##gff-version 3 ##date Fri May 24 03:39:39 CEST 2024 ## exported from the transgeneomics system molecule_59020408 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59020408 mpicbg region 9631 34929 . + . Name=dmel-5.43-3R;type=genome;start=1251469;end=1276767;strand=- molecule_59020408 mpicbg region 34930 35884 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2436;strand=+ molecule_59020408 mpicbg region 35885 35991 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3813;end=3919;strand=+ molecule_59020408 mpicbg region 35992 49500 . + . Name=dmel-5.43-3R;type=genome;start=1237960;end=1251468;strand=- molecule_59020408 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59020408 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59020408 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59020408 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59020408 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59020408 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59020408 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59020408 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59020408 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59020408 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59020408 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59020408 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59020408 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59020408 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59020408 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59020408 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59020408 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59020408 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59020408 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59020408 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59020408 coding_transcript gene 33419 36369 . + . Name=CG12147;ensembl=FBgn0037325;identifier=FBgn0037325;alias=CKIa-like;id=51191255 molecule_59020408 coding_transcript mrna 33419 36369 . + . parent=51191255;Name=FBtr0078793;id=51191261 molecule_59020408 coding_transcript exon 33419 36369 . + . parent=51191261 molecule_59020408 coding_transcript five_prime_utr 33419 33498 . + . parent=51191261 molecule_59020408 coding_transcript cds 33499 35994 . + . parent=51191261 molecule_59020408 CLC cds 34930 34989 . + . Name=2xTY1 molecule_59020408 CLC cds 34996 35712 . + . Name=SGFP molecule_59020408 CLC cds 35719 35760 . + . Name=V5 molecule_59020408 CLC cds 35761 35784 . + . Name=Precision cut site molecule_59020408 CLC cds 35785 35805 . + . Name=TEV molecule_59020408 CLC cds 35806 35877 . + . Name=BLRP molecule_59020408 CLC misc_recomb 35885 35918 . + . Name=FRT molecule_59020408 coding_transcript three_prime_utr 35995 36369 . + . parent=51191261 ##FASTA >molecule_59020408 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACCTATACCGTGGGGTTAGTTT ATTTCCCAAGCGATTGTTTTGTTTTACCATGACGGTTTCTCCCACCTCAA AGGTTCTGTCTCGTCTTGTTACATTTTCTCTTCTTAGCTGTTTTTCCTGA GCTTCGTTAACCATTTCTACTATCTCGTTAGCCAATTCGGGAGGAGTTGA ATGAATAATGTCGATCGGTCTTCTATTGGTGACTGAGTGCACCGTCTTAT TGTATTCTATTGTTGCCTGAAGAATAAGGTTGACTGTATCATTCATTCCA CTGTCAAGTTTCAGGCATCGAGCTATTTCTAAAAGCGTGCTGTGAAACCT TTCAACCTGTCCGTTTGAGGTACTATGAAGTGGAGGTGCGTTCGCTATGT CAACATTAAAACGATTTTTCAAAAGTGACTTGATTGACTCGGAATTTATG GACGGTTCATTGTCACAAAATATTGTCTTTGAATGGGGAAAAAAGTTCAT TAGTTGCATAATTGCAGGTTCTAAATCAGTTATCGTTCGAGAGCCGATTG GTTGCACAATAGCGAATTTGGAAAATTTGTCAATACATGTCAAAAAGTAA TTCCTGTCCGTAGAAAATATATCAATATGCAATGTCTCGCCTACATGTGA CGGAATAGGTGTTCTCCCGAGGATTTGCTTTTGCGGATGGCGGTCGTATT TGGCTTTTTGACAAACCAAGCAGTTAGAAACAAAGGTAGCGGCTATTTGT GACATTTTAGGGAAAAAGTAGTATTGAAGAATTTGTTTTACATTCTCCTG TGCTGCCCTATGCGCTCTGTTGTGCTCCAAAGACACTATTTCCCGTTGCT CAGTTTGATTAAAAATGTCGCTGACCATTTTCATAGTGTGTCGGAAGGTT GTTGCTGGAAAGTCATTTACAAGACTGTTTTGAATGAAAGCTAGTACAGG TAATTCGCAGTGTATCGCATTCACTACATCCGGCTTAACCACATCACGAA TTCTTCCGATTAAGGTCTCTTTGTCTAGAAACTGTATTAGATGCCTTGTC TTGCTTCCGAAAATAACAAAAGTTCGAGTTGAGTCTGCGGTGCCCTCATC TATCACAATTTGGTTTCTAAAACAGTTAACCGGCTTGTCGATAGTTTCGA TTGTAAAAGTCAATGAAATTTCGCTATGTATTGTTGCAATGTCTGACTGG GGTTCGTCCTCTAGGACATGAATAGCCTGCCTGGATAGTGCATCGGCAAC ATAGTTCTCCTTGCCAGGTTTATAGAAAATTTTAGCATTATGTTCGTCTA TAAACGCCTTCCATCTCTTGATTTTTGCATTTGGATTCCTATCTGACACG GCGTATGTTAACGGCTGGTGATCTGTAAAAATGTTTAAGTTTTTGACACC ATATAGATAGTTCCTAAGAGACTTTAAAGCCCAAACGATGGCCAAAAGTT CTCGTTCATTTGTTGCGAAATTAAGTTCTCTATCCTGTAAAGTTCTCGAA ATCATTGTAACAGGCTTGCCATCCTGTGATAAGACTGCCCCCAGGCCAAA AGCCGAAGCGTCTGTTGTTAAGTCAAAGGCTTTTCTATAATCGGGATACA ATAACATTACATTTTCGGAGACAAGAACATTTTTAAGCTTCTCAAAAGCA GAACATTGTCTTTCATCGAAAGAAATTGGTATCTTTTTAGACTGGCTTGC GGAAACCTTTCCGTTTTCACCCTTCAGAATGTCAGTGAGTGGTCTAGCAA TAGAGGCGAAGTCCTTAATAAAGCAGCGGTAATAACTTGCTAGCCCTAAA