTTTTGCCCTGTCTTTGATTCTTTCTT TCTCTCTCTCTGCTTCTTCTTCAACGTTGATCCTTTGATTTCGTTTGATC CTTGTAGGTAGAAAAGATTGAGTGTGGGAGAGATCTACCGTTGTTTCGTT ACTTCAATCTATAAGATACTAGAATTTTCTTTTTTAAAACCAATTCGAGA AATATTTCAATATATATTTTTGGGGAAAGAAGAATTTTAATTCTTTCGAA TATTAAAGAGTTTTTTAAGATTGATTTATAAATTTCTTTTGGATCTTATT ATTTGTATTTTGTATACGAAACATTCCATCTTATATTATTATCGTTAGTT TTTTGTAACTCCAAAAATCAAAATAAATATTCAAATAAAGAATTCTGTAT TGCCTTTTGTTTTAATGCCATTATGCAATATATGCATTTATTGCTTAAAT ATTTTTAAAATTATTAACAGCATTCAGCTTATGTCTTTTGAACATTCTCC TTACCAATATCAGATGCATTCCAACCGAAATGCGACGAAGGGCATGCATT TAAACACAATACCTGGCATACTCGACATTTTAAATGCTTTTCATCACTTG ATAAACAGTATTATTTGCCTTTCCTTTTTTTTTTTTTACATACATGTATC TCCCTCTGTTCGCCGCCGTTTGTTTTGCCCCCGTCTTCGCATATGTACGT CTTCGAGTGGTCTAACATGTAATGTATGCCTCGTCTTTAGTTTCTTGTTC GTTTCGTCTTTGAGACACCGGAAGTTGTTGCTAGGCTGAAAAAGTTGTGT GTGTTTTTCAGCAGTGTCTCCAGCTGTATCTTTATCTCCCTCTGGAGCCG TATATCCATCTCTATCGACGAGCAAGTGGCGCGTGTGAATGACCCAATTA AGCTGAAGATAACCCGGCCTAAGCTTCGACTTCGTAGGTGGCTTAAAACA ACTCGGTTGGCCAAGAAGAAGCAGCCCCAGAACCTGCCAGACGAACATAC CTACTATGGCACAACAAAAAAGAGTTCACATCGAATATATCGAATGCGAA GTTTGAACTGTAAACAGGTTTACTTGGCCTCACCTCGCTTCGTCTGCTGC AGTTGGCTGCTACAGGTTTGCCTCCGTATCGCGAACTGCGCGCCATGGAA TTTCCTGTATTCATTCATTTTTGAATCCATATAACATAAGCCTTATTTCA CTTAAGTTAAAAAACTACAATAAGAAGAAAATAAATGCATACCATTTCAA TCTTAAAATTCTTGAAATAAAAAAAATTTCATTCCGGGTGTGAATTTGTG GATTTGATTAAATAAAAAATAACTGTAGTATATATATGTTGATGTTGAAA TTTTTAAAAGCTCCTCCATTACTTTCTCCATTTAAGAAACAGGGTAATGT TTTTCTAAGGTCAGCTTATGCAAAGAATAACATATGCAGTAATCCCAGTT TAAGTTATCAACATTTCACTGTACATGGTTTAGTGTGGTGCTTTATTTTG TCAGGCCAAACTCCTTTTCAACATTTTTGTATTAAATATTTCGCACCATG TTCTGCATTTATTCGGATACGAGAGATCTCCCGAGGCTCCAGTCTTCAAC TCCATCTCCTTCTGTGCGTCTGCCATCTCTGTTCGACGCTCTAATGCCGT CCTTTTCTGTGGCATATTTTGTCGTTGAGTCAGTTGGGGTCAATGCTGCT GCTCAACTTAACTCTTTGCTCACTCAACTCACTTTGCTCGATGGCCAAAA CAGGTTTCCGCTTTGGCTGAGCTTTTGTTGTACGCTTGTTTTTTCGGGTT TTTCTCCTGTGCAGCAGCGCGGCCTCACCCACAGTTTGCTGTTTTATTTT TCGTTTCGTGTGCTTGGGCTTTGGGCCCAATACCCAATATATCTGGAATC CCAACCCTCGAGTGAAACATCCCTGCTGCCGCAAAACAGCCCTCAAAAGC