##gff-version 3 ##date Wed Jul 24 05:04:21 CEST 2024 ## exported from the transgeneomics system molecule_59023989 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59023989 mpicbg region 9631 24574 . + . Name=dmel-5.43-2R;type=genome;start=19829535;end=19844478;strand=- molecule_59023989 mpicbg region 24575 24647 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59023989 mpicbg region 24648 25636 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59023989 mpicbg region 25637 45687 . + . Name=dmel-5.43-2R;type=genome;start=19809484;end=19829534;strand=- molecule_59023989 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59023989 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59023989 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59023989 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59023989 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59023989 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59023989 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59023989 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59023989 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59023989 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59023989 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59023989 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59023989 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59023989 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59023989 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59023989 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59023989 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59023989 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59023989 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59023989 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59023989 coding_transcript gene 10179 12493 . - . alias=CG2980;Name=thoc5;ensembl=FBgn0034939;identifier=FBgn0034939;alias=THOC5;alias=thoc5;id=50831043;alias=garmcho;alias=garm molecule_59023989 coding_transcript gene 12571 14069 . + . ensembl=FBgn0034938;id=50831095;Name=CG3803;identifier=FBgn0034938 molecule_59023989 coding_transcript gene 14125 17385 . - . id=50831646;identifier=FBgn0034936;Name=CG2970;ensembl=FBgn0034936 molecule_59023989 coding_transcript gene 14487 16080 . - . alias=CG16783;identifier=FBgn0034937;Name=fzr2;ensembl=FBgn0034937;id=50799833;alias=FZR2;alias=fizzy-related 2 molecule_59023989 coding_transcript gene 17972 19627 . + . identifier=FBgn0034935;id=50799663;ensembl=FBgn0034935;Name=CG13565;alias=BcDNA:RH09340 molecule_59023989 coding_transcript gene 19650 24045 . - . alias=G[[alphas]];alias=DGs;alias=Gsalpha60A;alias=G-salpha60A;alias=G-5alpha;ensembl=FBgn0001123;alias=GSalpha;alias=Galphas;alias=G[[s]]alpha;alias=dG[[alphas]];alias=Gs;alias=stimulatory alpha subunit of G protein;alias=CG2835;alias=Gs-alpha;alias=Galpha60A;alias=Gs-alpha60A;alias=G[[S]]alpha;Name=G-salpha60A;alias=G[[s]]-alpha-60A;alias=G-alpha-60A;alias=DGsalpha;alias=G-alpha s;alias=GalphaS;alias=Galpha[[s]];id=51327475;alias=G protein salpha 60A;alias=dgs;alias=Gsalpha;identifier=FBgn0001123;alias=dgsalpha molecule_59023989 coding_transcript gene 24472 27235 . - . ensembl=FBgn0023477;alias=Transaldolase;alias=CT9666;alias=CG2827;identifier=FBgn0023477;alias=tal;Name=Tal;alias=154176_at;alias=transaldolase;id=50780898;alias=Tal molecule_59023989 coding_transcript mrna 24472 27235 . - . parent=50780898;Name=FBtr0072141;id=50780910 molecule_59023989 coding_transcript exon 24472 26408 . - . parent=50780910 molecule_59023989 coding_transcript three_prime_utr 24472 24571 . - . parent=50780910 molecule_59023989 coding_transcript cds 24572 26408 . - . parent=50780910 molecule_59023989 CLC misc_recomb 24648 24681 . - . Name=FRT molecule_59023989 CLC cds 24689 24760 . - . Name=BLRP molecule_59023989 CLC cds 24761 24781 . - . Name=TEV molecule_59023989 CLC cds 24782 24805 . - . Name=Precision cut site molecule_59023989 CLC cds 24806 24847 . - . Name=V5 molecule_59023989 CLC cds 24854 25570 . - . Name=SGFP molecule_59023989 CLC cds 25577 25636 . - . Name=2xTY1 molecule_59023989 coding_transcript intron 26409 26467 . - . parent=50780910 molecule_59023989 coding_transcript exon 26468 26591 . - . parent=50780910 molecule_59023989 coding_transcript cds 26468 26591 . - . parent=50780910 molecule_59023989 coding_transcript intron 26592 27121 . - . parent=50780910 molecule_59023989 coding_transcript exon 27122 27235 . - . parent=50780910 molecule_59023989 coding_transcript cds 27122 27218 . - . parent=50780910 molecule_59023989 coding_transcript five_prime_utr 27219 27235 . - . parent=50780910 molecule_59023989 coding_transcript gene 27897 30262 . + . id=50831421;Name=CG3735;identifier=FBgn0034933;ensembl=FBgn0034933 molecule_59023989 coding_transcript gene 31763 40692 . + . alias=CA-P60A;alias=organellar-type Ca-ATPase;alias=Kum;alias=CG3725;alias=l(2)SH0211;ensembl=FBgn0263006;Name=Ca-P60A;alias=Serca2a;alias=kum;alias=l(2)k09025;alias=Calcium ATPase at 60A;alias=Kumbhakarna;alias=Ca-ATPase;alias=dserca;alias=l(2)k08308ab;alias=SERCA;alias=SERCA2;alias=CaP60A;alias=sarcoplasmic endoplasmic reticulum calcium ATPase type 2;alias=lethal (2) SH0211;alias=Ca[2+]ATPase;alias=sarco/endoplasmic reticulum-type Ca-2+-ATPase;alias=Ca-p;id=50543625;alias=calcium