AACGATCGAACACTAAACAGATTAGTAGGTTGATTATATTTCTGAATAGC CTCTACTTTGCTAGGACTGGTTGTGATACCTCCACTTGACACCATGAATC CGAGATACTCGACGCTTTCCTTGAAGAAAAACGATTTCTCTTTAGAAACC CTCATGTTTGCCCCAGACAGTCTGTCTAGTACCCAAGCAACGTCGTTTAC GTGGTCCTCAATTCCGTTTGAAAATATTATTACGTCATCAACGTAAACGT AACATGACTTTCCTATACGGTCCCTAAGAACATCATCAATAGCACGTTGA AAAATACTTGGGGCATTTTTCAAGCCAAACGGCAAACGGCAAAACTCGTA TTTTCCATTTCCTACTGAAAAGGCAGTTTTCTCTCTATCCTTTTCTGCGA GCAGAATTTGGTGAAACCCCGATTTAAGGTCAAGGGTTGTAAAGAATCTG GCTTTTCCCAAATTTGACAAGATGGATACTACGTTTGGTATAGGGTACTT GTCGTCGATTGTTTTTAAATTTAGTTTTCTAAAATCTATAACCAACCTTT TCTTAGTATTTCCCTCTTCATCTGTACCTTTTTTATCGACTACCCAAACC GGATTGTTGTAAGGTGACGACGAGGGCCTGATAATTCCGTCCTTTAACAA AGCATGTGTCTCCTTATTCACAAAATCCGATACGCCCATGGGGTACGGAT AGAGTTTTGAGTAAATGGGTTGGTCGTCCTCAGTACGTATTGTGGCAACA ATGTTGGTATTATACGGCAGTGCTTCTTCCGGTTCCGCAAAGACGGCCAA TCGGTTTCGAAGCATTGTATGGAATTTATTAGATATCTGATTTGGAACCA CAATATTCTCTATGTTGGTGAAATTTACGCTGTCACATCTCAAAAACTGA ATAGATTCCACTTCATTGTTGATATTCAACGTTTTGTTCTTAAAATCTAA CGTTGCATTTCCCTGTTTCAAAAGGTCAAGTCCTATTATTGCGTCAAAAC TAGAGAGACTTGGAAGAATAAAGAATTGAACAGATGTGTTAAATAGCTTA ATAAAGCATTTCTGTTTGACGGTGTTGCAACCATGAAGCGATTTTACCGT GAATTTATTTTGTACCGGCATTATGTTTTTTAATTCAGGGAGGGGCTGTA TGTAATTTTTCGAAGCCCCGGTGTCAATCAAAAGTTTTATGGTTCTCCCT GCTATCTCTCTTTCTATGTACGGTAGCAGGGATTTGTGGCTAAAAAATGA ACATGATCGTAATTCACTAGTTCGTCCTCATAATCATCAACCTCCGCTTC TGCCTCCTTTTGATAACCGTCTGTATCTTCCTCACATTGACCTTTCTCAT GAGGTAAGTAGTTGATCCTCTGCTGTTTTGGCCCTGTAAACCTTGCACTG CCACTCGTTGGTCTTTTTGATGCTTGCGCATACCCAAAATGTCCCTGAGC CTGACTTGTGTTTTGCTGTTGGGGTTGCGATGCGAATTGATTTTGTGTTC GAAATGAATTTTGTTGTTGGGATGGCCAAGAATATTGTTGTTGAGATGGC CAAGAATTTTGCTGTTGGGATGGCCAAATATTTCCCTGAGTCGGAAATGG AGTTTGTCCAAAATTTCCAGTTCTTCTAGATCGCATGGATACATCAGGAT TTGTTAACTGGACTGGATCTTGTCTTTCCTGGTTATCATAAGTATGCACC TGACGCTTGCTAAAATATGGGTTTTTAGTTTGCATGGGCATGATTGAGTT TCTATCCTTATCGCTGTGCCTTTGTTCGATTTTCTGACCCCTTTTTAGAA TAAATAAGGGCGAATTGGTAACGCTCATGGTTCGACTCGACCTCTTGCGC TAAAGCGAGAGCAGTTGGTAAATCTTTTGGACCTTTTGCAAAAAGAATGT CGCTCAACGATTTCTTAGCTCCGGTTACAAATACACGTAACGCGTCCGTC CTGTACTTTTCATTCAGTGACATCGCCAAGGCACTATCAAATGTCATTAT TGTCTTGTTGGTAAGTAGGGTCAGTTTTTTCTCGACTTCATCGTAGAATT CAGTAAGAGTCATGTCTCCCTGTCGCAAAGTTGATAGCTCTTGTTCGATT AGATAGATCGGCCTTTTGTCAGAATATGTGAAATCAAGACGGCTGATCAT TGCTTTGAAATGTAACGGAGTATTAAAAGAAGCCAATACTGTATTCGCTG GACCTTTTATTTTATTTCGCATAATACCAAGAGCTTGGTAAAATGTTGAA CTTCCCTCGTAATCTTTGAAAACTTTAAAAGCGACATGAGCCGCTTTTCT CCACGACACATATGTTTCACTTTTGCCATCAAAATCTGGCAGAGATTTAA TTATATCTAGAGGCTCGCTACAGACAACACCTGGTCTAATTTCAGCATCT ACATAAGTTTCCACCTCTGGGGTGTTCACTGTTAATTTCCCGATTCGCTC ATTCATCTCCTGCAATTGCTTTTCAAATGATTGTTTTTGGACTGCGAGCG CACCGGCAACAGCACTCTCTACGATCGCTTTTAACTGAGCTTCAAATTCC ATTTCGCTAGTTGTCTTTGTTTTTGACCACCAATTATCTGATGACTTATT ATTTTTTTCTGCACTGTTTTGCCTACTTGCCTGGTGCGCTGACCATTTAT TTAAGCTTGACACTAGGTTGTCTAAAAGGTTATCACTGTCACTCATGTAT TTTTATTATCAATACTCTTTGCATAGGTTATAATATAATAATAATAATAA TATTTTTAATTCGTTCAATAAGCGTTATACTTACAATATAATAATAGTGA TTAACAAACAATTTTAAGGTAGATGGTCTTAGTAATTAATATTATATTTT ATGTAATCACGAAATTTTTATTTCTTAGGTTAGAGTTAATTAGCCAAAGC CGCTGGTTTTGTCTCCGGATCCTCCTTTTGTTATTTATTTATAATTATTC AGTTATCGTAGGTTTTTATATCCGTTTGGGCGCCAATTATCATTTTAGTA GATTTTCCATATATTTATTAGCGTAAGTTTATTAATTACAATAGGGCTTG CGCGGTCTGCACTTAATGAGACGAATAGTAAGTACGTGGCGATGACCGAC GCTTCTAATCTTCCAAAATCGACTAACTTAAGTATAGCAAGAGTTCTTAT CTCTAAAGCTTAACAAGTTACAGTTTCTTATAGGTAAAGCTCGATCTATA GATGGGAAAAGCACTTGAGGCTTACGACTATATTTCGGGTGTTTTGTGAT CGTGTTAACTTACACTCGCATAAAAATATCTAGAATTCATATAATCTATG GTTTTTGCATGTAATATAGATAGTTGAAAAAACGAAATTGCGGCTCAAGA TAAATAGCTTTGCTAATAAACATTAATTGGTAATATCTTATCTTTAATCC TTATATCCTGCATATCTGAATTTAAGAAAATCTCTTTAATAAATCTTAAA GTGATGCTCGAAAGTGATGTTTTGATTCTAGTCACTAGAATCGAGAGTTT CACGAGGCAGGTTAAAGTCGAGCTGTAACAACGTCGTTAGTAGCGCCATC GATGTTTTCGAGGGTATCAAACATCAAAATTGTAAAAACCATATATATAA ACCATGATTTCCTAATAGGCTCATAAACAGTCAGCGTGCCACGGACTATA TATTAACTATAATATCGTGCTCTATAATTTGTCAAGTGTGATTTACTTTC TGGGAGGTTTACCCCCCCACCACTAATTCCCATACGCCTGTTAGCCCTCT TCCCCAGATTGTCATATGAAGTGTGGCTCTGAGCAGCGATGGGAACAATG ACCAACCAAATGGCCTCCACTTCACACAGCCACAGAGAGCCAGAAACAGA AGCAGGAAAAAAAACACCTGTTCTCCCCGTGGCACTGGTGAATATGAGCG AAAATCCGTTGGAAAATAAATGCTGTTTGTACAAGTGGAAACCATTAAGG TGGACTTTGAGTTATGACTGCCAGGCAGTGCACTTGACGATGAAAAATTC CGCACAATAAACAGGCGACAGCGAAGTGAAGGCTCCCAGCCTGCTCCCAA TCCTGGCCAGAAAAACCCCTGTTGGCCCGCTTTTAGACAACAGTCAGCCA TTTGGTCAGCACAATGGATGAACAACAAAGAGTGTAACAAAAAGGGGGGC AAAAAGCTCTGCTCGAAAACAAATTCACGCCAAAATGGACATGAATAAGT TGAAAAGCATCGAGGGGCGGCATGGGCGGGATGGTCGGTGAACTGTCGAA AAGGGGGCGGTATGGTTCGCTCAGCACGTAGTTAATACGAGTATGACAAT GGATGCGGTTGGCTGGCTGCCCGACGCTCGCTTGTCAACTCTTTTGCTCC GCTTGCCATTTCGATTCCTCCTCCTCATCCTCATCCGCCTCCCCGTGCTC ATCCACGAATCTGGCGGAACTGGAGGGAATGGGTATCCATGGCGTTGCCA CAGCATCCTCCCCGGGCCATATCCTTCGGCGACTTTGTCAGCCGAGCACA CACTTGGCCCAGTTCTCGATTTGCTAGATCAACGACTGGCCCAAATGTAT TCAACCGCGGAACAAAGCAAAGTGATGGCTTAACCGATATACAATACATA