GGGCAATCGCAACCTGAGACACTGGGAATGCGAGTGCAGATGGAACTTGG GAATCGTATTTTGGGGAGGGGTGTTGACGATGGGACTCTTTCGGATGGCG CTGCAGCTGGAGCTGTGTCTGTGGCTGGATAGTCCGGGCTATCCCGAAAG TGGATGCCCCATTCCAGGTGTTCGGTCGCTGCATTGTAGCAGGCGCTCAG CTGCATTCACCGCACGATTGTGTGCAGTGGCCGCATGTTGCAAGTTGTTG CACCAGCAACACTCAAGCGAATCTTTCGCGAAAGCCCGAGACGCAGGCAC AGACGATGGCGACGGCGACTGGCATTTCTGCACCGGTTTTCCAGCCATTT TCCCCCATTCGCATTGGCCGCCTATGCTTTCTTCCTTATCGCCTGTTTCG CTGCTGCCACAACTTGCTGCTGTTGCCGCTGTACATGTTGCCGCTGTTGC TGCCACTGCATCTCTGGCTGCTGCTGCGCTGCTGTAAATGTTGCCGCGAA TGTTGCTGCCGCGGCAACATTCGTGGTGCCAGCTGCACTTGCTACTTCGA CCAAAGTTGCGGATATCAATTTACTTAAGCATTTGTGGCTCCTGGTACTG AAAGTTTTATTTGAAATTGATAGCCGGGAAATATATATGCGCATTTCTTC AAATCGCAGTATTCATTTCGTATAAGGTTAGGATTTGTTTCTTGTTTTTC TACGTTCGTAACCATGTAATATAATTAATAATATTTACAAGCACGTCGAT ATCAATTGAAACGATACCATAAAATAAAAGGATTACTTTACAAAAGAAAA CCTATTAATAAAACCTATTCAACTCAAGTTAAAACTGTAAGATCACACAC GTTCTTGTGTATAAAGTAATCTTGAGAGGTTTTTGAACATGAGGCATCGC ACCCATTTTGGAACCAATCGCATACAGTGCGATCAAGCAGACTCCAGTGG CTTGTGGACCGGGTGTGTTTGCTTTTGCCTTAATCAGCAGAAAATCATAT GCGAAATGTACGATACAGATGTGCCCATATACACATCTAGCTATAGCACT CTTTATGTAGAGCCCCTCTAGCTCTAGAGTCTAGACTCTAAAGTCTAGAC CACATAAACGCGTATCGATGGCGACGAAATGTGTACATCGCACATGAACG AACGGGGCGAGTGAGTATGTACAGTTTAAGAGAGCGAGGCAATATGAAAT ATAAACAAATAATTAACTGACATATCCGTATGCTTATCGCGCAACAAACC GCAGCAGCAGCAGCAGCAGCAACAACAGGGGCAACAGCAACGGCAGAAGC ACAGATACAGATACATCAGATACAGATACGGACACGGATTCAGATACAGG CACACTTTCGGGGCGAGAGCGACTCTGAAATTTGTTTCTGACAAAATGCC ATAATGAACGTGCTGAGTGGCGTCGCGGAACCAGATACTCATGACCAGAT ACTCGTACGTCCACGTCCGAAAAACCCGAGAGATACTCTCGTACTCGTAC TCGTACTCGTATTTGTACTTGCTCGTCGTTTTCCGTTGTACTTGCGTCGC GGCAGCGGCAACAACATGAACAGAATGTATCTACAACATCAAACGTGCGT TGCCTTTTGTCGTAGTATAAATTCATTTAAGATTCTTTGCTTTTTTCGGG TTAATATAAATCAGTTTTTCAGTTCGGGTGCCGAGTGAAGAATCGAAAAT CTACCGGCACGCTTACGCATCTGCCAGATACTCTTCTCTGTTCAGCTCTG TGCTCTGCTTAAGATACTTTCCGGTCCGTTAGTTAGGCAATCTTCCGCAT CAGTCAGAAAAAAAAGTACAAAAAATTCGTATAGAAAGGGGTGGCTGTGG GTGGTGGTTTTCATTTGTGCTAGGCGGCTAATCGAAAAGTCGTCAATCTC ATTACATTCATTTGTTTGCCTTTTTAGTTGGCCCTCACATGCTAATTGGT