ATPase;alias=dSERCA;alias=Ca[2+] ATPase;identifier=FBgn0263006;alias=Ca-P60 molecule_59023989 coding_transcript gene 40738 42409 . - . ensembl=FBgn0034931;id=50799132;Name=CG2812;identifier=FBgn0034931 ##FASTA >molecule_59023989 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACGCGTAAGCCCGAGGACCTGG ATAGAGCCTACGAGGTTCTGAGGACCACGCTACCAAAGCTGTTCGTGGAG CCCCTAGACTACTCCATTTACAGCCCGGGCCTAATCTTCCACAACAACAT AACGGGCAAGCACACGGTGGGCCTGTACCACTACGTCAAACAGATCGCCA TCCTGCGAACGGTTGGCCACCTGAAGTACGCCTACGTGAAATTCGAGGTG CTCAAGATCACGAAGCACCAGGACGACTACACAGTGCGGATAAGGTGGCG AGTGCGCGGCATTTCCGGCCTGAAGGTCATGTTCCAGTTCTGGAAGTACA AGCTCTGGCAACTGAAGGAGGTGCTGAAGGATCAGGAGGCCTGGTACGAC GGCTACTCTGTCTGCTATCTGGGCGACGATGGGCTGATCGTCAAGCACGT CGTGGACAAAGTGATGCCGGACGAGAGTCGGGAGGCGGTTGAGAACCCTT CTGCGACGGCACTACCTCCCGGATCCTTGGCAGCGACCTCTTCCCAGAAG ATCAACTGCCAATGAAGTCGTAGCTAGCTAGCTTTAAATGTTACTTATTT ATTGTATTACTAATCGTAATAAACGCAACTGTGAGAACGTTTAGTAACCG CATTGGCGCATTGTGTTGTACAACATTCGTTATTCAACTGTCACTGCTTG AACGCGTAGACCGATCCCTTCTTGATGTATTTGTAGGGGCGTGAGCGGCT CCGCTTGGCGAAGGCGCTTATGTAAGGCTTCTCCTTGTTGTACTCAATGG TGTTTTGCATGGATCCCTCGGTTTCGAGGAATATATCGAAGCTGTAGATG GTGCGGAAGAGCTGCGCGTACAGGATGCAGTCGTTGGGCTCCAAATGTTT GGGCTGCAGGGAGTTGGTCCAGAACTCCATCATCTGAGGAATACAAGTTT AAAAGCTAATTGGAGGATAATACCTGAATAAGTTCAAACCTTGATCGCCG AATTGTTTTGCGCGGTAAGGCATCCGTTCCAGTGCACATTCAGAATCCAT AGAGGCATTTCCAGTGGATAGTTACTCGGTATTCTAATAAAGCACTCCAT TTTGGCCGATCCCCGGACGATGACAGCGCGGTAAGAGTTGTACGTAATAC CCTTGTCCGCTGACGAAGAATTCAGTGCGTCTGAAATTTGCGAGTGAAGC TCCTCATGTGTGATGGCAGTCCATTGGACGAGACTGCACGACAGGCCGGC TGGATAGATGTTCTCCTGCAAGCTATACAAATCGATATCCTTGAAGGTCA GCCCGCGAATCTGCTGGCTTAAACGCTGCCAAGAGTTCAAGCGCCTGGCA ATGCGGTCAATAATCTCCTTGTTGTTCTTATTCAAGTTCAGTTCGTGTTT GTACAGCATCGAACTGTTGACGGTTGCAATCGAGCACATACTTTGCAGCC AACAGAAGGGTTTTCCGTAGTCCTTGGCCTTGAGGTAGCGCACACATTCC TCGGCTGTTAAATCCGAGCTTCGTAGCTGAAAGAGCGTAATTTAATTGGT TGTCCAACGTTGGATAAGGAAGTTCTTACCTCGTATTGGATTCCCGGAAT GGGTAATTCATTGCCCAAGTCATTGGGGTACAAATGCCGCAATAGGTGGT GAACAAAGTTTGTGTCACTGTGAAAAAATGCCTAGTTATTTATGCGATTT TTTCCTAGGTGTGTTCCAAACTTACCCCTGGCCGTTGGCATTCCTGGAGC AGTTAAGTTGGCCCCAGACAGTGGCACACTTGATAAAATCAAAGTAGCGA ATCTGCAAAACGAGCTGATTCGATCCAGCCGCTCCAATCTTTAAAGTTTA GGTTAATAAATGTTTTGGAATGAGCAAACCATGTCATCCTACCGTCAAAC AAATGTGTAGTGGGTGAGGAGCGAGTGAGTCGTCCAAGTTGTTTTTATCG GCAATCTTTTCCCGGTCTCCACTTTCCTTTTTAGTCTGTCTGTAGTTCAA TGTGGAGCACTTTTTCTCCTTAAGCAACTCCTGCATTTGAGCCTCGCTCT CATAGCCAACCACCTCGGCGGTGAAGGACTGCTCCTCGCTGACCCGCTGC AGCGATTGCAGGACAATGAACAAAACGTAGAGCGGCTTGGGCAGGTACTT GACCACTGCGCTTAGCTTCCATTCCACGTCCAGGGATAGCTGGAGTGCAT CGTGCAGCGGCTTTGTGGCGCTCTGCAGAGTGCGCAAGGCGGGTGCGAAG GAGACGTACCGCTGGGCGTGGCTAAGATTGTCCTGGAGCAGTTCCTGCTT GGAGCTCAGCAGGGCGCTGTACTGCTTGTCGAGTGCCTTCCGCAGACGCA GCTCGCAGTCGAGGCGATGAAGGTGCTGCTTGTGGCTGGACAGCTCCTCC GCGTCGTTGGGCATGTCTGGCAGCTCGCTGGAGTACTCGGCTTCCGAGAG CAGCTCCAAGCTGGTGTCCCTGCTCTTGAACTTCTGGCAGCGCACAATCT CCTTCTTCAGGTGGCTCACTTCGTACAGAAGATTCTGCAGCTGCAGCCGG CTGAGGTCCACCTTGCACTTTTCCAGGTGCAGCTTGTCGCGCCCCGCTTT GATCTTGTGCTTCACCTCGCGGTTGGCGTGCTTCAGAGCCACGAACATCA AGGTGGTGGCAATGCGAGCCTCATCCGTCGATTGCCCCTGCTCGTGACGG ATGTGGACGGATTTAGAGCTGTACTCTGGCACGGAAATCGGACTTACCTT GCTCTTCGCCTCCTTAATTCCCTCTATGGCCTTTTGCAGCTGATCGAACT GCGTGTTCAATATTGTTTCCATTTTATTTGGCGAAATTGTAAATCAGAAG CCGCAAAAGTTGTTTTTATTAACAAAACTGATATAATGTGGCCAGGCTAT CGAGTCGATAACATTCGCCGGTACTTTTCAAAATGATTTTAGTATATGCG CATACCCCACTGCTGCGGTCACACTTGGTAGCGGCTTTGTAAATATAGTT AAAAAACAAAATATATCCTTTAATATTTGCTGTAAGCTTAAGTTAATCTC TCCAAACTTGAAATAACACAATGCTGCGATTGCTCCAGAAGAGAACCAAT CTCATAAAGCTAGTAGTACCCGGCCCCCGACTTCACCAGACGATTGCGCA AACAGCGATAAAGGTTGCATTAATATCCCACTGATTACATATAAAAATAT GTTTTTATTTATAAAGTAATATTTGTTAATGCCGCACCTTTCAGGAAATC CCAGTGATAAAGCCCATCAGCACTCCGAAAAGCGACAAGACCGTCGGAAG ATGGTTCCTGGGAGTCAGCGGCATGGTCTTCGTGGCCGTTGGTCTAGGTA ACCAATAACAAAATGTAAAGTTTGTAGTTCCTTGCGAAAGTGAATCTCTT CCAGGCGGAGTAACCCGACTGACAGAGTCCGGACTGTCCATGGTCACTTG GAAGCTGACGGGTGAACGTATGCCCCGAACCCAGGAGGAATGGGTGCAGG AGTTCAATCTCTACCAGCAATACCCAGAGTACAAGCTGTGAGTACTCCCC AGATTCATCCAACGCCAGGAACTACATGCAAACTTCTGCTTTCAGAAAGA ATGTGAATATGACCGTGGAGGAGTTCAAGTTCATTTTCATGATGGAGTAC ATGCACAGGATGTGGGGTCGTGCCATCGGCGGGTTCTTCCTTTTGCCCGC TGTTTACTTCTGGAGAAAGGGATACTTCTGTGCGAAGACCAAGAAGAGCG TCCTGCTGCTGGGCACACTGATTGGCCTGCAAGGTCTGATGGGATGGTAC ATGGTCAAGTCCGGGCTGGAAGACAGGTTCCAGGATCCCAACGACGTGCC ACGGGTATCCCAGTATAGATTGGCCTCCCACCTGGCAGCTGCCTTCGTCC TGTACTCACTCTCCCTGTCAAAGGCCATGTCCCTGCTCATCCCCACGAAC ACATTCGTGATCCAAGCCAAGAAAGCATTTAATATCAAGGGGCTGACGCA TTTGACGAAGGCAATGGTCCTGCTGACTGCCATTTCTGGAGCCTTTGTAG CCGGACTAGACGCCGGACTCGTGTACAACTCGTTCCCGAAGATGGGCGAC AAGTGGATTCCCGATGACATGTGGACGTTTGCGCCCATACAGAAGAACAT CACCGAGAATCCGACGACGGTGCAGTTCAATCACCGCATCCTTGGTATTA GCACAGTAACGCTGACCACCGCTCTGTGGCTGGTCACCAGAAGGATGCAG TTGCCCAAGCGCGCCAACTGGGCCATCAACGCCGTGGTGGCTATGGCCTG GACGCAGGCCACGCTTGGCGTAACCACCTTGCTTAACTACGTGCCCGTGC CTCTGGCAACGGCCCACCAGTCGGGCTCGCTTATTCTGCTGAGTTTCGCA TTGTGGCTGTCGCACGAGGTTCGACTGTTGAAGTACCTTCCGAAGTAAAT AAATAGGCGTTTATTTGTTGAACCAAAAATTTAATATCCTCGCCTTGATA ATAACAACTATGAGTGGGGCAAATGTAATAGCAACAACCGTTTATTCATT CCTATTCAATATTCATTTTCACACTGCTTTTATCCTCCTGCAACTCCTTG TACTCAACACTCTTTGCGTTCAGGCAGGCGCCCACACCCTTCACGTTTTC CGATGACTTGGTGGCCTGGTTAGAGTTGGAAACGTGGTTGTACACCGCCA GGGCCTGGGCCACGAAGCCATTAACATCCCCGGGATTCGAGGGCAAGATC ATGGTGTTATTCGTCTTGGCCAGCTTCTTGAAGGCTCCAATGTACTGCTC GGCCAGCGTGAGCGAAGCAGCATTCTGTCCATCCTGAAATGCATAAGACG AAAACCACGATCTTAAATTAAGAAACCATATAAGACTTTAGATGGTAACA AATATAATTTATCGTAGCACAAAGAATACGTCGCAATTTTGTCCTCATCT