GGTACATATACAGAATAACAAGCAATATTAACTGGATCGATATCATATGT AGAGTTCAATTCCACTAGGATTTAGATACATTTAAGTACATGTAATTAAA GATTACATTGATTTCCAACACAGATTTCTGCACAATCAAAGAATCATACT TAAATAATAGCCAGCTTAAGTTTTGATTTCTATTTAGTGCACTATTTCAA TGAGCTGCTCTTCAAAGACACTATACTCTTTAGCAATCCCAAAGAAATCC TCTTTTTACTCGGCATCTCGTGCTTTGCATATTTTAGAAGGCCCGAGGAA GGAAGCCAAACAGCAACTGGCCTTGTTAGGAGTGTGTTCCATAAATATTT TATGATAGTTAAACGTGGCAGACCGATGAACAAAAACTGGTGGTACGAGG ACGTCCTGGTAGTGATATGTAAGACAGTGTGATATCATTTTGCCCATTTT CGTTGTCCGTTTGCTATTTGTGGCGTGGCAAAACTACACCCTAATTGTCT TAGTCCTCATGGAACCGACCAAAAAGAAAGTCACAAGTATAAACTGGAAG ACGGGGCAACCCAACCTTGGGGATATTTTAAATGGCCAACTGCAATTGTT AGATAAACGGACGAAAATATTTACATAGTGCCAGCCTTTATGGCCACCCA TAATTTGGTAATATTATTGTTCAGGGCTAATTTGGCCACAAAGTAGTTAA CAATTGATAATATGCAGATATCGTCGTAACGATGCACCTGAATACCCTCT GTTGGCTATTATTATAAATTATTCAGCCTATCACTTTAATGTGAAAATAC AGGGGGACTTTGATATGGTCAACGGCGCCTCTTGGTTTTGCAATATTTTT GCAAAAAAGAGCGTGAAAGGTTGAAAGCCTGTTGAGTCATAGAAAACCAT CTAGTTGCGCCAGCAACTAAATTTAAAAAGTTTGAAGATGACCTGGTTGC TTGGCCGAAAATCTGCAACCACTCTGGAAAATAAAGTCCGTTTATACAAA GCTATACTAAAGCCCGTGTGGACTTATGGCATACAGCTCTGGGGTACTGC CGGCACCTCAAATATTGAGATTATACAACGCTACCAATCAAAAATATTAA GACAAATTGTTAATGCACCATTTTATATTTCAAATGCAAGTCTCCATAAA GACTTAGGAATCCCTTATGTTAAAGAAGAAATAGCAAAACATAGTAAAAA ATATATAGACAGAGTAAGAACACATGAAAATAACTTAGCCGTAAGTTTGG TAAATAATAATAACAACGTCAGAGGACTTAAAAAATTTCACGTGCTAGAT CTCCCTGACAGGTATTAAGTTTTAAAACATGTTATGCATAGAGCATGTAG AAGGGATTAATGGATCACTACTGCCTCTTTTAATTTAAGATTAATTATAA AATTTACTTATTGTCATACTTTTTTTAAGACAGATTGTAAATAAAAAAGA GAAAGAAAAAAATATAATAAATAAAAAGATAAACACTGCATGCTGGATTG AGAGCTTTAGATTAACGTTCTAACAGATAATTTAAAGTATTAGAGTATCC TTTAAACTGCTTCATTTTAACATCGATACTAAATAAATAAAATGTAAAAA ATGAAATCGCATATTCAGACTTAAAAGTTGTTTAGGTTGTTTAGCATATC CTTCATGCCTGAAATAATATGGAAAATCCGGAGCATAGACCAACTTAAAC CCACAAGATGATTCATTTCCTGTTGTGGTTGCTTCATTTTGCTTTATTTT ATAGTCCAAATATCTTGTTCCCTTTAGTTTTTGAAAATGATTAAGCGCCG AATGGTACGATTTTCGTTGAGCCCACTTTGATAGAGCCACTTATGATAGA GCCCACTTATCCAGCATAGGCGGAATATCATTCTTATAGTAAACTTCTAT ATTATCCTCCAAACTTGTTAGAACTTATTTTTCCTTTCCGATACGCCTCT TTTAATTTCTCACAAAAAGTATAAAAACTCCTCTAACTAAAATGTGGTTG TAAACTGTTTTGATTGTAACGAAGGTGCTGAAGGTGCGAGCTCGAGTCTA GACTACGCTGACAGCAGGCTGAGTCAGAAGAAAACATCCTCGCAGAAGGA CTAAAATTATCCTCGAGTTAATATTTCCAGAAGGCGAGGAAAGGCGCAGG ATTGCAGCTGGTGTGGGCTGTGGGGCAATTTAGATTATTTAGCAATTTAT TATGGCCTTGGGAAGCATTTTCTAATCAGCAGCATGAAATTTACCGGAAA ATTACATAAAAATATAGTTTGTACATATTTTTAGAAAACGCCTCACCACA GTCACCCTGTGACAGTGGAGAAACTTTTAACTGAATTATGGAATGTTGGA AATTGCGGCAAGGGCTGTGGCTGGGAGGATGGATTTATGGCAGATCCGGG GCAGCCAGGTGGCAGGTGCTAACTCACCTGGGGAGGAACGTCCAGTACCA TCAGCTCACGTATGCAGGTGTCGCAGACCAGACAGTTTTTGTAGATCTTG CGATGAGTTGTCGTCTGATGAGTCCTGGGAAAGTCATGGTAGAAAAATTG CTGAAAGCAAGCACGAAAGAGCGGAGTCAGTAAGGTGATATTAATATTAA ATTATATAAATACTGAACATGAAATATTAAAATAATGTTTCCATTGCCAA ATCTTTTGATTCCATAAAAGCACTCTGCCCCAATGGAAAGCAAAATAATA TTTTCTTGCTTTTATGCTTTCTTTGCCGAGCCAACATTTTAAATATGCGC TCCGCGCTTTTGCATGAGGGAGCTTTGTTGAGCTTAGAGAAGTGTAATTA AACAAGGCTTTGGATCGGGCCAGGTTAAGATATTACTTAAATACACATGG AAATAATTACATTTTATTTATTTGTGAGCTGTAGACAATCGTTGTAAACT TATTAAAGGCTACAGAAAGATTATACTTTTTATTTTAGTTTATATACATA TTCACACAAATTGAATTTACACAAATTCACGGAATGCCCAACTATCGCTT TAATTTGTGTATATATTTAGAGATACTTAATGCTGACTGTAGCCAGCTTT TCTGAGCCTCAGTAAGGAGCCATAACTCTAATCCAAAGCCCATAACGCAC ACGCGCGACTATTTTGGATTTCGCTTGGCGCCGTTGTGGTAACGACCCTC TTGACCCGGGGCCTTTTCTTTTACAAACAAAGTAAGGGATACTGGGCCTT TACTTTGGGATTCGAAATAAAGCCAAGGCCATCGGACACATAAGAAACAG TTTGTAAAAAGACGTTTGATAATGAACTGCAACGGCCGGTTGGATGTGGA TGCGGGACTCGCAATGGGTATCAATGCATGAGCAGGATGAGTGGCAGGCT CAAAGGATATTTAACGTCTGATTGCACCCTAAAGTGCTGCCTTGCCGCTT CAAGAAATCATGGAATAGATTGAAGTTCATAGGTTTCTTGAAAACCATCG AATGATCAACTTATGAAATGTGTTTCTCAGTACTCCTGCTCACAGGATGT CTTGGGAGCAAGAGGGAGCGATCTCCGCTCGCTCGTCTAATAAAAATGCA AATATTCTTCTGCCAATCAGCGCACCCATTGTTGTCGCTGCAATGAAATC AGATGCAATTTATGCACACTATATTCAATTAAGGCCACCAAAAAGGAAGC GGCAAGGCAGCAAAGTAGCAAAGTAGGAAGGCCACCGGAAGCGGAAGTGG CCGCGTTGAGAGAAAGAGAGCAAAGATGCCAACGCTGGCTGGCCTACAAG GGAATTACTTTGGCGCACTCTTTTTCAAATCACATGCTGCACAGACACAG GCTCTTCCCCACACTGAACGTGTGGGCGGGGGGCGTGAGAAAGGGGTCAG ACATCGATTCGTATCGCGTCGCTTTTATGTGTCAACGCCGCATACCATTG AGTTTTATTTTTATTGAACTGGTAATTGAATAAGAAATGACATTGATGGT CGGCTGGCTCCGTGGTCTCCAGGTCCCGTTTCCATGTCCCAGTTTTGAGC TCCGTGCCTCGTGCTCCGTGCTTCATGCACCTCGCCCCAAACTGCTGAGG TCGTTGGGGCCTCGTAGCTTTGCGCCTCTTTATGCTCCTTGCTCTGGCTG CTCCATAAAAAGCGGTACATTATCTGCTCGCCGGGGATCCTAGCTGCTTT TCTAAATGTACCCTAATAGATATTCATGGCGCACGCTTTATTGATATGAT GCACTGCGTTTTATTTCTCACTTTTATCTGCTGGAATTAGCCACCTTTTT TTGAAAATTTGGAAATTTTTTATCTGAAAATTCATGTAACCCAGGGAGAA ACATAAATCCCTGTTCTTTCAAACTCTAAATTAAATATCTAAGTGTATAC AATATAAATAAGCAATAGTGTAATAAGTAATTTGAAAAGTACCGGTAATT TGAAAAGTACCGGAATGTACCGGTTTGCCTTATCTTGTTGTAAAAATTAT GTTATTTCATTTCGCATTTCTGTTATTACGCGACTATTACATTACCGCGT CTATAAACATTTAGGATACCTGGTGTGCGAGATTAACATCTTCTCGCTCC GAAAAGGATTCCCTTGGCCAGCTTGACCGCAAACAGCCATTAAACTGGAC