TAAACTGCTGTTTTGGCCGGCCCTGTTTGTTGTTGTCGCCTTAGCTGGCC AAGCTGAATGCATTTTTAATTAGCTCCCAGCCAAAGCAAAAACCGTCGAA ATCAAACCAAAGCAGTTGGCTTTTAACCTGTTAACTTGGTTCGCAGCTTT TTCTACTCCTGATGCTTTTGTTGGTTCAATATGACGCGTGGGAATTAGTT TAGTTCACTGTTTCTGTTTTAATACTCTACTAAATCTTATTAAATTAATA CAGTTTGTCAACTTAACATCTAATTAAAGTTGATTTAAAATCGTTAATTT TCCTTAACTTTCAGTGTCTTAATTGAAATTCATAATGAAGGTTAAAGATT GTTAAGCTTACATTTGAGCGATTTTATTGTGAGAGCAATCACAAGTCGCC CATAACAGTTGCCTTTCTTTGTTTTACAAAAAATCAGAGGCAGTGATTAT GGGATTTTTATATAAAATTTATTTAAATTTTTTTTGTGTCTAAACATATT CTCTTTGCTCGCATCGCCTCGACATCGAATTTCCTGCACATATGGACCGC ATAAACACGTATGAAGATATACATATATGTGCACACCGATTGTCTGTATA GTATATAAATAAACATTTTTATAGATTTCGAATTGGCTTTGGCAAATAAA CTGGTTTAAAACATCTGGCAACAATTGTAGATCCATAAAATGCCGAGATA CTTTCGATTGTGACGATGGGAGCGGTGGAAACGCCGAGTGAATGCACGAA GAATAGAGTGAATTTTGAGATTCCTTATTAAATGCACTCATTAAGTTCAC TTGGCATGGCTATAATTACAATACCCTCCTAAATCCGGCATATTGGCCTC TTCAAACGCCTCGGGTTTGTGTTAGTTAGGTCTCCCTGTCGCTGAATTAG ACTTTCACTTTTTGTTTCGTGCTTTTGTTTCAAAGAAACAATTTTGTGTT GCCTTCTTATTGTTTGTTGTTTGTGCTGCGCCGCTTCTCTGATATCGAAA TTACGTAAAGATGAATGGCCGCCCATTGTCTGGCCCACGGAATTTTGAGC GCGGGTGGGAGAGGTCGTTGATCGGGCAAGATATCGGCGGGGATAACTGG GGTATCTGACGATTCGGCGATTCGGAGATCTGTCGCAACACACAAACTGG TAGTCATCTTGTTGAATATGCAATGCGAGCATTTCAGGTAATGAGATCCG TTTTCGATTCATCTGGGGCCATTTGGAATCAAGACCCACCGTTTTTGGTG TCGGTACGATCCGCTTCGGGAGAACGTAACCGATAAGGGAATATATTCTA TATGCGCTTGTATAAACAATCCAGTACTGAAATCTATTTATGTAGTGGCA CACTTATACAGCGATTGTCTATAAGTACCAATTTATGGGTACATACGATT CGGGGGAGACTTTGTAAAATGGCTCGGCATTTGTAAATATTCACTGTGCC GTGATATCACCAAAATGTATCTCATGCTATGGGGCATCTTAATGCATGGT TTAAAGATTCAAGTTTTAATAAATGAATGGAGAAAGCCAAAAACATGTAA ACTGCTTTCAATTACAACTTAACAGTAGCGAATGTAAATTTAATTGAAAT CAATAATCATAATGGTAGAATAAGTACCCAAGCACTTGAAACAAGTTACT TCAGTAATCAAATAACAGTATCTATTTAATATCCTTTACATGACTGAAAA TCGACGTTAGTCATGCAAAGCGATATTTGTCTAAGCAGGAAAATCACTTT CCTCACGTGTAATTTATGTGCATTTGTGTATAAGGAGCTAACTGGGATTC TTGGAGAACAAAAGCAAAGTTCAGAATTGCCTGCCGAATGTCACATTCGA TTAATGTTTGATGATTGCCTTCCGATAGCGTTTCAATTGATGTCAGTTGT