TATGCCTTTAAACAAACGGAGCACGGAGTTTGGCTCTTTGGATATTTTCT GTTTGGTAAAAACGGTCCAGAAGCGAAGCGTCTCATCTGCGCCGCCAGTC ACTATGGACTCGTTATCCGGACTCACTGACAGGTGGAGTACCCGCTGTGT GTGCCCGGACAGCCTGGCCATCTGCTTCAGCGAGGGATAGCGCCAGGCAA TGACCTGTGGCTGCGCGTGTCCGTGGGTGGTAACCAGCTCTCGGGAATCC CTGGCCCAGGCCAGGTTGCTGATCTGGGCGCCGGTGTTGATGCACTTCAC CAGCTTCCCGGTGAGGACGTTCCAAAAGCGCAAGCAGCGATCGGCGGACC CACCGCCACTGGCCAGAAGACCGGACTTATGTGGCGACCAGCCCAGCGCC TTGACCACCGCCTTGTGCTCGTCGAAGGCGTAAATGGGCTCCGGCCAATC GTCGGTCCAAACCAACAGGCGGTTGTCGCTGCCACCGCTGGCCAAGTATC GATTGCTGGGCGACCACTGTAGGCCACACACCTCTAGCTTGTGTCCGCGC AAGCAGCGGGTTATGTGCGTCGGCGGATTGCGGATATCCCGCTGCAAAAT TGAGCGGTCGCGGGAGCCACTGGCCAATCGGTTGCCGCACCAAGCTAGCG CCGTTACACGCGCCGAGTGCTCTTCCAGTCGGTTTATCTGCTTTTGGTTC TCGGCATCCCAAATGGTCACGTACCCGGACTGGGTGCCAATGGCCACCTG CCGGCCTTCACCGTGCCAGCTAACTGCTGTAATCAGGTTATCCTCATTGT TGAAGTCGCATAGTCGCGTCACCTGACCACTGACGGCACTCCAGAGATAA ACCGAGCACCCGAGACCAACGGCCAGGGTGTTTTTCGACGACCAGTCAAT AAGGTTCAGGTAGAAGTCGTCTTGCAGCTCCGGCGCATCGAGTATCTTGT ACGGGCGACGTGGCAGTCGGCGCATGGGTCTCTTGAAGATGCTGAGCAGC CGCTGGCTGCTCTCGCTGATGTTGGCGAATGGTGTGCGTACTGGCGACGA AGAACCGCTGGCAAAACCAAAGATACGGTTATGCCGATCCCTAAAATCAT CAGTCTGGGCATGGACCTGTGCGGTCTGCTCGCAGTTCTCCAAGGAAGTG ATGTTCTCGTCCAGGAACTCGTTGCGCAAGAGGCATGAGTACACAGAGCT CTCGTACACATTGGAGTCTCCCGGAGCATTGACAAAGTTCCGGTTCCAGT GGTTACCAGCTCGTGTGGGAATGCAGCGCAGATCGATGTCCTCCTTTTTG CCGACGGCGACGCCCGGAAGCAATCGTTGCTGATACTCTGATTGAAACAT CTCCGAATTCCAATATTTGTTCGTAGTGTGATGCCAAAGTGTTTTTGAAA TTAAATGCCTAGCATTCTACCTAACCGAAATCGAGAGTTGGTGGAGTCCC CCGGCGAAATACTTACCAGGTGGGATAAGGATTTCGCTATGGCCAGTAGA CTGCGGGCTCTGGCATCCGCCACGGCTATAATGGCAGCCGCCTCTCCGCT GGCCTTATTGATGTGCTCCTGCCGCTCCGCCTCTGTGGAAGAAGGAACCA TGAATGTAACTACTGGGTACATTCTGTAAGGAACACTGCCGCTTACCGGA GGCTAGAATCCTAGACTTCCGCTTGCCCTCGGCTATGTTGATTTCGGCCT CGCGAACACCCTCCGATTCGAGAATAGCGGCTCGCTTTCGCCGCTCGGCC TCCACTTGCATCTGCATCGCCTCGTGAACCCTGGTGGGCAGCTGAAAAGG GACACGATCCATTAATCTCGCTACTTGAGAGTCAACTGAAGGATGTGACC TACTCGAATATCACGGATCTCGTATCGCAGACAGGCGATGCCCCACGCCT CGCTGGCCTTGTTGATCGAGTCGACGATGCTGACGTTGAGGGACTCCCTT TCGCGGAAGACCTTGTCCATGGACATCTTGCCCAGCTCCGATCTCATCGT CGTCTGGGCCAGTTGTGTTATGGCGAACTCCGGATCCTCCACGCCGTACG AGGCTTAACGGTGATATAACAGATGTGGTGACGTGCCGCTGCTTATGGAT TGTGGAGACCTACCTTTGTACGGATCAATGATGCGCAAGTAGAGCACGCC GTCGATGCTCAGGGTCACGTTGTCGGAGGTAATAGCGCTCTGTTTGGGCA CATCTATGGCAATTTCCTTCAGGCTCTGGACGTATTTGATTTTGTCCGCC ACCGGGACTAGTATGTTGAGTCCGGGGTCCAAAATCCTGTGAAAGCGCCC CATGCGCTCCACCACCCAGGCCTGGAAAACGGAGAGGAACGGATCGGATT GGAGTGAGCTGCGGGCGACCGTGGTCAGGCGATGGAACCTACCTCTTGCT GGGGCACAAACATAACACACATGTTTATCGGGGTGGAGGCCTTTCCCCTC CGAGATTGCGACGGAATCCATGAGCCGGCGAGCAGGAAGTCTTGCTGCAA GTAGATATATTAGCGGGCCGTTAAACCATTGCAGCGATTTCGAAGGTTCT AGAACGTACCTGGACCAGGCTCGGAACGAATCTTTTGTTTAAAAGAAATC TCGACATTTCGCAATATATGTGCCGATTTTACAAGTCGAAAAATACTAAG AAGAAAACATTATGATAGTCGGCAAACAGGGTGATTCATATCGCATTTGC GTGCAAATCGATTAATTTTTTCGTTGGGGGTATCTAAAACGGTAAATTTC GGAACTATTTTCGAATCGGAAAAGATGATTTCGAATATGTCTTTTAATTG AAATAAAGTTTTTTTTTGTGGAAAGTGACAGTAAGTGAAGAGCATCAGCA TAATAATTGTTTTTCAATTCTAGCCAATTCCAACCCGAATTATAATGTGA TATAACGTCACAAAGTAAAGTCAACTTTAAAATATTTCACATACTTTATA TTTCGTCAGCGCCAACCAACCAACGCTTGCAGATGAATGGGATTCGCGGT TAACTCAATTAACCAGGAAACCCTAAAGGCAGCAGACACAGGGACATTTA TGGTGTCGTGCAAATGAAAATTAAATCTAATAATCGAACATATGTGCGAG TGCACGCATGTTTGCTGAAATCTTGACACTCTCGCTCTGTTTGTGGGAGT ACTTACCATTAGTGGCTAGAAATATGGTGCAAGTGACGCATTAAGAGCAT AAAGGAGACCGAACTGGCCCACCCAACCCACGGCCACCGAACCATAGAGC CAGAGCCATCAAGCCATCGAGCCACTAAGCCGTTAATAACGGGTGCGTTC CTGCGGTCTTTTAGCTGTCGTCGGTGGTTATCTGCATCATAAATTTGCCA TCACCCTGTTTAAGTCAGAGGATGTTTGCCCCGAATCGGGTATAAAACGA ACTGCGGCGCGGCAAATCGGCACAGTCATCTTCAAATCGCTCCCAAGTGC ACCAGGCTAACGGTCAACGGCTGGAATCATGAATCTATATGTGCTCCTGG CGGTGGTATCGGTGTTCCTGAACTTCATTCACGCAGCGCCCGGTGTGGTA CGTTTTTGAAGTGCTTTCGAGAATATCCAGTGGAAAGCTACGGGCTTCTG TAAACGGATTACAATTACTATAGCTAACTATGTTTTAGGATATTTCCAAC GACGAACTGCTGGATGGAAAATATCTTTGTGAAGGTAACAACGAGCCATT GAACACATACTGAGAACCAACTTGTACATATATGTACATATATATACTCG AACTTTTTAATTATCATAACCAACAGCTTAGCTTTTGTACAAAGCCATTA AGTCCTAATTTCTTATTATTTCGATTTCGATTTCGATCAGATCTGCCAGC GTTAAGAGAATTGTGTAACGGAAACAGCGTGAGTTTACGACAAACCGGAC TTCCCAACGACGACCTTTCCACATCGCCGTTGTTTAACGAGTTTTACAAA CTCTTCCAACGAAATGTAAATATATTTCTGTCCAAAAACAAGAGCCCCGA GTCCTTGCAAGAGCGCTTCTCGAGAACGGTTTCGAAGCGCGGCTTGGACA GCATTGGTGGCGGTCATTTGATAAAGCGGACGCAGAGTAGACAGTTCCTA AGCGACTAGAAACCGCCACATTCCCAACTTCCGCTTCCGCTTCCGCACCA CTCCATTGACTTTGACAATATCGAGGACCGAAATGAAACTGAAATGTAAA TAAGCAGCCTGGTCTTTATTTTATATGTGCATATAAAATGATGTAGCTCC TAATTGTTAATAAATTATTGCATTTGTAAAGAGTTTTACTTTCGCCCTCC AGAGGAGAGTCATTCATGTAAATTCCAAAAATCTAGACTTACACTAATCC CTTACCACCGCTAACACATGCTGCCCCAAAAAGCTGGCTCGAAGAAGTAC GATGGACCGTTTATAGTGAGGTGAGTGATATGGTGGCACGTGAATATGCC CATCGTGCGACAGGTTTATATGTAGTACTATCAGATATCTGAGACTCGGC TGCTGCTATCAGGTCTTATCCGGATGTTATCGAAATAGGCTCTATATATA ATGTATGTAAATATGCAGATAACAGATCCGAATAATACGTGGCTATACCG GCAGCCAAAGTGCCTGCTTGCCCGCCTATTTGCCATTACTCACTGAACTC ACTAATCCCCTTCCCAATCACTGAAACATATGCCCTGATCCCCAGATTGA TTTCGGCTGCCAATGGACAAACGGTCGTCTGCTACGAGTGCAGCCAGTCG GAGTTCAAGACGAAGTACTCGGTGAAGCAGTGCGCGGCCGGCAAGATCGG GTCTGGCCATCACCGGGACCTGGTGCCCTACCTGGTGAGGATGGACCCCC TGTACAAGGACACCTGGAGCAGTAAGCTCAAGCGGAACTTCGACGAGATC GACAAGGCCTCCGCCAGCTTCAGCATCCTCAACCAGCTCGTCTAGTGATA CCTTCGACAGCGCGTGAATGTAAATGCCCATGGATATGGATACGGACTCT GATAGCGGAAATACTCTAAAATGCTTCATGTCAAGGGACTATAGAAAATA AAGCAGGTGCATCCTGGTAGAATAGCCAAAATAATCGAAACAAGCGTGTC TGTTATTAACATGTTTATTTATTATTCTTTAATGTTGAGTTTTGTGAAAG