GTAATTGATTTCGCAGTGCTTAAAATGCCATAAAAATGCACAAATCTCGC ATTACAAGCAATAAAAGCCGCCCAACGGGAATCGAGAAAGCAGTTCGACC GCTGGAAAACTGTGGGGGTTTCCTGGGTTTCCTGGGTTTCCTAGGCAAGC GATCCTAAAAGCTAATGCATACACGCTGCTCTCAATCGCATTCGTGGAAA TTAAACGCAGCTATATAGCACACACAAGCACATGCATGGAAAATAATGGA ATAGGGGACCGCGCAGCGGGAAAAGCGGGAAAGCGGAAAGCAAATGGCAA AGCGGCCAACTCGCAACTGCCAACTGCAGTTAATTGAATTTGGCAAGCGA GAGGTGAAAAGCGGGGGCGTGGAGGTCGTCAGTGGGCGGAAAATATACCG TTTTCCACAACGAAGCTAATACTCTTTTTACCAACAAAAATTCCATAAGT ATGCCAAAAACTTAGTGGGAATAAGGATACAATTTTTGAAAAGTAAGTAT TTAATATTTTGATTTATGTTGCTATAACCTTTATATTATATATTTATATT TAGTTTCAAGAGAGTATTCTCTGACAGATACTTAAGTGGGAAATTCGAAG TATTCCTAGTTGTTTATTAAAACCAAGTGTTTTTGGGAAGGGTAATCATC GAGGATGTCACTTAGCAAAAGGCAAACAGAATCGAATTTATTTGACTTTG TCTGGGTTAAATTGAAAAACATGTCGAATATTTTCAAATCAATGTTTTAT TTTTTGTTTTGTACATTTAATTAAAATTGTCAGAAGGAAATTTAAATTTT TTGTTTGGTAGCCAAACTATCTTAAAACATTTATTAATCGTAGAATAAAA CAGGTATACAATAAAGAGGGAAGAATAACGATTTTCCGAGCCTATAAAGT ATTTGTATTCTTATTCAGGATCTTTTTTTAGTCCGTATGAATGACGATAT CTCGAAAATTATCGATATATGAAGTAGAAACTGAGATTAGGGCAAATAAA TTTCAAATTTCACTGGCATTCGGTATTGTGTAAATACTACCTTTTGTGTG CTTTTATTTGTTTTAAGGTGAATCAATCAATTTCTACTTGCTACATAACT CGCTTTGCTGCTTACATATATAATTTTTTGTCTCGCATTCTTCAATTAGC TACGTGACGGATAGCTACTAGGTATGGCATTCCACTGTATATTTCTCGCT CGTTAAAAAAAAAAATACTGGGAAAATAAAAAAAATACTTTTTTTGTTTT AACAGAAACTGAATAAATGTTTTAATTTAACAGTACATCAAATAAAGTGT GATGTGACAGTACTTGATTAGTTAAGTCAACAGATAAATTCTAGTAATTT TGACATTTTTTAAAAAGGACCACAAGTTAGTGAACACCATTGCTGATGGA CTCCGCCACAGCAGGCATGCAGGCAGCCGCGGTGAGCACATGTGAGGCAT TCAAGCTCTGTGCCTTGCCATTGTCTAATTACAAAAGATAAACCACAAAA GAAGCGCAAATCAAATTAACGGGGCTCGCACACGCACACAAATGCAATTA GCGGATCGGGAGGGGGAGGAGGTGAGCTGGGAAGGATGCAGGTCCTGGAT GGAGGTGGCTGTGGGACTTATGCATAGTGTAGGTAGATGGTGCGCTAAAC ACCGTCGATGAGGGCCAGCTGTCGTGGGATGGTCTATTAAAAAGTTTGCA TCTAAACTTTTTAGCTTTCAGCTTTCCACGGGGTCACCCGTGGCCCATTA ATAATTTAAGTCCAAGTTGGGGCATCAAAAGTGCAGCGTTTGCATCCTGT GCATGCCCCGCACAACCCTCTCTCTTTAACGTTTTGTGCTCATTGGGGCA ACTTTAATCGGGAATTGTGTTAATTGAAAATGCAATTTATTATGGAGGAA CTGATTAATGCGAGCGGTCAACAAGGACGCCTTCAATGGATCGTTGATTG AATCGGATTGCATACTAACGTTGTAATTGCTTTTAGCACTGAGTCGCACT TAGCAAACATTTAAATTATCATTAACAAATTCCGTATTAATTACATCAGA CGGCTGTCGCAAATGGATTTTATATAATGTGGATATATGTTAGCTCTAGT AACTATTGAGTTAAGGAAAAAACAATAACTTTTGGGTTTTAAATGATGTC AGCTCGCAAATCTTCTTCTAATTGTTAAGAGCAATTACTTTTGTTTCGAG CCTATGATTATCCGACTTACGCACTGCAAGCTTCAAGGCCTTGAGAAGTG TCAAGTGTGAATGCTCTATCTAGCAGTTGAGAGCTATCATTTAGGATTAT CTTTACCCTTATGGAACTTGTACGCTCACAAAGTAGCTTTTTCTTTGTCT GAAGTATATTAACCTCGCCACAGAGACTACATATGTATATGACCGATTCG ATTTTTCAATATTTGTTTGGACTCACCTGTAGTATGCTTGTTTTGCCGAC CCCAGTAGCCCCCAAAAACGCGGCTTTAAGGGGGCCCTGCAGCCATGGCG GCTCCGCACCACCCTCCAGAGTGATGCGCTATGCCGAGATGCACTTGTTC TGTATGTGGAGCTCCATTTCGATTGAGATCTTGGTTGTGGGGGCTGTGGC TGTGGCTTTGGATTTTGATCCTTTGGCTCCTGCGGCTGCTGCTGCTCCTG TTTTGATATTGCCTGCTGCTGTCCTCGCACTATCACCGACATAATCAACG CTTCGTGTGCTTCCGATCAACAGTTTCTTAGAGTTGGTTGGCGATATAGT ACTACTCCACATTATATTGTTGTTGTAATTGCTAATGGTGTTATTGTTAT TCTTCTGCTTAAACGACGCCAGCTTGCCGGATTTATTGGATCTTTTGGGA TGGAAGGACACGTTTTGGGTGGATGCGAAGCCAGCAGGTTTGAAATTATA TTGCGTTTTGTGGTAGTGCTAGATGATTCGTTTGTATTTGCTGAAAGAGC AGAAAATACATAAAATTGGTTAGTATCTATAAACTGATTAAACGATTATT CATTTGACTCCCAACTCTAGCATAGCCATTATCCGCAGGACATCAATTTT AAGTGGAAGAATCGCAGGATGGGTCGTAATATTATAATTTAAGTGGCCTT CTCAAGCTATATGACAGCTACACAGAAATGAAAACAAATCAAAAGCACAA AATAAATTGGAAAAGTGACGGAAAAAATCGCACAATGATTTCGTGGCAAT CAGCTCGAATTCGGCCGACTAAATTTATTGAGTCGCCAGCGGATATTGCA CATTGATTTCAGTTTAATAACGTAAATATTGTTTGGTCCCCAGCCCATTG CCTTCTTCTTTTTTTTTTATATTTTGCGTGTTTCTCCTTGGGGTCTCTTT GCATTGCCAATAATAAATTTCAAATTTCACATTTCACTTCCGCTGCACAA CGGAAGTTGATTTCTGGCTCTCGCTTTTGCAGAGGGCGCCAATTCGTGCT GCCTATTTTTTGGAAAACGAGGATAACGGCAAGTGGGGCGTGAAAAATGT TTTCCAATTCTGTTCTCTGTCCGCAGTATTTTTTTTCGTTTAGGGTGGAC CGTTTGTAAATTACACGAGAACAGATTTATAATTGGAAAAGTTTGGAGTT TTGCGTTTTGCACGCTTGTTAAAGTCAGTTTGAGTACAAAGAAGCCGATC TGCGCTTTTAATCAGTCACAGCATTTTGCGCCTACTCTTAATTAGTTAGA CATCTGCCAACAGCTTCATCCATCATCCATCATCACTCGGAGCAGGGAAA GTTAATAAATTTAATAACCACAAAATATGCCCGCAGCGATGTGTGTGGTG CCAGGGTGCTAAAAATGCCAGACAGCCCCCTAGCCATCGACATCGCATCC TTGTCGTATTTATAGCCCACATCTCCATAAGAATCAGCATCAGGTTCCGT ATCCGTATTCGGATCCGCCTAACGCCCACATCCTTCGTCGGATCCCTTCC AAGTCAGTCACCTTTCCAAAAACCATGCGTCATCGAGGCGACGCCCACAA CTAACCGGAGCCGTATTGTGGATTGTTGTGGGGAGGTTGCCAGGATGCCA GGAGCACGGATGCCGAGCCGGCTGATTTGATTTGATCAGATACGATTGAG AGCGTCTTAAGCAGCGCCCACACTAGCAAATCGTCGCTTAGAAGCGTTTT CGAGGCTGAGCACTGTGAGTCGAATGGTTGATACCCTATGTGCAATTTCG AGTATATTTATATGGATTTAAATTTTCTTAAATTTATATGTACTGTGTCG CACTCAACTGTCAGCATTAGTGAATATGTGCCCTCGTTCAAAGTTATGTA TATGTAATTTAAATGGTTTGCTTTACGATCTTTAATGAAATGGTTATTCT TTTTCAAAAAAATGGACGAAACTTTATCGTGTAAAGTCATGTTGATATCA AAAACAGAGTGGATTTAATAACACGTAATCTTAAATAAATATGGGAGTAA CAGGAGTTCATGTTATTATTATATTCTTAAAGGTTCTTTTTTCGGAGAAT TAAATATGCTAAAATACCATTTCAATGCCTCGAAGGTTGGGCAAAGCGTT GATGGCCTTGGAGGGGCCAGACGAAATCGAGATTCCCTGAACTAGTTGTC TATTTGCATATTCCTCGTGAATAGGAAAGTTATTTTCTCATCGAACCTTC