CAACATAATTAATTGCGTGTACACCTTTGCAAACACACGCACATATGGCT TGAAATTGAGGTGAGAAAGAGACTGGATTGACAGTGGCAAACTGCAAAGG AAATATGAACACTGAGAGAAAAACTAGAGTAATAATAGTAATACGAAGTG TTTCTTATCGAAATCTGTTAGATCCAATTCTAAACAACAAATCCAAGTTG CTTCAGCTAATTTAACGTGGTTAAACGCAAAAATTAAACACTTTTTGGTA TAAATCTATCGAGGTAGTGCACATTGATTTCTCTCTGTGCATTGATCTCT GCTACCCCTTACGGTTTCTCGGGCTAACTAAACTCGGTTTCGAATCAATC AAGGCTAAAACCTGGCCACACACACACATCAACGTCCGCAGAGCCATCGT TTCGGATTTCATAGGAAAATGCTTTTGGGTGGGAAACGCAACGGCAACAA TAATATCATGAAGATGGAAGAAGGGGATAAGAAAAGACCGTAACGAAAAT GGAAGTCAATTTATTAACTAAAAAAAGAAGTCATGGAAAACTGGACAACC AAAAGAGTCAGCCTTTGTGTTGGTGTGTGTTTATGGAAAGGGTGTGCGTG TGTCGGCAATTTTTTGTTCTTCTCTGCCGTTCGTGTTGTCAACGTTAATT AATCAATCATTGTACGAAATCTTGACTAACACATTAATCATTTAAAATCA CAAACTTTAAATTGCGATGCGGGGAAAACAGAAGGTTTTGGAGAAACACT CAGCTTTTGCGAAAATCAAATTGCCTGGAAAAAGGGTGAAAAAGGTGGGG AATATGTTGAATATGAAATTTCTAGACGGAAAGAGCCCTATCTCTGTTTG ACTTGTTTTTGTTTGGTATTCTTTACTTGATTTCATACCCGTCACACGAA CATTACGTAGGGTATATTGGTTTTGCGTAAGAGAGAAAGATGTCATGATT GATCATTAAAATCAATCAGATTAATGCTCGCTAATAAAATGTAATCAGCA ATTATCAAAGTGAAGAAAGTTTAAGCCAAGCTCTCGAAATCAAGTCCTTA AAAATTTAGTGGTATTAAAATGTGCTACTCTTCAGTTTCTAAATGGCTTT TGTAAAAAATAACTAATGCACTTTTTTACACTCTTGCCACATTAAGTTTT CAGTGACAGAAGAAAGCTGATTCTAAATTGTCAGTAACGAGCGGGTATCA CTTTGGTCTAGGCTACGACAGAAGCGTTCATTCTTGTTTTTTATTATTAT TATTATTACGTTTTTTTTTTGCCACTCAACACGTTTTCTGGTTCTTTCTT TGGGTGTATGGGTGTGTGCTTGAGCATGCGGCCGCACTTGTGCCACGTAC AACAAAAACAACAATCATGCCAGCGAGGAAAGTTCATTTGAATGCTTTTC TTTTATGCCCCGCGAGATACACAAAATAATCGCACAGCAACTCTTTTTTT TTTCGTGCCACTTGAGTATATTCTTTAAAATTGTTTTCCAACAGTTCCCC AGCCAAAAAAAGTAAAAATATTCGAAAGGATTAATGGGGAAAATAACTCC TTGATCTGCCAGCAAGATTTCCACTTGTTTTTAATTGGGCCTTTTTAATG GGAAACCTGCAGCCACTTGATTCATTACATATTTATGGCCGGATTTTTTA TACCCTTGTGCATTTGCATTTCCAAGCAAACGAATTCAGCTAAAAGATTG GCATAGGAAATTTCCATTTTCAAGATTGTCAATTTATGTGACAGTTAGAG AGGTGCGAACAGGTCTTAAGCAACAATGATCGAAATGTCAACACACTTTT CTCAGTTATTATGGAAAGTTTTCTTATCGTTATTTGTGCGTACTTTGGAG GCGTATAAAAATTACAATAAAATTCGTGTGAAGCGCGTGAAATATACTAT TCCTTACTTTATTGAGTCGTTTGAATGATGTTCAGACATTGGTAAAGATA