GTCATACCAGATCTAAATGCAGCGAATTTTTTGTTTTAATCAAGGGACTA TTTAAATACAAATTACATTTGATAATTATATTTAAAACAGTAAGTCATTA ATATTTTTATTTACTTGCATTACGGCGATGGGGATAACCTATAACAATTC ATATTGACGAAGGTGCATCCTTTGAATAATGTCTCTGCAATCATTAAACA CACGTTTAATGTTTTCTGTGTCAACGGCGCATGTGAAATGTGGATAGCAG TAGTGTTTTCCGTCTCCGCTAGCGGTAGATATACGCTATATAAGAAAGAG ATCCCATTAAGGATTAAGGCTAGTTAGATAGGTGGAGGAAGAAACGGAGA TGTGATATAACCCACCAGAAACTCGTCTCGTATGAAATATTTTGCTCGTA TTACTTCTGGGTCATCATTGGATTCCATTATTGCGTCACCTGTGTCGACA GCACATTTGAAATTAGACAAAATACATTATCCATTAAATTTCTTAAGTTA ACTTGGGCACGGTTTGCAAATTTGAAAAGGAATTGCGAATTTCTTGGCCA GATCTGAGTCGGTTGATCTGATGACTCCCTCGCCCTCAATTGGCCTCTAC TATGGGTTATACTATTTTACTTACTTGGCGTTTGGTATTTGTTAAACTCG GAGAAATATTCCGACAATTTACTTTTTCCAGCCTTAATTTTCTCTGCTAA CAAATCTTGCTTATTTAAAAATAGTATAATAGAAATCGTGCGAAGCCATC TGAAAGAACAACTCGTTAGTTTCCATTTGTCGAGATGGCGCCAAATTGCT CGGTTCACCTGTTGTTCCAAATACTCTTGAACAAATCCAAAGATTCTCGA AGTCGGTTCTGGGTGGGATCTTCCCGCAAAACCATGTTATAACTTGAGCA CGCAGTTACGAATATGATAGCAGTTACATCATTGAAACACTGAATCCATT TCCTACGCTCGTCCCGCTGGCCACCGACATCGAACATGCTGCACGCGAAT GCACATCATTAGAATGGAATAGAAACTAAAATATTGCGATATCACTTGGG ATTACACTTACTGAAAGTTTACTTTGTCCACTTGAAATCTTGTTTCAAAT ATTCCAGAAGTCAAAACACGGCACCGAAGAATATCCTGCTCATTAGGGGT GTAGTTTGGATTCTTGATTGTGCTCACTCGGTCCAGGAAGCTTCAAAGCA GAATATCAAGTGTAGAAGTAAGTACAAATTCGGTTTCAGTGCCTTAATCA AGCTTAGATACAAGTACAAATGCGGATTAGCTGGCATAAACTACGGAAAA TTGGGACTTGGTGTTTAGCAACTTGTTTCTTCGGGGAATTAAACAAAAAG CCTTCTCAACTTGGAAAAGTATGATCGTTACGATACTTCTATGTGCATGG CGTAGTTGGTACTACTTCGACTACTAGCTCCTTTTAAGAATTGGACTCAT TCTAAAACCCATATATTGTAGTAATTATTGTACAGACAGACAGATATGGA ATGCGAAAGTAGGTTTAGGTTGTGGTTCTACTTTCAGATAGTCATACTGC AGCAAAGCGACGATATTTAAAGTTTACTTCATCAAGCGGATTACTTGTTA GAATTAAAAGTTGCATACTTTCGATCCAACGCATTGAATTTCTGCACTTC CAAGTGAAACACATAGTTAAGCTTTCAGAACAATTGGCATGCACTCCGAG ATGAATTAAATTAAACAATTAAATCTGTTTGTAGTGCTACAAGAACTATT CGTTTGGCTCAACACATCGATGGCAGGATGTTAAATGTGGGTGGGCATTA CTTACTATTTCGCACAATCGATTAATTGATACTCATTCGACCTCTCATAG GTTTGAAGAACGCCCTTGTCTTTCCATAGTTCTTCTGTATGTTCATAAAA TTCAGGAGGATAATTAAAGTCCGGACCTGCGGGGCAGATAATGGTTGATA ACAACTTAAGTTGGGGCGGCAGAGGCTCTTACTAGATGCATAATCCTGAA TGTACTCCACTCTGGGTTCATTTTCCTTCTTTTCTAAAGCTACAGGTGGA TTAAGTGTGCTCATGGCTCCTGTAATAGTCTGTAAGGGATTGGCAAGGAG TTAAGCAAGTGTTTGGGCTTAGATGGCCGGCGGGATGGAACTCACCAAGA TAGCGTCTCGAATATTCTTTTTAATATCATCAATTTTCTGTTTCTTTTCC GAGTCAGAAAATCCGTCGACATGCAATATTCGCATTTGCTTGACTATGGT TGATTTGCCGGACTCGCCCGCCCCCAGGAGGAGCAGCCTGTGTGTGGCCC TGTAGAGCTGTTTGTCCTTCTGCAACTGTCTAGATATTGCATCGCTCCGG CGCTTCTGGCTCTTCGAGTCCTCCGAGTTCACGTCCGACTGCTTGGAGGT GGGCGACCCAAAGCAACCCATCGCAGCCCACGGGGTCCACCAACACGTCG CTCGGTTTTCCTGGTTCGCGTCGGGCGACTCGGCACCCCTTGTGCTTTCT CCGTTCTGCTCCAGTATAGCTGAGTGCTTGGGTTCCTCGGATCAAACCAC AATCCCTTGTGTGCTCGTCGGTCTCCGGTCTGCGATCTCCGATCTCCGAT CTCAGTGGCACCACCGTTGGCGTTGGCTCAGCGCTTCAGTGGATCTCTGC AGCAGGCTGCATTCGTACAATGGTATAGTAGATGGAAAAATGAGTAACAG AACTTTCAGAACTAACGATCCTCGAGCTTTCTATTCCCACTAACTGAGAT TCTCCAGCAGAAACCCATTTCGATTGCATAGAATCCCGAATCCACTTCAG TGCCCCCATATCATCCGCGTACGCGCGAGTGTAGCGACCAAAATGGGTGC CTACTAAGCCAAGGCGACGCCGCTGACATTGCCGCCCACGAAAGTCCCGT GAGTCACTGGGTTTCGGGTCCCAAAAGCGCTCGCATAGCATCGGAATCGG AATGAAAATCAAAATCAAAAATTACTCCACGCAACGCGCGTTCATTCGCG TTGGACATTCGCGTCGGACGATTGGAATTCATCACATTCATATTCACATC CATATTCACAGCCATATTCACATTCTCATTCACATCGACATCCACAACAT CGGCGTAGTGTAACAGGTGAAGAAGGGGGCGGAGAGGGTGGCACTCTCGC GCATACTGGGCAGCAGGTACGCATGTATATAGAGATACCAACCCAACATA ATTCCATCTGCAGTTGAGGCTCGAATGGAATGGATGGGTCCGATACGCGG ATTCGGATTCGATTAGCTCGTATGTGGGTTTACGGATGAGTGTAGGCACG CGAATATTAAGAGTATTTAATCTAGCAATTATTGCCGACCGACGGGAGTC GCAGGAAGATGAACGTACTATACCCTACACATATACCTATATAGGCGGAG GGGGTGGTGGCAGATATGCCAGATATGGCAGATATGCAGATTTTAATGTA AATATATGTACATAAATTCATCGGCATCGGAATCGGGATCTAAGCGGGCA CGGACACGGACACGGGCACATATATATCTCACAGATATGAGTACACACCG TTGTGTATCTACTCGTATATACGTGCGTATGTATTTAGATATATACACAA GTTCTCGGTTCGCATGTGTGAATGGATGGATGTACATAAATAAATGTATG TACATATATCAATACGTAGTGCTCCGTGCCTCCGAATCCGAAATATTTGC CATTTCTTTGACACTTGGTTAGAAAAACTATATTATACCTATACCATCGC GAATCGGATCGAATCGAATCGAATGGAATGGAATCGCATCGCAACGCATC TGCTTGGATTGGTTTGGATTCGAATGGATTGAATTCGATGGATGGGATTG TATTTTGGATATTCATGCGCGAACGATTTTTCACTGATTTCAGGTTTAAG GACATGGGACGCAGGTCGCAGGTCGCAGGACGCAGGACGTCCGAAAATCG GGAGGTCGGTCGAGATCGAGGGGCTGCAGGGGCGAATCACATCTCTGCGC GATGGCAATTACGTGTGCGAACGCGACTATTCCCTGCGTTCGACAATGGT TATTGTTTACCGTGAAATTACCGAACATTTTTATTCATGGGAGCAACTTC GGGCCAAGACTATAGGTGCACGACTCGGTTGGGAGCGACTTTTGGGGTCT GAAAAACAGGCAATTCTATCGCACCCGACGCGCCAGCCACTGTTTTCCGG ATTCCCAATGTTCTTAGTCTCTGTGTGCTCGCAATTCATCAATTTGTAGC TTAAAAATTACTTTTAATACCAGTACTAACTCACTTTTTATATATTTTTT ATTTTATGTATCAACCTAGGGATGCAACGAAGTAGATACTTTTATCGATA GTCAGTCTGCCTATCGGATAGTGCGGGCGGTGATGTAGATAGATATGTTA CTGGGCCAAAAACATCTATGCCAAATGACGATGTGCTATTTTAGCGAATA TTAATAATAAAATAAAGTATCCCGAGCTATGTAGAATAGCGAAATCCAGA AACACCCGTCCGATACTTTACATAAGCAGCCGTCTCTACAGGCTTACATA GATATTCTACACGGGCGTGTAGAAAACATGTTTGAAGTTGTTATGATAAG GTATCAAAAAAAAAGTATCTTTATCTGTGATATAATTTGCAAATTTTATT TATTTTGTAAACTTTTAGTATTTATTATTCGTATCCATATCTGCAACGAG TAATCATGCTATTTGCATGCCAAACCTATTCACCCATTTAATAATTTCCA TAACTCCCAACTGAATCTTGTCATCTCTTTTAATTGTAGTGTTTATTAAA GTATAAAATCATTGTCTTTTTCAAAAACGAATGTATTCATCCTCCACCTG CTAGCGGACCCAGAGGAACATCTACTTGTCGTCGTCATCCTTGTAGTCAA TGTCATGATCTTTATAGTCTCCATCGTGGTCTTTATAATCTGTCGACGAA GTTCCTATACTTTCTAGAGAATAGGAACTTCCCGAGGATCCGCTGCCGCC GGCGTTGCTGCGCCACTCCATCTTCTGGCTATCCAGGATCTGGCGCAGGC TGCTGGCCATGCCCTGGAAGTACAGGTTCTCGGGGCCCTGGAACAGCACC TCCAGGGTGCTATCCAGGCCCAGCAGGGGGTTGGGGATGGGCTTGCCCTC GAGCTTGTACAGCTCATCCATGCCCAGGGTGATGCCGGCGGCGGTCACGA