ATTCATGATGGCAGCCCTGCAGGCTAGCACTTTGATTAGATCCTGGAGGC CGGAGTAAATTTAATTTGGAAAACAACACATTGGCCGGGCATGTTATGGC ACTCGGAGCGGAGTGGGTTGCCTTTTGTTTTCGATCTCAAGACCCAATTC ATACGCACCGTGGCCCAGTTGATTGATACGCTCTCGGCGAGCGTCGAAGT ACGTAAACAAGTGCCTTAGGCTGAGGTGGATGTGGATGTGGATGCAAGGC CTACAGGCCGAGGTGAGTGGGCGTGGCATGGCCCGGAGACTCAAATCCTG GAAATTGAAAACTTTCCACTTTTTGGCAAGACTCCAAGGCTCTTCATCCT CAGTCGCGGTTACGAAGCCAGACAATTGTAGCCCAGTTATTGTGTATATA TTTGAGCTGTGTGTAATGTAATGCTTTTAGCCTTCCTCCCACTCGAAAAT TTCCTGCGGTCTTCGTGCCGACAGGCTCTCGCAACCTGTTCGCCCCGAGT TTTCCGACTCTTCCGATTCCGAGTCCGAGTTCGACTTCCGACCATTTGAG GCAGTCCGCCCCGGCGTTGTTTTAAGCCCCACCTCGTCTTTTGTGCACAG AGCTTTTTATTCGACGTGCCACTAAAATTTTATAGGTTTATTTATTGTTT GCAGAGCTACTTGCTACAGTTGTTTCTCGACCAGCTTTTCTCCTTCCCCC TTAAATGCACTGAATCAAGAGATAACGGCAGGAAATCAATTACAAATTCT AGCCAATTTAAAGACGGCCTTTTAGTCTCTGCCGTCCCCTGGTTGGGTAA AACGAATAATAAAATTAAAGACAGAAAACGGTCCAGAAAAGGGGACTGCG AAAGGAACTACCCTTGGATCCCTCTCCTCCAACTAGTTGGGGCAACATCC TGCAGCATTCGACATTAAAGAACGGAACCTTCAGAAAACGGGGGCCACCA AGGACGTGTATATCTGCATATAAGGATGTGTCCTGTCGACAGGCGGAAAT GAAATGCAGGTAGCGAATGACAGCTCTTGGCGGATATTGATTTTGGTGTG TGTTCGCGAACTAGAAACATTTTCCCACATTTCGGCACACAAAAATGCGA GACTAAGCTGCACGTTGGATATTATTTGCAATCGAGGAGCTCAGCATTTT GGAGGCTTTCATCTTTTTTACAAGACAGCTGTACCTCTAATTGGTGCTAC AGTCTGCCATCCGAAAAGGGACACTAATGGATTGCCACCCCTTTCATAAT TAAAAGCATGGGTTTCGCTCCTGCCATTGGTTACGTAATCCATTCAGAAA CTAGCTAAACAAAGCAATTTGCGCCCTAAGCTCCGACATTAATTCAAATT ATGACGAGAATAAAGCAAAGCAGGTCGTTTAATCAAAACGCTTAAGTGAA TCTTCAGGAAAGGACGCTGGAGATGGGCCCAAAGCGATGACTCGACTGCC TGGAAAGGCACTACGTTTTATATCATTTGCATTTTAAGTACGGCGCTCCA ATCCCGCGTCCTTTATCACGTTCCATCCTGGCAGCTAAACGCAAGTTTCA GTGCGTATTTCATACAAGCTAATTTTTTTACGATTATATGCGCTTAATAA ACGCCATCGCCCGCGGAGCTGCGATGAGGGATGCCAAGGAATCTGAGCCC GGAGACTCAGCATCTGGGTCCCATCCTCGTCCCCATCCGCATCCTTGATC CCCCGTCACGTGCTGTGCTGACTGCTTAACGTGGGCAACATCTAAGCCAG CGCAGCGGAAACGATGGCAGCGCCATCATCACCAACACCACCACCACAGC GCACAGCGCAGCGGAAGTTCATTCACACACACGCACACACATGCATACAT GCATACATGATAGGGGCAAGAAAGGCAGATAGTGGAAGCTTCGATGGACT AGGATTTCTCCTTTGTTAAGTGTGTCCACACGGGCTAACAGGGATTCCCC GACTCGAATTCCAATGAGATCATGTCGCACATCAATAAGAACAAGTTGAA ACTATAAACGATGGTTTTTAGTATTTTAAAGTATTTATGTATTATTTAGA AATCTAATCCGCAGATTGAAACCTAGGAAAGGTTTCATCATTTACCCTTG GTCAAAAGGACTCATCCAATCTAATCAGTAAGGGGTGCTATAATATTTTA AAATCTAACTAAACGAAATATTGAACTAATGTTACTTATCGAATAATTAC GAATTAACTGAATATGAGTATGTAGTTTTTTTTACATGTTTCTTGCTCCC TTACTGTTGTTTTATAGCGTCCAGAATAGTAATATCCTTTTGCTGTGAAA CAAGAAAATTAGTTAGGTAGGATAGTTTGCATGAGCACGACTTCCTCTGT GATAGCTGCAAGATCAATTTACACCCTTTAAACATATAATGTATACTTTC TTTTTAGTTGCATTTCCCCTTCTAAGCAGATGTTTCGTAATCAGCGTGTA AGTTCCTTCTAAATATCAACTACTTAAGTGTCTTTGTATAGCAGATGTCT GAGAGACCTACCCTTCTACCCTGATTTCCTGCTCATTGTCATTTATGGCG TAAACATGGTGTGCACTTTCTGTGCCTCATTGTGGATCCGTATTCGTCCC TGCCTCAGTTGAACACTCAGGCAGTGTCAATGTGTTTGGATTTTGCTGAT TACGGCTGCACGTGTAATAAAAGCTCTTAGCATTCGAATCTACATATTTG CCCGTCGGTTTGGCTGTGTGGCAACTAAAGTTTTCCGCCGTTTGACTGCC TTTGCATACATTTATCCTGGCGTCCTTGTCAGGTGGCTCCTGTCGCCGTA AGAGCGCGTTTTGAGTGTTCGGCAAATATGCGAGTGCTTCGCAGGGCTTA CCGCAGTGGAGAAGTATCCACCTCCACCCCACAATGCCACACCCATCTTG GGCTCTTCTCGGATTCATCCTACTCCCTGCCTCATTTCGGTTAGCTTCCA GTTGGCTTGGTGGGGGATTGTGAGCACTGTCCGATTCGGACTCAACATTC GTTCGAAGTGCACCGCCAAATGGATTCGTATTCGGTTTACTTTACCACCT CCTCCACTTGATCTTGGTGCGGGCAAAAGTTTTTCAATATTTCAAGAGAT TCCGTGTTTTATAACCCCGCCTGAACCCCTCCTTCTTCGCCAGCTGTAGC TTTATATAATTGAGTGGAAGGAAGCAGCTTTAACCGCACGAGTTAACCGT GAAGAGGCGATGGGGATGGAGAGGATTTCGAGTGGAAGCCTTTCGATCCG GCATCTCAAGGTTAAGATACGATAAAATATCTCCTCTTGTTGCTGTTCGC CAAGAACGGGAATCATATTTAATTATGCATTTCCCTTTCGAAGCATAATT ATTGAGAGAAAGGCATTGAAATGTATGAAAAATACTTTAATATATCAACG CAAGCAGCCTTTTTTAAGAATTTAATTTAACTGAAATCTATTACTTTACT TTAGCATTCAAGTTGGCCACTTCTCTATTCTGAATCAGAAGTAAACGTTG TCAATGAGCAAGTAATAACTTCTATGATCCAATCAAGCATAACTATGTTA CCTGACTTTTCCCTAGAAACTGCGAATTATAATCCCAAACGACCATACAA ACGACACGATGGCAGTCCGTCCATGTTGAAGTAACCGTAAGGATCCAGGA ACAGCTTTTGCGGATCATAAACCCCGTTCCCCGCTGCGAACCAACTGTGG ATGGTCCCAAGGGATGGCGACAAGTGGGCACATGTGGACAGACGTGAGAC CCGAATGAAAGGCCCAATTCTCGCCTTGGACACGCACCGGGAAAATCAAT GGGAAGGTGCGCTGGTGACCGGGTGAGGGGAGTCAGAAGTGCGGGGTCGG ACGAAGCCAGCAGAGAATTTCCAAGTTGATGAGCCGGATTCATTTCGGTT GCGTGCCAAAGTCAACGGAAGGTGCGAATTGGGGATGTCACACATCTGCA GATGGGATCGCGTGGGTGGCTGAACTTTGCAGTCCGGCCGCAAAATGGGG GGCGACAGGAAGCAATCCGAAACATACAGTTGACATGGAGGACATCATTA GCAGGAGCAAAGGCAGCTGTCACTTAGGTCGGAAATTACGCATATCCTTT GATAAATTGTAGCGGAAAGCGAAATAATGAACTCCTTGCAAAGTTTGCGA CAAACTATATAAACACTTGACGATTGTGGGTTGTGTACACCGGAATGGCA AACTTTGGTGCACAGTAGGTGAGCGTATCCTTATATGGCCTTTGCAAGGA CGTAATTGGGTCAGTGCAGGTGGCAGAACTCAGACTCCTACTCACACAGA TATTCCTCGGGATTAGCCTAGCCGATGTGGGTTAGACGCAAGCAAGCAGG CTTGGGCTAATGTCATCAAATGACGTGTCACTCAATCGGAAAAGCCGAGG AAACCCGATATCCTGGCTCACATCTTTGCCCTGATAAGCGACGATATAAG GACGCGAATAAGCTTATGCAAAATTAAATCATTAAAATGCGAGTCAGAAG AAATTTTCTTAAACTGTTTTGCGCACGAGTTGATGCCAAGTCACACATGC CAATGCAAACCGCTCCCACACACAAACTCACACAGATACACACAGAAACG