ACTAATTTGTTGTTATGACCTTAATTATCTAGCCAGATATGATTTTATGT GTTTGCTTAGCCTAAAATTGAGTTTGTGATTTTAAGTTTCTTATAAAAAA AAATGGCTAATTCACCTATGAAAAGTACTAATATACTACAATGTTTGGAT TAATTTTTATTTTTTAGATTTTGTTGCAAATTTGTTAGTTCTAGAGAACT TAAGCATAATAATTAATAATAAATAACATTTAATTTGGTTCGGTATTGAG CTTTCTATTTTATTTGCATCCATTAAGAATTTAGCATAAAAGTATCTGCA CGATAAAGTATCTGCTAGATACGGCACTCACATAGTAGATATATTCGCAT CACTCGTGGGGTTTTTGGATGGTCAGGGACTTACGTAGGTTTTTTAGGGC GCATAGTGCTGATGGAGGGGGTGGCTGATGCTGCTGCTGCTGTTGTTGCT GCTGCCTTTTGTCGACGACTGCCGTCCGAGCGGCCTGCATGTGTCACACT GTACAGCGTACATCGCTCTCTTTGTTGCATGGGTATTGGTAGTGCAACGA CCTGTGACAAAAAGCCAACAACAACTTAGGCAGCGGCAGCGCAGGAACAT CAGCAGCAGCAACAACAACAACAACAACAGCGGCAGCAACAACAACAACA GAAGCAACGACAACAACAGTCCACAGGAACAACAGCAACAACAACAATAA CAACGTGTGACGCAGGGATGTTGTTACGTGCAGAGAGAACAAAAGAGAGT GCGAGAAAGAGCGAGAGAGACGTCGTGTTTTTGGGTACAGCTGTTAACGA AACTCCCACGCTGCCGCCTCTGTTGCTGCGCTGCTACTGCGCTGCCGGCG TCGCTGTTTTGTTGGACATTTTTGTGCGGCTTCCTTCGATTTTTGTTGCT GTCATCGGTTTTTTAAAAAATGGGGTCGAACTTCTTTTAGCTAAAAACGA ACAGTTTGGCACCCCAAGGATCACCGTTTTCTAAACTGAATTGAATTATT ATAAGTCGCTAAATAAACGACATTTTGGATTCTAGGTTATGCTTAAAAAA TGAAATAAGTAAAAATTAATGCAAATAATAAAGTTGCTCGGTATCAATAC CTATGTAATTGGTATTACCATAAAGCATTTCGGTCTTTATGCATAACGCA AACCTATAATCTTGAAAAGAAAGTGTAATTACTTATTATTCACAAATACT TCGTCATGTATCTGATTTTAGAAGATATCTTATCTTTTTTAAATACTTAA ATATTTTAACATATTTACATCTTACACTACAAAACTAAATGTCTAAGTCA TATATTTTATAGATTATATTTTGGATAGATATTTAAATTATGGCACATAT ATGTAATTTTTCAAACTTTGGCTTAGACCGTTTTTCTTCAACAAGTTTTA CTGTATTTCTGTGCATCTTCTCTTGCCTTAGCTGCGTTTAATTTGTTTGC GCTTACAAGCCTGTGGCGTTTTTGGTTGCATCTACTAAGTAACTGAGGAA AATGGAGAAAAAAAAATACTAGAAAAATGGGAGAGAAATGTTTTCCCTGA AATTGCTTTTGTTGTGTACACAAGACCAAGGGAAAACAGGTTGCCAAGAA GACAGAGATGGAAAATGCAGAGCGGGAGGGCGATATGAAGCTGCATGGTG ATGGACTGAACTTCATTAATTAGCCTCATGAAATGCGCCTGCTAAACACG CCTTAATTACTGGGTCAAACATTGTATCTGTGTGTTTGCATCTTGTATCT CAGCGGTTGTGAGTGTGTGCGCGTGTGTTTGTATGTTTGTGTGCATTTCC GGGCACTCGAACATCTCGTTTAGTTCCAATTTGTTCAAATATAAACGCCA CTCGCAGCATGAATTAATTAACGTTAATCAATTTTCGCGCCCGTAAAACA AAATAAATAGAAAACTAGAAAATGTTTTGTGGGCACAAGACTGTCTGAAT