ACTCCAGCAGCACCATGTGATCGCGCTTCTCGTTGGGGTCCTTGGACAGC ACGCTCTGGGTGCTCAGGTAGTGGTTATCGGGCAGCAGCACTGGGCCGTC GCCGATGGGGGTGTTCTGCTGGTAGTGATCGGCCAGCTGCACGGAGCCAT CCTCCACATTGTGGCGGATCTTGAAGTTGGCCTTGATGCCGTTCTTCTGC TTATCGGCGGTGATGTACACGTTGTGGCTGTTGAAGTTGTACTCCAGCTT GTGGCCCAGGATGTTGCCATCCTCCTTGAAATCGATGCCCTTCAGCTCGA TGCGGTTCACCAGGGTATCGCCCTCGAACTTCACCTCGGCGCGGGTCTTG TAGGTGCCGTCATCCTTGAAGCTGATGGTGCGCTCCTGCACGTAGCCCTC GGGCATGGCGCTCTTGAAGAAATCGTGCTGCTTCATGTGATCGGGGTAGC GGCTGAAGCACTGCACGCCGTAGGTCAGGGTGGTCACCAGGGTGGGCCAG GGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCC GTTGGTGGCGTCGCCCTCGCCCTCGCCGCGCACGCTGAACTTGTGGCCGT TCACGTCGCCATCCAGCTCCACCAGGATGGGCACCACGCCGGTGAACAGC TCCTCGCCCTTGGACACCATGAATTCATCAAGTGGATCTTGGTTTGTGTG AACCTCGTCCAGCGGGTCCTGATTGGTATGCACTTCCTTAAGATAGGTCT TAATCAAATTCTCCAGCTTAACAGTATCCACGGCGAACTTCCTGATGCCC TCGGAAAGTTTGTCGGTGGCCATGGCGTCCTCGTTGAGCAGCCAGCGGAA CCGGCTCTCATCGACGGTGATCTTCTCGATGTCCTGCAGCTTGGCGTTGC TTACGGACAGGTAGGTGACCACCGACTCGGTCTCGTTCTCCAGCTCCTTA AGCAGCGCTGGGCTGATGGTAAGCAGATCGCAGCCAGCCAGGGCCTTGAT TTCGCCCACGTTACGGAAGGAGGCGCCCATGACCAGGGTCTTGTAGCCGA ACTTCTTGTAGTAGTTGTAGATGTTCGTCACGGAGATCACGCCCGGGTCC TTGAGCGCCTCGAACTTCTTGGTATCCGTGTTGGCCACGTACCAGTCCAG GATGCGGCCCACGAACGGGGAGATGAGGGTCACGCCGGCCTCGGCGCAAG CCACGGCCTGTGCGAACGAGAAAAGGAGCGTCAGGTTGCAGTGCACACCG TGCTCGTTCTCCAGGATCTCGGCCGCCTTGATGCCCTCCCAGGTGGACGC CAGCTTGATCAGAATTCGCTCCTTGTCGACGCCCAGGGATTTGTACAGGG CGATCAGCTTCAGGGCCTTCTCCACGCTCTTCTTGGTGTCGAAGGACAAG CGGGCATCGATCTCGGTGGAAACGCGACCGGGCACAACCTTCAGGATTTC CGTTCCGAACAGCACGCACAGGTAGTCCATGGCCTCGGCCACCTGCTCAC TCACGGAGCTGCAAACGATGGTATTCTATGTAGCTTTGTGTGGCAAACAC CCAAGTGAACTGCTTACCCCTTCTTGCCCTTGGCGTATTCCACCGCCTTT TGGACCAGCGGCTGGTACCGCTCCATGGACGAAGCGGACAAGATGAGGGA GGGATTAGTGGTGGCATCCGTGGGCTTATAGATGTTGATGGCTGGAAGCA ATGTGTAAAGTATTTGCATAAGTGCGGGGCCAAATTACATTGCGAATTTT AGAAAGACCTCGAAACCTGTTGAGCGACTTTCATTTTTCAATCGCCCGAC CGAAAATATCTTTGAACTTTTCAAATGTCTGAGCAGGTTTGGCACTCTGC TCCGAAACCTTATCTCTGGTGGCATTCTATAGTACACTTTACTATAGCGG TCACATTTCTAACACACGTAAGCACCAAAGGTCAAACTAAAGTCAGCTCG GATTTGCTTTTCACTTTTATTTGATCTTCACTGCGGCAGACACGACGGAT CCGATGGCCCGTCGTTAATGTTTATCTTTTGGATAAATCCATGTATCCTA TGTATCTTTGGACTCGGATTCTATGTATGCTCTATATATGTATGGATGTT CGAGCTCAGACTCGCATTTCGCTTTAGTTGCATTTCTGGATTCCCACTTT TGAGGCAAACTTACGCTAGCTTTGAAATCGGACTCATCTTGTTAAGAAAA ATACCTTGCGTGCGTACTTACCTTCAAAGTCGCCGGTGTCAGCCACAATT GTGGTGATTTTCTTGAGTTCCTGTAATACCGACATCTTTTGCTTTTTTAA CGTGCGATCACTTCCCATTGCCCAACTTCAATGCAATAAGACCGCCACTG GAGCGGCAATTTATACCGCCCGGCTCTGGAAAAATACTGAACAGCCCCAA CTTGGGTTTAGGAATCGATATAAGGGGCCATCAGGGGGATTCCTGACAAT TAAGCAGACTTAAACTAGCTCCCTAACATTAATCTTTAACTGTGATGATA AGGTATTCAAGCTAATCTTAGGTGAATAGCTTGTTAAATATAAATAACCA TCTACTTGTAATTGGACGAATAAATAAGTGCATACTTTCGTTCTTGTACA GAAAGCGCTGAACATTTTGGGTCGGAAGAAAATTTTCGTAAACTAACGAT AATTTTAAAAGTATGCATTTTTTTTAGATGATTTTTCTAGTGCAATGATA TTGATTTTACTTGGACTAGGCTGGTCACCTACTGAGATTTCAGTTCGCCC AGTACTTCAAATCGGAAAATCACCATATTTGACCGCTTCAAAAGTCATAT CTTAGACAATTTTTTGATATTTATATGCCAGAAATCAATTCATCGTTGGT CACCTACTGGGGTTTCATAGCAAATTTATGTGATTTCCTAAAAAAACATG GCTTAGATTATAAATTTCAAATGAATTAGCTTTACCGGCTTTAAATTCAC CACACGCCATCTCTAGGAGCTATCGATATGTCTGTGTATCGGATTCCTTC ACCAATCCAGATGTTTGTTGATCCACACGTGTGTGCGAAAGATACTCGGT AACAAACAGTTTAAAATGAAACAAAAACACTCGAAGAACAGGGCGAAGCC CTACAAGAAACCAACGCCCGCCCGGCGAAATGAGAGATTCTCGAAGAACT ACAGTTTCATCCAGAGGAGCAAGCAAATGGAGGAGTCCCACCGCAGGGAA CGAATGCCCACAGCACCGAAACAGGAATATGAGCCCGTGGCGGAGCTGTT GCCGGAGATCCAGGATGATGTGGACGAGACTGAGTTCTATAAAAAGCTCA TAACTGGTGTTAATAACATACCCACAAGTAGCCCTTGCAATGGACAAAAA TGTGCCCATGACTAACTAAGAATATCGTTTCCAGGTGACATCCTACGCTC AAAAGCAGAGAAGGAAGAGGATCACGTTATTCCCGTGCCCAGGAAGATCA AACCCAAAAAGGAAAAGCGTTCCGAGCAGTTAGGTGTCGACTTGGAAATA TACAATTCGTTTTCGAAACGCTTCGATTTTGAGCTATCTACGGATAATAT CAACGATTTGATTGCGAGAAAGGATGTTAAAACAATCAAGAGGAACTGGT CCGCTCTGGGGAATGTAAGGTTCGATATACCACGACTGACTGAGGACTTC AAGGAGCCCGACTGCAGCGAGCCCAAGGACATTGCAAGCACGGAAGATCT GCAAAAGTTGGAGGTGAAGGCGTCCATTTGTGCAAACGCCAAACTGCCAC TCACTGCCCTGCAGTCCCAGCTCTTCTACATCGCCAATAACTACCAAGAT ATATACTATCCCCATCGAACTCATGGCAATGCCGAGGATATTCGCTATGT ATACTGCCTGCACGCCCTGAACCACATGCTGAAAGTCAGATCACTGATAT TGCGCAACAACGAAAAGGTTTCGGCTTTGGCCAAGTCACAAAAAATGTCG CCCAACGAAATCTCTATACCAGAGAGCTTCAGGGACCAAGGGCTTAAGCG GATGAAGGTCGTTTTTGTAGTGCCCTTCAGGGAATCGGCTCTAAGGATTG TAAATATACTCGGAGATCTACTCTTTGGCAGTCAAGATGGTAAGTCACCC GTTGATAGCAAAGAACCTGTATTACCATTAAATGTCCTTCACAGATCAGG CCAGGAAAACCTCGATCGCGAACTATGAACGCTTCCTGGGAGATTACTCC GGGAATACGATTTACTTCCCCAAAACCAACCCAAAGCCAATGGATTATGA GCAAACATTCAGTGGCAACACGGATGACAACTTCAAACTAGGTATTCGTT TTACAAAGAAAACCATGTCCCTATTCTCCGATATGAACGCATCGGACATG TTGATCGCGTCTCCCTTGGGACTGAGAATGCTGGTTACGGACAAGGAGAG CGATTTTGACTTTTTGAACTCCATTGAACTGCTGATAATCGACCAAGCCG AATTGTTCCTGGCGCAGAACTGGGAGAACCTGCTGCACTCCCTGGACCAC CTGCACCTGCAGCCGCAGAAGCTGCCCGATACGAATTGCCAGAGGGTACG AACGTGGTGCCTGAGTGGAGCGTCAAGTTTCTACCGCCAAACCCTGTTCT TCTCGTCCCACGAGCTGCCCGAGTTCCGGGCAGTGTTCAACAGCAAGTGC AACAACTACCAGGGAAAGGTGCGAGACTCGAACCTCGTCGAGCACGGAGA CATCCGGAACGTTCTGACTCCAATACATCAGGTTTTCCGCCTAATCAATT GCTCCAGTGTGGAGACGACCTTCGACGATCGGTTCCAGTACTTCGTCAAG AATATTATGCCCCAATTCAGTAAGCCCGGTTTCTCGCACTGTATGCTATA CGTGCCCAGCTACTTTGACTACGTACGGATACGCAACCATTTCAAGACCG AAATGGTCAGTTTTGTGCAGATAAATGAGTACACCAAGAAAGAAAAGATT TCCCGGGCGAGAGATATATTCTTCCACAGCGGGGCATCTGTTCTGTTGTA CTCGGAAAGAGCGCACTTCTTCCGGCGCACGCGGATTAAGGGCATCCGGA ACTTGATCATGTACCAGCCGCCCAACTTTCCGCACTTCTATTCCGAGATC ATCAATCTGATGCTGAAGACAAATCAAAATCCGCGCGATGGATTTGGGGA CGAAATGTCCGTCAGTATCCTGTACACAAAGTACGATCTGCTAAGCTTGA