CCCAATGTCCTTAAACACACACACGCGTGCTTGTGCCTAAGTAGATATTT CATCGGATTTTCACAGCAGCTGAGATAAAAAAGCGGCGAACAACGCAGCG AGTCGGGGAAAAACCCACGGACAGCAACAAATTTAAAACGTTTTAGCTTC GAGGAGGAGTTGGGCGCTGGCAGGTTCTCCTCGATAATGGCTGGGGTCAT GTTTTGACCTGGTTGACATGAAAGCGGCATGCAGGAGCAGGGAAAACATC GCCAGTCACATGTGTAAGAGCGTGAGGCATTAAAATTAAAGGTAACCACA GAGGAGAGAGGAAAATGCTTTGATCAACCAGGAAGTACAAAAGTCGGAAC AGCCTCGAAAGAATTGGGTATATACGCATATGTATGTACCAGGAATAGCA TAGGATACATAGAAACTCAAGTGTGTAATATCAAAACATCAATTAATCGC TGTCCTGTAAAAATCAATTATCCTTGGTGAAACTATATTTTTCCGCAACA TGTGTTGTGGTGGCACTTGGACATATTCATAAAGGGACATCGAACCGAAG CTTATAACCGAAGCGATAAACGTCTGTTTTTGGGCTCAGCTACGTTCTGA GATGTGTTTAACTTAAAGGCCCCGTTGCCGTCACATCTCATGCCCTCCCA CGCTAGAGTACTTCTTCCGTTGAACTTGGGGAGCAAGTGAGCGTACGTGC TCCATACGGCTCCATCAGCCCAGACATCTCAAAGCCACGACTAGGCAGTT GAGAAATTAAATTCTAGTTACGTCCCTGGAATTTAAAAATAGCAAACAAT CGGCGAATGGGTAGAAGGGATGGGTAGTTGGCTTTTGGGTTGAGAAGTGG GTGGAAGCGGGTGAGGATTGGAGGCTGAAGGAAGCTTGGATGCGGTTGTT GAACGTGTTCAAATTGGCGAAACGCGTCGAAATTATGTTAATGTTGTATG TTCGTGTCCCGAAGGCGGCCAACAAATTGAATATGTATTTAAGCTTTAAT GTTGGGTGGCAGGAGCGGGTGGCTGTCGGGAACGCGTCATTGTTTAATCT ATAATTTGGCATCTATATCTTTATTGTGCGCCGGCAGAGAGGTGAAAAGA GTTGAGTCCTGACAATTTGGCATCACTTGGTTTGCCTTTGTCATTCCTAC GTTTTTTATGCCTTCCCCAATGTTTGATGTATGTATATACATATATATTC CGTGGAGGAGGACTGCTTAACAATTCCTGTTCATCTCTCTGTCACTTTTA ATGAGTTCTTGTGCAAGAATTTTCGTTCCCTCGCTGGAACTTTGGAACGT TGGCAACAATGTCGTCGAAATTGTCGCCGCCCATGATAATCAGGCGAACG CCCTTCAAAGTGGGCGTGGTCGTGGCCATGACGCATTGCCACCATGATTA TAATTTCCATTAAGGCAATTTTTTAGGGCTGCAGTAGAAGATGAGATGAG CTGGTGGCGCCGAGCAAGTCATTTTGAACCAATTTGCATTGCAAGCAGTT AGTGCGAAAAGTGAAGCTCATTGGAGAAGAAGATGTATGGCAATAGGCCG TACATTTAATACTTAAGATTTGAGTGAGAGAAGTGAGGGAAATATTTATT CAATATTTAAGATATTTATAGATGTATTTGGGATTGCGGGCAACGTTCAT TGTTGACGAATCGATCTAGAAACTTGTCAAAACATTTAAAACGACGCCTA AGCGTATGTACATAAATCAAGGCAGCAGCCAAAACCTAAGACGTCACATC ACGCATACGCCATGTGACCACAAGCTACAGATGGGCGGCAAACGAGCGTG TATGTAAATGATTTAGCTGTCCGAAAAGTTTTGAGGCTTGAACTGAACAC AGTTAAAAAATTTGGCAACGAACTGGCGAAAACTAAACTGGAATATGCGA AGCATGTGCAGACAATTTGGTCATAACCTTTGACAGGCCATCCAAAAGGA TTGTGGGGGCGTGGCCAAGGTAGGGATAACTTTTGAAAGGACCTATGTAT TCAACCGAAAAACGAGACGTTGATGGGACACTCTCCAGTAAACAACAAGA TGTGATAAATACCGAAAAGTGCGCAGTCACTTTAAATGGCTAATCATTCC CAGCTCCATGATGAATGTGGGGAAATGGGTAAAGTGAAGGGGTGTGGTGT GGATTGGATAGTTTAAGCTCATCGTTTCATTGCTGCTAGCTGCTGAGGCA GTATTTTAATTAAATTTAATGCGCCATAAGCTCTAAATAAATGCCACTTC TTCGTCCTAGAGCCTCCATAAAAGGAGCATTATTGCATGCGAGTGGAAGA TCCGTGTGGGTGGCTCCCGATGATGGTAGGAGACCTCCATGTACATATAG TCGGGACTAACGCGACTTTGTGGGCAATATTCCATCCCCTCGTTCTGCTC TTTTGCCGCGCATAAATAAGGGATTATGGATGGATCCACGCATTTAGTTC TCGGAATTGTCACTGCTCCAAGCCGCAAGCCCCAGAAGAACGTTCCCCCC GAAAACTGTGCAAGTCAGATTGACATTAATTTATATATTAGTAGATTATA CAATAAAACGGGTAGATAATTCAGGATATGTCAACGGACTTTATGTATGG TTCCAGATATTTTAGATACCTTTCAGATAAAATAAAACGATGTCAAACAA TTTTCAGCTGAATGTGGCTTCATTACGTTCAGTACAAATAAACTGATTTT GCATAGCATTTATGTAAATGACAACTGTGCCTAGTTCGCAAAACAATTTT GCCATTTCAACTCTGCATTATCCGTCGTTTTCAATTCACATATTGCTGGC TAAACATTTTTGGATCGCTTCCAGCGCAATCTGGGCACAGGCAATTTAAT TATGAATATTTATAATAGGTTTGTCCATAAATCTAATCAAGTGGGAAACA TTTTCGTAACTCCAAAGTGTGGCATTTGATACAAGATAATAGCGTGCGTT TAAAAGCCATGAAAGAAGCAGATCGGATAAATGATAGTTTGACACGGCTC GAATTCTCTTAATTGAAAGTGCAATTTGCAGAGCACAGCTGTCAGCTATT TCCGGTCGAAGTTTAAGCCAGATAGTCTAGAAATTCGAGTGACTGACATC CTCACAATGAATTCGCATACGATGCGAATATCTGAGGTGAATGCGAGGGT GAGAGAGCCAGCCAGGTTCGAGTAAATTAATCCACTTCCGTGGGTAAATC CACACAACATGATGTACATACATATATACATATGTGAAGAATATCGATTC GACAGTCATGTGGACACATAACTCTGCCAGCTCAGTACGGTTAATTGAAA ATGAAGTGCAAAAGTTTCTTAAGCAGCCAAACAAATGATAAAAGCCAACT GGAAAGAGGGAAAACTTGCTGAAAAAACAATTTCAATTGATGACAATGAA GATTGGTCGTAATGTCAAATGGGTTCCATATGATGGGTAAATAAAAGTGC GGAGCTGTTTTCCACTTTATTTTATAAGTGGACTACTACTATGGGGCTAC TTTTTTTCTTTCTATTTTATGAACTATGATCGATGAACTCAGAAAATTCA ATCATACTCCACATCATACTTATCGAAGGTGGCAACAATAGATCGCCAGA AACATCAACTTCCTGCCTGCGTAGAAGTCTGGCAAGCTCCCGAATCGCAT GGCGGAACGGGAAAAGGGGCGTGCCAAGGACGACAGACGTTGGCAAGGCC GTTCCGATGTTCACCAATCCAAGCCGCAGATCCGAAAGGAGCGCCGCCAT CCGCCACAGCCAAATCATCCTCATGAGAAGGACCAGCGACAAGATCGTCG GTTCTCAGAGGAGAAGCAATCCCTACCGGAAATTATAGTGGCGGGAAAGT ACCGTTTATTGAAGCGTATTGGAAACGGATCCTTCGGCGAACTATTCCAG GCCGAGGGCCTCAAGTACCACGAGAAGGTGGCCATAAAGCTGGAGAGCTC CACGGTCAAGCACCCATTGCTGCCACGCGAGGCCAGGATCTATGGCATCC TGCAGGGCGGACTGGGCATCCCGCATGTGAAGCACTATGCCACCGAGGGG GCGTACAATGTCATGGTGATGGACCTCCTGGGGCCCACGCTGGAGGATCT GCTAAACCTCTGCTCGCGCTCCTTTAGCATGAAGACCACCCTGATGCTGG CCGACCAGATCCTTGCCCGCGTGGAGCTGCTCCACCGGAGATGCTTTATC CACCGGGACATCAAGCCGGACAACTTCCTGATGGGCCTGAACCGCCACCA GACTCAGGTGTACATGATTGACTTCGGACTGGCCAAAAAGTTCTACAGCC TGCGCACCCAGAAGCACATCGGCTACACGGAGAACCGGGACCTGGTAGGT ACGGCCCGGTACGCCAGTGTGCGGGCCCATTACGCGGAGCAGAGTCGTCG GGATGACCTAGAGTCCGTGGGCTACCTGCTGCTCTACTTCCAGCGGGGTC GTCTTCCCTGGCAGGGAATCCGGGCGCAGTCGCAGGCCCAGAAGTACGAG AAGATAGCTGAGTACAAGGCCAACATCCCACTCCAGCAACTCTGCTCCGG ATTGCCTGTCGAGTTCTTCATGTATCTGAAGTACTGCCGCAAGCTGCACT