GGCATTTAGTACATGTTAGATGTTCTATAAGCTTACAAGTGTGATAACAA AATCAGGATAATACGAAGTTATTATCTAAAAAGGGAATGCAATGGTAAAA TGTTAATTATATGCATTTCTTATGTTAAAGCTTCTACTTAGCATGCAAAT ATTTAACAGTCGTTATTTTTAATGCTATTTATGAAAAGTTTTCAAGTTAT TTCACCAGTTAAATGTTATAATTTTATTTGTTTTCCGCTCATCGCTTAGC GACAATTTCATGGCTTTCAGCCATCGTCACGTGTAGCTCATAAATATTTA AGCGCAATATAAGAGGGGATTTGGGGAAAGGCGAAAGGGGGGGGGGCATG GGTAAAGCAGAGACCGGACCCCGTTTAATTTTTTATTTGTTTTTTTTTTA TAGTTTTCCGCGCGCTGTTTGTTAATTTAGCAAAAAGCATTGCGAAACGA CAGACAATTTAAGACTTCATTAACAGGCCAGGCGAATGAGGGGTTAATTC TGGGGCACAAAACGAAGGGACGAGTGTGATAGGGATGGAACCGGAAGAGC AATTGTGGGTTCCACTTCCAGGATACATACGAGCGACGGGCTTCTCTTCT TTCTGCCTCGTTCCGCACTGAGTCCCACCTGCCCAGGTACATTTACATTT AAGTACCAACACGCATATGTATGTTTGCCAAAGTCCTTACGATATCCTAT GCCATATCCTTGCGAAAAACCGGAATTCTACTGTGAACGCTACTCAAGAT ATTTTGATTATAACTGATCAAAGTAAAAGCATTTCCTTTTATTTATTGTA CAAAATTGTCAATGCAAATGCTTCAAGGGCTGAAACGATTTATATATATG TATATATATTTTTATTTACTTTAACCCCATGAGCGTATTGAATAATTTGG AATCGTTCGAAAAGTGGTACGCTCATCGGCAATCGTGTTGCATGAAAACA GAAATAGAAAATTAATTAAAGTTGGCAGGCAGTCAGGCATTTTTATTCAT TGTCCTATTCATTTAATGGGGTTTCCTCTCCGACCGTGGAAAGTCACCCC TGTGAGCAAGAAGATTCGAGCGGCAGAATGCAGAAGCGCCTCAGCGAGTG GTTGGCCGTTAAATTGTTGTACAACATGGGTTAAATGGATGCAGGCAGCT GTGCAGAGACGGGTTCCAAAAAGTCGAGAAGAGTGCGATCTCTATATGAG ACATAGTAGCTGGGCAAACAAAAATTCAAGGCACTAACCATAGAGTACTA TTGGAAGTTTGTGCTATAAGCAATTTTAGAAATATATTCGCAGTGTCCAA ATGTTCCCATTTGATAACAACATAATTATGAACTTAATGAACCCATGATA ACCCTTATCTTATTATATTTTAAAGTCATCCCATGACTTCCGCAAATATT GGGAATTTTTCTTGTTCAAACAAATCCTAATCATAATAAACTCTTTGGGT ATTCGATTTTGCGGCACTGCTTATTTTTATGATCCAAAACTCTTATCTCT TAAAAATTAGAAGACCGTCAATGTTTAAAACAATGCTCAGTACGTTCGGC AATTGCGGAAACACTGATATAAACTAATTGTTTAATTGTTTTTGCTAATT TTAATGTGGAGAGTAGAATGACTTTTTATTTGATTTATTAGGAAGAAATA TTGTTTCATTATTTAATTTCCAAAAAAACCCACAACAAAAAGCAACTCAT ATAAAAATAAAAAATTCGTCACATAAAAAAAATTTTATAAGAAGTCTCGT TTTAAACAATTACGATGTTTTGGATAAATTGTAAGATTTCCTTATGCGCA ATGTTTTTAAACCAATATTTATATTCGGCGCAATTTTATAAAGACTTTCT TTTTTGTGCTATTTTTTTAACAAATACATATATATTTATATTGTGAGTGT