GTAACATTGTGGGCAGTGAGAATGCTGCGAAATTGACTTCTGGTCAAAAG GATTCCTACCTTTTCTCCACCAAAACGTAAATGCTTACACGAGAGCTGAC TTTGAAATATGTACATATTTAGTTGTCAATTAGAATATACTAAATGTTAA CGCAAGTAAATAGTAATGTATGTGATAACTTTCAGTTGTGGCTCTATTTT TGGACCTAAATACTTTCGTGACGTAGAGATTTTAGGAGGAACTGGCTAGG TGATTGATCTGATGTTAAGGGTGGCGATGTCTTCTCTTTGTTATTACGCA ATTTGAAATTATGAAAAAATGAATAATTGGCAAATGGTTGTGTAATAAGA GGCAGCATAAGTAGTGTTTTGCCGATTGATGAAATGATTCAAAATGCATT TGAATTCAATATATTTTGCCTGTTTTTACTTTAATATCCCTTTTTTATAA AGGAAGATTGGCCAGAGCATTATGCAATAAAAGTTATCATTTATAAGGCA ATTAAGTGTTAAAAAACATTATTTTGCAGTTTGTATTTGTTTTTAAATGA TCACTTCGCTTGATTGCTTGAGATTGCTGGAATCTGGAACCATTACCATA TACCGAGTTCCTAAATAGACAATATCCAGCGGTTGACAACCGCATCAAAC CCAGATTTGCCAGTCCCAAAATAAATCAAAATTCCTGGCTGCATTGTCAT TTATCAACATTTTTAAATATACACATAGGTAGCTTATAAAAGTTCTGGCC TAGACATATAGAGGTAAAATAGTAGCCAAATGCATATTTATGGGGGTCTC TGTGAAAAGTCGTAATAGCTGCTGCACAAGGCGGATGGCTGATGGCGGAT ATCATACGGCAGAAACGTGTGCGGAGAGCGCTCTTGCCAATATCTGAGAG TCCGAGTCCGTAGGGGCATTACAAGCCTATAAATAAAAATAGTCGACGGC TGCCAGTCTCTGCTGAAATTGGGGAAAAAGGCAGAAAAGCCAAACGAAGA ACTAGGGGTTCGCAGGCCGACTGGTGGATGCTCTTTCAGCTGTTAATGGA TCGAGATCAACTAGATTGAGGAAATGAGTATTTGGGCTGGGATTTGGGAT CTGTTGTATTTGCCAAGGACAAGTAAAATATTCAAAGGGCAGCAGCTATG GATAACTATGATGGATTCTAGCTCGGCGAAAGTGGAATGCGTCAGTGCCA GTGCCATCATTCCCAACCATCCCCCCACCAAAGGACCCAAGTCTTGACCC ACTTGAAGTGGCTGACACCGAAGGTAGAAACACCTTTGAGTGACAAACCC TTCCACACAACCCAGCATAATTTCCCCAGATTGGTTTAAAAATACCACTT TCTAAATATTAGACAAACACACGTGCATTTCTCGGAATACGTCTGCACTC ACACTCCCAGGCACATCCACATCCACAACCACATCCACGTCCACAAGTGA TCTCGCATCGCCACATTGCCATTGCTCTAGACTTTCGTGGCCGTGCGCTC CCGCGGATCCGAGATCGGGCGGCCATATGTACGTATGTATGTATGTGGAT GGGGAGCTCGTGTGCCCGTGGTATTGTGGTATTCCCACCTATACCTAGCC ACATATACGAATCTCTGGGGGACCACGGTGAATCTGCCTCGTCGAGGTAC GAACGAGCTGCACGAGCAGATCTGAACCGCCACCATTCGAATTCGGATCG CATTGGATTGGATTGGATAGGTGGTAAGTGCTCAAAAGTTTGTGCGTGCT AAAAGTATTTTCCCGGGCCAAAATAGAGAGTGTATGTAGTTTTGGGAATT TTGCCAAAATATATGAATTTTGTAATTCAAATAGACACTCTCATCGCGCA GCGTTCTCCTTGCGTTCAGTTGCCGTTGATCGTTATAATAGCGCGATCTT TGTGTCTTGGTCTTCCGACTGAAATAAATTATTATATAATAACGGAATTT TTGCTAGGAATAATAATTGTAAGTTTTGTTGATTTTCTGCAACAACTGCA AAGCGAATACGCCAGTGAATTACTCCAAACTGCCAAAACCATTGGGTAAA GCAAATAAACCCCCCTAAAAACTATCGAAAATTCGTCCGCGCGCTTTCAA AAGAAAAGAAAACCTGGAAACCAAAAGTTATTGAAATGCCTACATATCTA CATACGAACATGCTTCTTACACTCGAAAACCGTGCTTCAAACTCAAAGTG TTTGCCCCCAGTTTACTTTGCCACCCTGGAGCTCGTCCAGAGCTCGTAGT TCGATCTATCTACATACATGAAATATCCGTAAGGGCGACGATTCGGCGGT GACCTCGACCTCCGGATGGTATCGAAAATTTGAATGTCACCAATACGAGA GCACTCCACGAATAGATTCGATCCGACACAGATGTAAAGTTTTCCAAGTG CCCGAGATCTATGTATCTGTGATTGAAAATCTGGTTATGCAACCACAACC GCAACCGTGGCGAATATATTCGTACCCAAATTCGAAAGATCCATGTCTTG TACTGTACCTGTAGCCCTTGTAACAAGCATAGAACACACGATCTCTTGAA CTCCTTAACTACCCGCATTCATAGCTTAATGGTGGTTACATCGGTTAGTG AATTTGACTGCCTTTCAGTTGCAAAAGATCCCTGAAACCAACAGACAGTT TTACAGAAACGTGTAGCTCTATAAGTACATTCAGCCCAGGATCATGGCCC AATCATTTGTACTTATTTTTGAACCCACCCACCCACTATTATACAACCCA TCGGTGGACTTGTCAATCAGAAATTCGGATTCGGGGACGTGGGAAGCAGC ATATCGCACAAGTGTCGACATCCATTAGCATGGAGATATCTCTGCTCGCA ATATCATAAGCCGTTAAATCGTACATATAACCGCGCAGAATAGGAATCTT TCTCCCTACGATCGTCTCTCTGTATATGTACTCAAACTTATTTATGTGGT CCTAGTACATATCTTTATATCTACGAGTGTTCAGAATTGAGCTGTATTTT TCGGGTGCTAGGACTCTATTTTTAGCCCATCTCGGACAGAGGCGATTTTT TGCTCCATAATGCACACACACATGTGTATTTTAGGGGTATATATAGGCTA TATGCATGAAGATGTTTTCGAAACACACGTCTCTGTGCTCAAAATATAAG TAGTATTCGAGCGCATTGATTGACAGTTTTTTGAAAACTAACGCCTTTTG TGGGCGGGCAACTGGTGGAAACCTCGTTATCAGAAGTTACGTATGTAATT CTGTGACGTAGCCAGCGTAATATTCAAGTATTATGCGAGTTGGCTGCCGT TCAAAATTCCCCGTATGGCCTGATTCTAGTGTCTGGTCGCGAAAAAGATT AAAATTAAAATTTAAAAATGTCGCTGCTGGCGAATACCTGGCACCCAGAT CTATTTATTGCGGGCTCTTGATCTCGATCTCATTAATTTGAGCACAAAAT GCGCGAAAAGAATAGTGTTGCTTGTTGTGTGGCCAAAATAGTGCGGATGT CTCTGTCGCTTGCCAAGTGAAAATATGACAATGTATAAATAAGTTTAAGC ATTCGTGATAAGGATTTCAGTTCGATTTACACCACAGAAGGGAGTAAAAA CATTTGGTTTTCGATCGCAATAACAACTTGATTTATAAGGTTAGAGGTAT TTTCCAATAAAGAAACTTTCCAGCACAGCTGAATTCCTTCGAAACTTTGA TTAGTTTTAAATTCCTATATCACCTCAGCTATCGGTATTACTGAACACGG AAACTCAACAGTTAGCCATCGCAGTTGAGATTCTCAGTTATCGATAACGC CGGCTATCGCAGTTTAGTAGCACAAATTGAACGCGTCAGTAGAAGCTGAG CTAAAAGGTGGGATAATTATCTAATAATTGCCAGGACTGAGAATTCTTAA AAGTTGGAGAAAGAGGCAGCTCTGCACAAATAACGTAACTCGGACGATAT ACGTTTTCAGTCAGCCCTGTCTTGTGCGAATAATGTCGTGTCATAGTGAG GCAGAACGGCGATAGGCAGTAAATCGCGGCTTGGTACTTAGTGCAATAGT TATCAGCACACATATTCAGAAAAAAGCGCCATGGGTTATATTATATAGAG AGTCAGTGGAAAAAAGTACTTAACACACGCAGTGCGTCGTTTAGCGAGGT TAACGTAGGAGCAGAGCACCCGTATTACGGACCAGATCCCCCAATCCCCC GCAGAAACTGAGAATAGAAAAACGAAAACTGCGTCTGTTGTGCGAAGTGA CACGTGTGTGAATCTCATAAGCGGAGCGATTTGGCCAGGGTAACAGCCCA TCATAGTAATGCAATATTCCAGCATATTCTCCGACCCGATCCGCACAATC CGATCCTAAGTTGGCGCGATAACTGCGCGACTTTAGTGGCCAGTCCGGGC CCGATCAGAAGTGCCTGAAATCGGGGAATTAGCATGTAGCACCTGTGTAT GTGCGTATGTTGGAAAGTACCCGTGAGCCGAGTGCCGTGCACATGCACAT GTACGACCACTTATTCAGAACCTAATGAGGTAGTTTTAACTGCAAACGTA CATGCCAGTACAGATGTATGTGCATACATACGTGCATACACACTTGCTAT TCCAGTCAGTCGTTGAATAGAGCCCAGAAAACGGCAAAATAGCTAAATAG CCCTGCCAGAGAATTAAAATGAGCCCCTTGCCTTGTGTCTACTTTCAAAT CCCCACCTGAATCGCCCCGGAATCTGGACACAGGCCACTGAACGAAGAGG ATAACGAATCAAGATGGAAGACGGTCACTCGAAAACCGTCGAACAGTCCC TCAACTTCTTCGGAACGGACCCCGAGCGCGGCTTAACCCTCGACCAGATC AAGGCTAACCAGAAGAAATACGGACCCAATGGTGAGAGTCGCGCGTAATT CCCCTCCACATTCCGAGACCGAATCGACTGACGTGTTTGTTTTCTTATCG TTACAGAGTTGCCGACTGAGGAAGGTGCGAACACAACCCGAGCAGATCCC CTGCCCCCCACCCCCACTTCACTGTATGCATACATTATAATAACGATTGT ATTCCACAGGAAAGAGCATCTGGCAGCTGGTCTTGGAGCAGTTCGACGAT CTGCTGGTGAAGATTCTGCTGTTGGCAGCCATCATCTCATTTGTAAGTGC AGCAGCACAAAGAAACCCACCCTCAAAAACTTAGTTACGACCACACTCTT