TCGCCGAGAAGCCGGATTACGTGTATCTGCAGCAGCTGTTCAAGGTGCTC TTCCGGAACCAGTACAAGGTGTGTGACTTCCTCTTCGACTGGGTCGTTTT GAAGCGAGAGTCGCCGGAGCAACAATCGCAGCAAAAGGGTAGGGAAAGGG ACAGGGGTGGAAAAAGGAACGTGGTGGTGCAGAAGGAGAGGCATCGAAAC AAGGATAGGGATAGTGATACGCAGAGGTGTCGAATTAAGAATGGGGGAGA TCTGCTCGAGATCGAGGAAAATGAAAGTACCACTGGGGAAGACCCAAACG AAGATAAGCCTCAAAAAAAGCATGGCAAGGCCTGCTCCTGCAGCTACCAC CTCCAGAAGAAGCGCCTCCAGGATCGGGATAGGAGGGCGCCTCTGATGAC CGAGCGGAGGATCCTTTCGGGGGAGCAGGAGCAGGAGCTGGAGCTGGAGC TGCGGGGGTCCCCTCAGATGCCCTGTCTTGAAGTGCATACCAATCAGGAC CCGCTGGACGAGGTTCACACAAACCAAGATCCACTTGATGAATTCATGGT GTCCAAGGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGTGGAGC TGGATGGCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGGGCGAG GGCGACGCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGG CAAGCTGCCCGTGCCCTGGCCCACCCTGGTGACCACCCTGACCTACGGCG TGCAGTGCTTCAGCCGCTACCCCGATCACATGAAGCAGCACGATTTCTTC AAGAGCGCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGCTTCAA GGATGACGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGATA CCCTGGTGAACCGCATCGAGCTGAAGGGCATCGATTTCAAGGAGGATGGC AACATCCTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAACGTGTA CATCACCGCCGATAAGCAGAAGAACGGCATCAAGGCCAACTTCAAGATCC GCCACAATGTGGAGGATGGCTCCGTGCAGCTGGCCGATCACTACCAGCAG AACACCCCCATCGGCGACGGCCCAGTGCTGCTGCCCGATAACCACTACCT GAGCACCCAGAGCGTGCTGTCCAAGGACCCCAACGAGAAGCGCGATCACA TGGTGCTGCTGGAGTTCGTGACCGCCGCCGGCATCACCCTGGGCATGGAT GAGCTGTACAAGCTCGAGGGCAAGCCCATCCCCAACCCCCTGCTGGGCCT GGATAGCACCCTGGAGGTGCTGTTCCAGGGCCCCGAGAACCTGTACTTCC AGGGCATGGCCAGCAGCCTGCGCCAGATCCTGGATAGCCAGAAGATGGAG TGGCGCAGCAACGCCGGCGGCAGCGGATCCTCGGGAAGTTCCTATTCTCT AGAAAGTATAGGAACTTCGTCGACAGATTATAAAGACCACGATGGAGACT ATAAAGATCATGACATTGACTACAAGGATGACGACGACAAGTGATATTAC GCTGTTTGTAAATGTCTCGCGTGTTAATTACCTGCCGAGCAACTATATTT AGCATGACTTAACCATTTACCCAGCTCAGTTCCTTTGTTCGAAAAATCAA CGTCTTGGGTAATCGGGAAAGCTCTTGGGCGCCCTCAGAAGTCAACTGGC AGCCTCGCCAACAATGGGACCAACTTTGCGGGGCGTCCCACACGGTGAAA TCGATACCGTGGAAACTTGGGGGATATAAAGGATAATGGAGGCAATGTGG GACTATTCTACCAACATATCCTACACTAAAATAAGAAATGCATTTTTATA CAAAATTTAAAAAGTCGTAACAAAAGTTTACCAAGTAGTTTTTGCAATAA AATAGTTTATGAACAATATAATTTAAGTTTAATTTGTTTTACTGTATCCC TAAGTTTGCCCAACTAAAAGACTATAACCCTTTCTCTAGCTTTTCCTTGG CTGGCACCATTTGCTGTAGAGAATGAAAAAGTAGCCCGGAAAGTGTAACA CACACATACACTTTCGATAGCTTGGATATTAATAAGGGGGTTAATTATTG GCCCAGCCAGGACGCGTTACGAGATTCCTGACACGACTTCAGGATGTGTG GCTGGGGCGGAAGGAGATGGCTAGCACCCGAGGACATATAAATGACTCCA CCAGTGGCTTGGAAGGAAATAGGGTAGTAGTTTGCTCAGTCGCGCAGCAA TAATGCGGACTCACGGGTCTAAGATATCCTAGCAGTCCGCAAGAACACAC AGGCCAACTATTTTCTGTCCCAAAGAGCTTTGGCCCAAACACCGAAACCG GCGGCAATGGCGACTTTAGGCTGGGCGTGAGGGTGCATAAATCTATAAAT AACTCCCCTCGCCGGGTAATCCACTGAGCGAAAATCTAGGAATCATATTT AATGCCTAACAAGACAGGGGATCAATTTAAGCTGACAGAAACTAAAACTA AACTAATTAATTGTAATTGTATTGCAATCTTCTAATAATAGAAAATATGG ATTTTTTCACTTTAATGATCGTGCCAATTGAAAAAAATTACTATGTGAGA ATGTAAAACCTGAAAAATGTTATATATCTAATTATAATTATCCCTTAATT ACATTCAACTAGGATATATATTAATTATATATCAACGAGCGAGTACAATT TATGCCCACTTAAAACCACCTTCTCAGCAGCTTTTCATTTAAAGTGCTTC TCTAAAAAAATAGTCTACGCTTTCTCCCTGCAGACGGGTTTTCCCGTGTA CGCAGCGCAGACGCTGCCACGCCCATTTAACATCCCAAGTTCTGCGATTC GAGGAAACTGCCTCCTTGGGACTTCCACCCACGAAATACTCTGGGTAACT TTCCAAAGAAGTTGAATGCATGCCTAATGTCGAAATCCCTACACCACAAA AGAGCACACCCACACCCACACCCACACGCACACTCACACAGCACACGCAC ACTCATGAAAATCCGACCCACGCACTCATTCGCTTTTCCGTTCACGTACA CAACGCGCTGAAGCGTAAAAATATTTGCAAGCTTTGGCTTCGACTTTCTC CTTTCTCCATTCACCATTCTCTTTGGCCGTCGCATTTCAAATTAAGTTAA TTTTTTTCGTTGAACAAAATGGCTACAAATCTGTGTTTTATTTATAAGTG CCGCTGGCCAAGCGAGCAGACACATTACAGAAGGCAGTGAACTCGGTCAT TCTACGCTGATGGGTCCTCGATGAACTTCGGTGACATTCAAATTGGGCAG TTAACGAAATTGTGCAATTTGTGGGTCAATGGCAAGTGGCGATGGCAATC CGAATATCAAGTGGATGCGAGTGGACATGTGAGTGGGTCCAGCGGTACCA TTATGCTTATGGGTGTCTAATGGGGATAACTGAGACTGTGGCAACGTTGC GTATGAGCAATATTGTCACTTTATGGTGTTGTGCGCTTGATTCTTACATT TTCGAAATTGCTTATATGTACCAATTCAAATTATCAGTAAGTACTAGTAG TACTAGTAGTCTTATTGTTTAAGAAGAACTTTTGATCTATCCTAATGCCT GATACGTTTCGTTTTGTATGAAATTGTGTTTTCAACGAACGCTAAAACTT TACATGCTCACTTTAAATCAATTATGTCTTGCAATTAATTTCAAGAAAGG CCGGCTCATCAAATTAGTCACAAACGATTGCCATTTATAACAATTATTAT TTAATCAGCGTTTCCAATATCTAGCAGCGGATTGCTGCTGGAAAACATTT GTGCCTTGTGGCAAAAGTAAATGAGATGACAGGGTAATTAAAAATTTTGC ATGTGTGGAAAACATTAATTATGCAGATGTGTAATTAAAAAGTATGGTTT CAATAAAGTCTCTTCGCCAGAAATTGAGGTAATTGTGCTATTTTTTAGGA ATTCGATTTTTAATTCTGGGCGCAAATATTCAAAATTAAGCACCAACGTT ATTTTCTTTAAATGGTGTACCGAGTAGGCCAGGAAAATTAAATAAAGTAA AAGTAAAGTAAAGTATTGTCGATAAATAAACAAATAAATTGGCGAAATAA TAAAATAACTTCATATGTAAGAAAAACTAAAAAAAAACTGAATACTTCAC ATAACATAAATATTCGAATCTTTTCAAACTAAAATATATCAGTATATACA ATATATCAAAATATGTTGTTGAGCATTATGTAACAGGTAGCATTACCACC ATTAATGTATATATTTTTGATAAAGGATACTAGCTGAGTCAAGTGGCAAA TGTCCGTCCGTTAAGTTTTGGGCACATATACGGCTGCCGCTAGATGGAGT TCGTGTGCAATCTCGGGTGATATTAATACGAAAACAGAAATTTGAAAACA TCTATAAAAGTAGCATCTCAAATTAAGATAAACTTTTTTCGTTGCAGTTT TCTTATGCTAGTATATTGTTTTTGTTTTTTTTTTTGTGTTTTTGTAGTCA