GTGTGGATTTCCTAGCGATTTATTAAAATTGAATTTTCCATGCTAATCCA TTTTTATTTTGTTTGATAAGGCAGAATAGAAAATAGAAAATCATGAAAAC CCTTTTTTTAGAGATCAACAGCACAATTACATTCCGTTTAATTTCTTACA TACTGTTAAATCAATAAATCAACAAATATGTAATAAGTCGCACCAATTTT TAGAGCGGTAGCTTTTTTCCTTTACACTGATTTTGTCTCCTCTCATCTCT CACTCTCATTTTGGGTCCCTGCTCTGAACTACTCCAAAAAAAAAAACAAC AACATAGGCAGCGGCCGAGCCTGACTTCTTTCTGTGTTCGAAACTTTGCT AGAAGAAGACTGTGAGATTTGTTTTTGTTTTTGTTTTTTTTTTTTCGAAC ACTAGCGAGGAAAAAACCGGGCGAGGAATACTGAATACTGGTACTGAAGG GGTGTATCCCGCTGGTGGGGCACTTGCCACTTAAGCATTTTACCACTGTA CCAGCAGGCTGGCCTTTCTGAGCGCCGCATTGCTGGTGGCATGGAACAAC AACAGTGGCGCCCTCTGCAATGTTGCAGCAGCATGGACGATAATGTTGCA TGTTGCAGCTGTTGCAAGATACTCCGCAACTCCACTTCTCATGCTATTAC TCTACAAAAAATCGCACGACATCTGTTTCTGGACCTGTTGTTGCTGCGTT TGCTGTTTGATGTTGCTGGAGGCGAAGTTGCTGCTGTTGCTGCTGCTGCT GCTGCTGCTGCTGCTGATGTGTTGCTGTTGTTACTGCAGCTGCAGCTGGA CAACAATTTGCATATACTTGTGGGCTTTCCTTGATTTTTATTTATATATC ATGGCGAATGCTTGCGGTTTCGCCCTGCGTGTGAACTAAAATCCTGCAAT TCACAATGTGTTATCTTCTTTTCGAAATGATATAGAATCAGAATTTAGCT GGAAAATTCTGGAAGTGAAGACAGAGATGATATTTCCGGTTGTATAGAGC TGCTTTTTCAAATGAATTACTTTCGCACACATGGCTTGATAAGATGATTT TCTTATCAATTTTATTTATACATTTTTGCTCGTATTTCAATTTATGCACG TTCGTAAAGTAAATGATTACTTTCTCGCTTGAGATTATATTCTTATTAAA TTATATTTATAAGAAACGTATAAAACATGAACTAATAAAAAATAATCCAA TTAGCGTAAGTAATAATAAGCTTGATTGCTCTATTTCTACTTAAGTATTA GCTTATTTTGTTTGCCTGATAGTTAACCTAATTAATATTTAATAACTTTT ACAGCTTGATCATAAAACGGTAAAATTTGACAATTTATGGGAAAGCTATG AGAAACTAATACGATAGCATTTGGATAAATATAGTACACGATTGGAGTTT TCCCCCAAGGCGCATGTGCAGAGACAATCAAGTTAATTGCATGGAGATGT TGGTTCTGTACTTTCCACCCAAGCACCACCCCCTTTTCGAATAACCTACC TCCCCACCACCGCCACGCCCCCTGCGAAAGCAGCATACCCATCTACTTTT CTCCAGCTCTTTCTGCGGTTTGGATTCAAAATTTTCCTCGATTTTTCCCT CAGTCTGCCGCTCGCCTTTGTCCCGGCCGGATGGCTTGGATTTTGGCCCG GACATCCAGGTGGGCGGCACTCCAAATTTCGGGGGCGTGGCTTTTGGGCG GAAAATTTGTGCGAGCTGTGTGCTTGCCAGGCTTTTCGATGGTTTTTGGC TCGAAAAGCGGATCTTTCTCGCAATTCGGATTAGGCGCCCAGCGCTGCCG AGCCATAGAGGCAATAGAGAAAGAGAGCTTTTCCAGGCCAGCCAAACGAA AAGTGGAAAGTCCGCCTTGGCTTTTCCGTCCCAGCTTTGCTTTGCTTTCT CCGGCTGCTTGCAGCCTGTTAGTTTCCGATAAAATTGACTTTTTGTCGCC GCCA