CCCCTCTGCAATCCCCAGGTTCTCGCCCTGTTTGAGGAACACGAGGAAAC GTTCACTGCATTTGTAGAGCCCCTAGTTATTTTACTTATCCTGATAGCCA ACGCCGTGGTGGGAGTATGGCAGGAGCGTAACGCCGAGTCGGCCATTGAG GCCCTCAAGGAGTACGAGCCTGAGATGGGCAAGGTGGTGCGCCAGGACAA GTCCGGCATCCAGAAGGTGCGCGCGAAAGAGATCGTGCCCGGTGACCTGG TTGAGGTGTCTGTCGGTGACAAGATCCCTGCCGATATCCGTATCACCCAC ATCTACTCGACCACCCTTAGGATCGATCAGTCCATCCTCACCGGTGAGTC GGTCTCCGTCATCAAGCACACCGATGCCATCCCCGATCCCCGCGCCGTCA ACCAGGACAAGAAGAACATCCTGTTCTCCGGCACCAACGTCGCAGCCGGC AAGGCCCGTGGCGTCGTCATCGGCACTGGCCTGAGCACCGCCATCGGCAA GATCCGTACTGAGATGTCCGAGACCGAGGAGATCAAGACCCCCCTGCAGC AGAAACTGGACGAGTTCGGTGAGCAGCTGTCCAAGGTCATTTCCGTCATT TGCGTTGCCGTGTGGGCCATCAACATCGGCCACTTCAACGACCCCGCTCA CGGAGGCTCCTGGATCAAGGGTGCCATCTACTACTTCAAGATCGCCGTCG CTCTGGCTGTGGCTGCCATCCCCGAGGGTCTGCCCGCCGTCATCACCACC TGTCTGGCTCTGGGCACCCGCCGCATGGCCAAGAAGAATGCCATCGTCCG CTCCCTGCCCTCCGTGGAGACCCTGGGCTGCACATCTGTCATCTGCTCTG ATAAGACCGGCACACTCACCACCAACCAAATGTCCGTTTCCCGCATGTTC ATCTTCGACAAGGTTGAAGGCAACGACAGCAGCTTCCTCGAATTCGAGAT GACCGGCTCCACCTACGAGCCCATCGGCGAGGTCTTCCTCAACGGTCAGC GCATCAAGGCTGCTGACTACGATACCCTGCAGGAACTGTCCACCATCTGC ATCATGTGCAACGACTCCGCCATTGATTACAATGAGTTCAAGCAGGCCTT CGAGAAGGTCGGCGAAGCCACTGAGACCGCCCTGATTGTGCTGGCTGAGA AACTGAACAGCTTCAGCGTGAACAAGTCTGGCCTGGACCGCCGCTCGGCT GCCATCGCCTGCCGCGGTGAGATCGAAACCAAGTGGAAGAAGGAATTCAC CCTGGAGTTCTCTCGCGATCGTAAATCCATGTCCTCGTACTGCACCCCCC TGAAGGCTTCCCGCCTGGGCACTGGCCCCAAGTTGTTCGTGAAGGGCGCC CCCGAGGGTGTTCTAGAGCGTTGCACACACGCCCGCGTTGGCACCACCAA GGTTCCTCTGACCTCGGCCCTGAAGGCCAAGATCCTCGCCCTGACCGGCC AGTACGGTACTGGACGCGACACCCTTCGCTGCCTGGCTCTGGCCGTTGCC GATAGCCCCATGAAGCCCGACGAGATGGATCTGGGCGACTCCACCAAGTT CTACCAGTATGAGGTTAACCTGACCTTCGTCGGTGTTGTGGGCATGTTGG ATCCCCCCCGTAAGGAAGTTTTCGATTCCATTGTCCGCTGCCGTGCCGCC GGTATTCGTGTTATTGTGATCACCGGCGACAACAAGGCCACTGCCGAGGC TATCTGCCGCAGAATCGGTGTATTCGCCGAGGATGAGGACACCACTGGCA AGTCCTACTCGGGTCGTGAATTCGACGACCTTTCCCCCACCGAACAAAAG GCTGCCGTCGCCCGCTCCCGCCTCTTCTCCCGCGTGGAGCCCCAGCACAA GTCCAAGATTGTTGAGTTCCTGCAGAGCATGAACGAAATCTCCGCTATGA CTGGTGATGGTGTGAACGACGCCCCCGCCCTGAAGAAGGCTGAGATCGGT ATTGCCATGGGCTCTGGTACCGCCGTCGCCAAGTCTGCCGCCGAAATGGT GCTGGCTGACGACAACTTCTCCTCCATCGTGTCTGCCGTTGAAGAAGGTC GCGCTATCTACAACAACATGAAACAGTTCATCCGCTACCTCATCTCTTCG AACATTGGTGAGGTCGTCTCCATCTTCCTTACTGCTGCCCTTGGCCTGCC CGAGGCTCTGATTCCCGTCCAGCTGCTCTGGGTTAACTTGGTACGTCTTG ATGGGGTATTTACTACTTAAAATGGTTAGTAATAGGTACTTGGTCACAGG TTACTGATGGTCTCCCAGCCACCGCTCTGGGCTTCAACCCCCCTGATCTG GATATCATGGAGAAGCCCCCCAGGAAGGCCGATGAGGGTCTCATTTCCGG ATGGTTGTTCTTCCGGTGGGTTACTCAAAAAGCACACATCCTTTAATCGG TATTAACTTGGCCTCAATCGAACTTTTAGTTACATGGCTATTGGATTCTA TGTCGGCGCTGCCACCGTCGGTGCCGCCGCCTGGTGGTTCGTGTTCTCTG ATGAGGGACCCAAACTGTCCTACTGGCAGCTGACCCACCATCTGTCCTGC TTGGGCGGTGGCGACGAGTTCAAGGGCGTTGACTGCAAGATCTTCAGCGA CCCCCATGCGATGACCATGGCTCTGTCCGTGCTGGTGACAATCGAAATGT TGAACGCAATGAACAGGTGAGTGAGATAACGAATGATGGACGGCACGATA GATACGAACCGATCGCCTTTGTTTAAACAGCTTGTCCGAGAACCAGTCGC TGATTACCATGCCCCCATGGTGCAACCTGTGGCTGATTGGATCAATGGCA CTCTCCTTCACTCTTCACTTTGTTATTCTTTACGTCGATGTCCTCTCCGT AAGTATTTGGCAATGATAAGCCCTTCTGCGCCGCGGAAACTAATGCCAGT ATCGTTTTACCCACAGACCGTCTTCCAAGTGACACCGTTGTCTGCAGAAG AATGGATAACTGTGATGAAATTCTCAATTCCTGTAGTTTTATTAGATGAG ACATTGAAGTTTGTTGCTAGAAAAATCGCAGATGGTGAGAGTCCTATATA TAAGATGCATGGGATTGTGTTAATGTGGGCTGTCTTCTTTGGCCTGCTGT ACGCTATGATGCTTTAAGAATATAATTATAATCCATAAGCCCAACTTCAT TATTCTAATTTCTAGTATAAAATGTTACTAAATATAAACAGAAACAAGAA CCCACAATTATATACATCTAACGTAACGACTTTAACCCCATGAAGTTTGT TCCCAACTGCAACTACTGATTTCCACCCGGTGTCACAGAATTGACTGGTG GCACCAAAAGATGGGCCGACTGACTCGCTCCTGGCTTTTGGCTTTGAACA AACAGCGTTAAATGATCAATATTTTCTATGAGCTAACGATTTATCTAACA CGCGTATACCCTACCCTATAGATATCTGTGTTTGTATATTACTATATTAA ATTTAGCAGGATTGCTTTTTGTACATACAATGCTCTATATACATAAGAAA GTTCCACACCGGCACATTCGAATGCATTAGTTAGTTTTCGTCATTTAATT TCACCGGGTTGCCAAAAGAACCGTGTAGGGAAATCCAAGTCTCTGGAAAT GAGATGTCTGTTTGTATTGAACCAAACTTTTGTAACTTAACCATTTCGTT TCTGTGTTTAGTAACTGGAATACTAAAGTGTAGGCTTAACTATGCAGAAG AACAAAATTTTTGTTTAATCCCATTAAGTAGAACCCACAATACCCATAAC CTTTCCAAGTCGAATCTGTGCGTTGATGTTTAAACGATTCCACCAAGCGA GCGTCCTAATGTTTCAAGAGTATCGTCCTATCCCTGGGCTTGTTTAACGT AATTGAATCCATTGAATCCCCCACGAGTATTTACCGAATGCAAATATTGG TTCGTTCATTCCATTACTGTAAGAATTTTATTGAGCACAAGATATTAAGT AGATAATGACTCCCCAGATCTGGGCGTGGCGCCGCAACAGCGTCTCGGTG TCCATTTCCGTCTCCATTCGTATTGTATTGTATGTACATGTATGAGCAAA TGATTAGGATCGGGTACATAAATGGCGATCGTACATAATGGATAAGGCAT GCAGCCGAATAGCCTAGCCTAGCCTAGCCGTATAGAAAATAGAAAATATT GGGGACCTTTTGATGAAAGAACATGTGTAACTTATCTTATGTCAGTCTCA AGTCTCAGTTGTAAGGAGTTAAGTAATCCTTCTATCATTCTATAGAATAC CTACTTAAATTAACATTATACATAATTTACTCTGTTATACAATTAGAGAC GCTGTGAATTGATTAAACAAAAAATTACCTACACCTAACATTAAAGAAAT AAATTATGCAGAACTAAAACGTGCTGGCTCTACGAAACCGGACGACTGGG ATCCACGAGGCCCAAGTTGCCAACGCTTATGTTCGCTGCTCCCCGTTTCT ATTCCTATTTCTAAGTTACGTTTGCTTGCACGATGCACGTGACCCGTTGG TACACCTGAATCCTCCTTGGCCGACGACCTATTCGTACCCAACTGCCCAC CTACAAAGCAACCTACCTACCATCTCTCAATGAACTATTGTTTTATTTTA TACAGTCAACCCCAGATTTCATTAACTGGACCCCGATTAGTTACCATAAC ACAAATTGAATCCATCCCTGCTTTAGAAAAGTACGTGCAGTTATTATATT ATGTCCGGGTGCGACATGTCGATGTGAATGTAGAAAAGAACAATTGCTGT ACATTATGGTCTAGTACATTGCCATCGCACTCGCCGGCATAACCGAGAAA ACACAGATTTGAAATTCAGCATGTAAGATATCTAAACGTAAACGAAACAA TAAAACAAGAAATCCGAACCCGGCCTGTGTACTCTACTCTACTCAATTCA ATTTCTCCCGCCCCGCCTCCAATCCAAGTAGAGAATCAAGCACACTCAAA CATCTCCCCCAAGAAACTCCAAACCACTAGGCTGTAAGTACGATCCCCCA CCGATGCTGCCAAATTCCAGAATTTCGGAAGATGCCGCTTAACTGGTACC CAGTGCCACTCCATCGCCATTTCCCCCACGAGTTTTGGTTTGCTCTTGCG TTGGTTAATCCCTCCCTCCGATCGAGAATCGCCACGTAATAATCCGTATT CGCCCCGAAATTGTAGTTCCTGATGTCGTCGTCGACAGGATGTAGAGGTT TGGACCACCAAAGCCGATACGAATGTGAAAGTGAATGTGAAGGAGGACGA GTTTTCCTGCCTTTATCATTCGTGTATTAATCGCTAAGCCAGCCCTGTTA CTTGCAACTGCAACATTAAATCCAACATAAATCAATTTATTTGCCTTAGA AAGTAAAATATTAATGGAACTGTGGGTTAGTAAGAACGGATTTAAATAAA TATATACCAAATATATAAATTAGAACGGCCCTGTTTCATTTTCCTTTATC TGTTGGAATGGGTTTATTCAATAAATTAGATCAGTCTGAACTATTCTGCG GAAGTACAATATCGACAACGAATTTAAAGCCGCCACTGGACCGGAACATT GGACCACGGAGCTACGAGGGCGGCAGCGCCCAGAGGGTGGCCGTCTTGTC CGCCGACGTGGAGATGAAGGAGAACTCGGTCGGATGCCATCGGATGGTGA TGGCCTTGTCCTTGTGCTCCGCCACCACCACGGAGGACAGCTCGTGGGCC AGGTCGCCTTGCAGGTCCGTCAGCCGGATCGAGTTGTCGTAGCTGCACGT CAGCATGTAGTAGGCGGATGGGGAGAATCGGACGCACCTTTGGGGAAGTG AAAGCCAATTTTACCAAATGCCAAGCGGGAGAGGATAGCTCTACTACCTT ATTTCAGCGGTGTGCGGATAGAAGCGCTGAATGGGCCGGTTGCCACGGAT GTCGTACAGAGTACAGGAGCTGTCAGCGTGCCCAGAGACTAGCAGCCTGC CGGTGGGATCTACACAGACCGCGGTTACAGCGGAGCTCTCCAGACCACCA TCCTTTCGATCGTTATCCAGCGTATTCACAGAGACATTCACTCGCAGATC CCAGAAACGTATCGTTTGATCCTGAAAGAGATCATCGCATATGGTTATAG CTGGGACAGGCTGGGAAGGATCTTCCCCCGACTCACCTGCGATCCCGACA CGAACATCGCGTTGTTCCAGCTGTAGAGGGACAGGATGTGGCCAGTATGA CCACTGTAGGCCTGGAAGGGAGTGCCGGTTCCGCAGTCTGTGATGTAGAT CTTGCAGTCCCCGGCGCCGCCGCTCGCCAGCAGCCGGGACTTGGTGGACG AGTCGTCCAGGAAGCACATGTCCCGCACCGTGCCGTCGTGCATGTTCAGC TCCATCTCGTGTCCCACCAGCTGGTTGGTGTCGTTGTTGAAGCGCATGTA CTTGATGGTCTTGTCGTTCGATCCGGTGGCAATTAGCTCCCCATCCCGTG ACCAGCAGGTGCAGTATATGGAGCCCCGATGGTGTTTCGTGCGCTTGCAG AGAACGGACGGGGGATACACCGCTGCCTGGTGTCCATGTCTGCATGGGAT TGGGATGGGAAACGAGTTGAAGGCAAAGACGAGTTGCGACACACTGCGAT TTAATTACCTCAGCTTGGACAGCGCGGGGTACTGGCAGATGCGGAAGGTC TTGGAGTTGGAGCCCACCGCGTACAACTTTCCATTCGGATGAAAGTCGAC GCTCCGGATCGCCTGCGAGTCGGACAGTGTGGTAACCGCCTCGAAGTGCG GCCTCTCGACATCGCCCTGTGGCAGAGAAAATGGTCAATCAATGAATGGG GTACATGTCACTCGGATCAACCCAGATGCATATGTTTAGATTCTTTTGTT AGCTGGATACCGAAAGTTGCTTGCGTGTTCAAAATAAACAGAGCCACCTT CGATGGCAGGCCAGCACTCGCACCTTTCTCAAATCCAGGTCCCTCGATTC CGGATTCATGAATGGTGTATTTTCCGAGGATCTATACAGTTTTTCACACT TATTTCGAGTATTTTCTGGAGCTTGGATCGTTTCTGTTTCGACCACACAG TTTCTAAGCCATCCGAGGTAATAGAACGTACAACTCGCCACGGTTGAAAT AACAAAAGTGGGGAGAAACCATCGAGTAGCAGTGTTGGTCAATCTGCCAG ATGCATCTGATTTTACGTCGCGATTGTAGAAAGACAGGTAAAGTATCTTG CAAACGCTGTTTACTCCGTTTCCAAGCGACGCGGCCAGGGTATGTGTGTA GATGTAGACCAAATGATAAACGCCTTCGGTTCTTATTGTTACAATTTTTT GATATTTTATTTACGTAAAAATAAAATATTTGGACATATGATTGAATATA ACAAATTAATAACCTTCTTTAAAAATTTGATTGATTCTTAAACTTGTCTA GTGTTGCGAACTCTTATAAAACTGAGCGATTAATGCTCTTAAGAGTAAAT TGTTATAACTTCTCGGCCTCCTCCGCGAACCATTAACACTTTTTCAAGGC CCTCTGTTAATACCTCCAGAAATTCCATATCTACGGATTGGATATAAACG GGTTAGTTTGTGCCTCAGATACATTCCCCTTTCAGATCTTACAATTTCTT TCACGCTCCGCTCTCACTTCCCTAGGTGGTCCAGGTAGATTCATTATGAC CAACTGGGCGTCCTGTGACTTTTCTACAATAACCTCGTTTAGTTTTATTG CTGTGTGCATGCGACGAACGTTGAACTCATCCCTGTGGAAAGAAATATAA GGACAATTAGGACACCGTAAAGTGGGCCATAAGAGAGCTGTTCCATACGG TTTCACACTGGACTTGAAGTCTCCGTCGGCTTTCTCTGTCGATTCATCCT TGTTAGAAGTAGTTTCGGGTGTGTCCGCGTTCTCGGGACCATCCAAATCA ATTGAGTTACGTTTCTCGTCGTTTTGAGAATCCTGCAGAATTACAATTAG TCACATTATCAGATCTTTAGCGTGGCATTAGCCTTGAGTTTTGGATGACA AGTGCCGTCGACATTAAAAACTCAAAAGTTCATTTCAAATCAACCATGTT AAGAAGCCAAAATATCAGTTAGAACAAAACTCAAGATAACTCGGGAATGG ATTTCGATTGCTACTGTTGATTATGCTTCAAAACTAAAATGTTTCAGGCT TACATTTGATGAGTCGTCGATCTCACTTAACTTTACTTATGTCATATGTG TATTTCGAGAGATAAGAGACAATGGTAAATAAAAATCTTAAGGCAGTACA TACGTGATGCTGTGTTTCTTCTATAGTTGGATCGGCGAAGCGAACTTTAG ACGCCGTTTTGGTGGCGTCATAATGGTGGTCTACAATTGTTTGAACCTGA AAATGTCACCATGAGGAGTATGAGAAAAGGTTGCGGAAAAGTGGGAGGCC AATATCAGAGGAGGGAGTAACTATTCTCGGGATGCAAACCGCAAAGCAGG AAACTCTATTTCAACTTTATTTCCCTATTGGTAGTTGAACTTATAGATGG GATCCAAAGTCCCAATGCTTTAAATTAAAATAAAGAATTTGATTGTAAAG ATTACCGACAATTCTTAAGTACACTTGTTATTCGATATTTAAACTTTTAT TAAATTTGAAAAACTCAATCAATTAAAGGAATATTAAAGTTAATCATTCC TGGGGAATGAAGAACCATATAAGACTATTTTTTAGATTATTGTAGAAAAA GACATTACTCAGAAGTACTCGGTGTTGAGAATAATTTGATAGAGTTATTA TTGATAGAAGGGTGAGCATTAGCAACATCACATTGACACAACATATAAGG ATTATGATAGGTATGGAGATGAAAGGAGCAGTTGCTCCCGCCGAGAAATG CACTGATGAGATACACACAACCAGGTTTCATACAAAGTTCGGGCAATGAA TAGTTTGTATCTTGATATATCGATATATGTAGGCAATCTGTTTATACTCT TTACCAAAGACATTTTATTATCACTGGGTGTTTCCTTATAGTCCATTATA GTCTGAACCTTTTGATTTTCAAATATATAAAGTGTAAAGCTTTAATTTGG ATCTCAGATAGAGGTATGGTATGGAAATTAGAGTTCATGAGAAACAAAGG GCAAATGGTTTCCTCTTAACAATTACTGAAATCAAAATACGCAACCTTCA AATCGAACGCATACAATAACTATGCTAATAAAGATTTAAGTAAATGAAAG GCTAATGTGCATTATGGCCGTATAAACAAAACAAGAATGAGCTGAATGAT GGATGTTCTTCAGTTCGCAGAAGTACAGATGACGTGGGTGAGAGTCGCTT CGGATATGGACCACTTACCACTTTGGAGTTTTCTTTCTTATTTAAGCCTA ATGCTCTCAGCATCTGATTACGCTGTTCCATCATCAGGGTCCGCTCGTAG GTATAAGCGGAAATATCGCTGTTGTTCTGCAGTTCGCAAATATAAAATGG TCAATAGGTTTAAGGTTTAGGTCCTGGCAGCTATATCATACCATCTCAAC AACTTCAACATCGGCCTCGATTCGAAGATGGTAGAGGAATGTCTTTAGAT CCTTCTTCATTTGAATCGAGTTGTCCTCGATTTGAGCAACTGTGAAGATC CTTAGCTTGCAATTGCGCCAGGTGCGATGTTGCTTCAGCAGGAAGGGCAG CAACATGAGCAGACCACCGTCGTGGACAATCCACCAGATATCAATGTTAC CACCGATCTGAAGAGGGAGAAGGATTTGTTACTCAAAGAAAACTTGGCAT TCGGAGCGGTAAATACTACTTTGTGGTTTGATTCTGGATAGAAGTTGATG CCCTTGGGCACCATGAGGGCCATGTGGCAGGCGGCCACCGTGCGGACCGT TTGGATGAAGGTCTTCCAGCTGTTCCTGCCCTCCTGTCGCCAGCTGTACG GCCATCCGATGATGACTGTGTTGGGCTTCATGCCCCCCAGTCCGATGGTT TGGATGCTGTGTTGAGAATTCAGTTATTAGTGGCCTCTAATATCCCTCCT CAATGACTTAGCCAACTTACACTGAGCTGAGGCCCTCGCCAATCTGCTGG GCTACCAGGACATCACAGAAGCCCTTCACCTTCTCGTCGGTCATGTACTT GCGCAGCGTGGCCTTCGCATCCACGGCTTTGTTAGTGATCTTAGTGTGGT CGCCCTTTATCACAGACACACAAATCGTCAATCCCTTGCCAGCTTTCAGC TGGGTGGCAAAGGAGAATATCTTCCTGTATTTTGGCAAGAGGTTGTCGTT GAGCTTCGAAAGCACCAAAATTTGGGGACGCCAATTTTTCGTATGCGGTG GGCCTTCCTCCAGACGGAGTAGCGAGTACCTGGCGGCGGTCAGGGCCATT CCACGAATGCCATCACCCCACTCCTTCTCAGCACTGT