AAATTGACTGGCTAATATACCTATAGCCGACCGAGTACTTTGCCATACAC AGCAGAAGGCTGTTCTGGTGGTCATAAATTATTCAATTGAAAATATGTTA AAAATTCACAGTAAATTATTTACGCCAGGGACCCTGTTCGGTGTACAAGG ATATTTACTCGAACGGCAGAGTGTACCATATACGTTCGTACACTCGAAGG GCCCATTGATAACCTCAGAGGGGCTTCGGCCACATAAATTTAGCCATAAA TTTGCCTTCCCTTACAAACAGATACAAAGGCAGAAAGCACGGTCACACAC TACCCACACACACACACATACGAACTCTCTCAACTCTGGCAACTTTCATT TCATAACTTTGTGGCACTGCTGTCGAGTGCACAGTGGTCAAGAGCATATT TGTTGTCAATTAGAGTTGACATTTTTATTTTGAAGGATACTATGCCATAC TATGCATGAATTGGTAAAGGACAATGGCATCCTTATTGCTTAAGAGCCTT TTAAGAGCCTTTTCATTATACAGGTATATATATTTATAATTTTGAGCACT GTCGTTGCGAATGCGATGTGGCGTGGTCAGCAGCAGATGCCGAGGGAGTG TCCAGATGACGTGCTCCAGCAAATCAGTCAGCATGGCGAATGATTTGCCA TTGCACGAGGCCAGCCACGTCGATAAGCAGACGACACGGCAGGGCACACG TGGCGTATGATTAATGCGTCTGGTGCGCGCTTAATGCTCTTAAGTGCACA TAAATGATTGCAATTTCGCTCGTCCTGTTAATGCATCTAAAATCGCATTA CGTGCAATCGGCATCAGCCATTCAGCCAGAATTGACCAATCGACTCGAGG CAAAGGCAGTTCATATGAATATGTGACCACATTATTGTGTAGTGGTGGAA CTGCAAATCAAAATGGTTTTCCAGAAACAACGAAAATCAGATATTGTAGA ATAAATCAATCACGAAAATCTATCGCATAAGTTATACTAAAGCTTTGCGA AATCAACGAACATTATCCTTGTAGGAAATGCGCATTGAATATTTTGTCAA AGGATTTGGCCACGTCCACCAATCGGAATTTCATTAGTGTCGCTAGTCTA ACGTGATTGGTTGAAATAAGATTTCAGTTTCTGGACGTATATAAATGTGT AAGCAAAGGACTTTTAATATAGATATGAAGCACTTATCAATGAATTATAT ATACATTAATAAATTATGAGTAAATTAGTCGTTTTTGGGAGATTTTACCA GCATTTAAGTGTTAAACTGATTTAAACAATATAGTAGTGGCTAAAAATAG AATGTATTGTGTAGTGTGTAGCATATTTAAAATACATATTCAAGACTCTT AAATAAGAACACAATTAAATAGGTTAATTGGCTGTTCAGCCGAAAGAATT GCCTTGGATAGAATAAGATGTGCTTTTTGAAATAACTTTATTTTAATGAT TAATTGGTTTTTGCCCTATCTGGTATTATTTTAATTTAATAATTTTTCCA ATTTAAACTAAAATCATTGTTTAGTACTAGGAAAGTTCCTTGACAATCAG ATACGCGTTATTTATTTTGTGGAAGAAAATTGTCAGTTTGTTGAAAAAAC TAATATCTGAAGTAAGCAAATACAATACTGTTGGCGTGACTATTTTAGGC GGCTTATGGGCGTTAGAGTGGGCGTGGCAATATTATTAAATCAAGCTTTT CTAGAACCAGCGATTTTAATCAATTGTTCTTACAATTTCCCCGACATCTC GGTGATACTGAAAGCTGGACATACGGACATGGCCATATCAACGAATCTAG TATATAAAAGAGTATAGGAAGAGTATGGCAATTTGTACTTTCCTCCTGGT AGTTAAATAATAAATGGCACTTAGGAAATTTACTAACCTAATTAGCCTTC ACACACCTGCCATTGAGAACTGTGAATATTTTAAATAGAAAATGGGGTGG TTCGACAAGGTCTTCGGTCCGATGAGAAAAACAAACATGAAAAGCAAACA TGCCTCCCTGTTTCCCGCTTACATTTTATTAATTTTGTTGTAGGTGAGAT CCATTTGGGTTTCAAAGAGCTTAACTCAATGAGACAGATTTACTTACCGC ATTCTTACGCCAACCGATTTTATTTGCCCAACTGAACCCAATTTACTGGC ACACTGTATTTTGTGGCCCTAACTTATTAGCTAATTAGTCAAATATTTGC GCTCTAATCGCACAGTTAATATTCATCACTAAATCATCGCATGAGCCCGG TCTAAGTGGCCCAAAATACACAGCGAGCTACCATTTGATTCGCTCAAGCG TCTTTGATTAATGCGCTAATTGAACATTTAGTCGCAAAGGCAAGGCAAAT ATTGATTTTATTGACACATCTATCAGGCTCATCGGCCAACAGCCAACAGC CAACGAGAAACAGGCAAGGGAGAAAGTTTGTGTAAAGTTTTCATGTTGTT GCTGAGCTTGTTTTGTTTTATTTATTATTTTACTCAGCGCCACCGCACAT TTGCTCTTTGACGGAGGACAGCCACATACCGCTTTTCCCACGGAAAAGCC CCAATATGTGTGTGCGTGTGTGTGTGGGTGTTTGCCAAAGCGCTTGGCCA TTAAACCAATTTTCAGGTTAACAAAAAGTGGACAAAAGGGAAATCGTAAA AAAAGCTGGGGAAAAAAAGTGAATTTTTTTCTGAACTTCGCTGAAAAGGG TATCGGGAAACTCGAAAGGAAGTTTGAAAAGTTTGTGCAACTTTGTAGTT TAAAATCCAAAATGATTTGGTCGACTTTTGTGCATTTTACATAAACATTT CAACAAGTTAAGCGAATACAATATCTTTATATATTGTTTGTCAAAACATC ATTTACGTAAATGATATTTTCTTTAAACCATTACGGAAGAAATAAATATG CCAATAATTGCACAAGTAAGAATGCTTATTTTACCCATAAGTTAAAAATA ATGTTGTTTTGATAAGGATGCTCAGTAAAATTAATAGCAAATATAGTAGT TACACTTTGAATGGATTGTGTATATTGAAGGGTATACAGGGTCTCATTTA ATCTAATTTGTTGTCACGTTGGCTAGGTTCTTTTTAAGTTTTCGACAACA AAAAATATCCGAGGGCTTAAATTTCTTTCGCCGGGAATGACCCTTTTTAA TTGCTTAAACATTTAGGCACTTTCACTCTGTATTCAACAAAAAGGGCTTT ATAAAAAGAAAAAAGCTCAATAGCGTAAATTAGTTGAGTTTTAGGGGAAA TGGTAATAACAGGACAGGTGTGTGAGTGGAAAGATCTAGAACCCTGCCAT TTCCCTGGCGGCCTTGGGGCCTTTGTCCTGTTAATTGCCTCTGATTGCCA ATATAGCGATATCCTGGACAAATAATTTTCAGTATATTTTGGGAAAGAAT ATGTCTTATCCACAGCTGTTGTTGGTTTCCAATGTCCCCAGTTTTGATTA TAAAAATTGATAGGGTACTTCTTCTCAGGTGATGTGCAATAACTTTATTA TATAACTTCTTTATATATTATTATTATATATATTATATTATATATTATTT CATTATAATCTGGCATTTCTCAGGAACGGTTGCATGGTGATAAATAGCTT CAGATGACTCAAGCACTTTTGAATTTATTAAGTTATTTAGTCCAATCGCC ATTATTCCATTAACACAAACTCATTTGAACAAGCTGCATTATGAGCATTG TCAAATAGCTGGGAATAGGATTTAGTGTCTAAAGGACATTATCCGCTTGC GTAATCCGAATAATCAGCTCGCCAACCAAACCCGAAGTCGATTCAATTGC ATTGAAATTGAACGCATTGAATCAGCTTAAAATGTTTTATCATCGGAAGC TGCTAAGAGGCTTTGGTTTAGCATACAAGGACATTTGGATACCAATTATT TCACTCAGTTCGGATGAGTTTTGTGGGCTTGGAGTTGTGCACACAAAGGA GTTGTGTTCAGGACTACCATGTAATAGAGAGTCTGCGCGTTTGAAGGGAG TCGTTTTCCACTTAACTTTATGCCCTCCATTTGCAAATGTACTTTTTCGC TCGCCGCACATTTGGACGAACTCCAGCTCGTTCGTTTTTTGGCCAAACTG TCTGCCTTTTTGGGAATTAATAACATTAAAAGCCGCACCTGGCTTCTTCG GCAAACAGTGCGACAGCATAATTTTGAATGCAAAATACTGATGGTTGGCA AGGATGCGGCCTCAAAGGTTATGCCGACAATGCTCCGTCTACCACTTTGC ATGTCTATATCAATTTTCAGGCAAGTGCAGAGTGGGAAACAAAAGAGTCT GGTAAAGAGTGCAATTTGCGAGACAACAGCAATTACAGAAATAAATACCC CCACCCCCACTTTCTAATGGCACTCAAAGATGTTCGAGGATGTTCCACGA TAGACACCATGCCAAACTCCTCACTTCGAGGGGATTCCCCTTACTAACAG CCTTGCTAACACCACGGCTCTGAATTAAATGCACTTTCAGGGGTTTTCCT GTTTGCAACTAGCATGCCATAGCATAGTAAATTATACACACCGGTGGATA ATAACCAACCATTTAAATACTGTTGCCTAGTAACTCTTTTCAACTATTGC TCCTGGTGATTAAGAGATAAAACACATACATCTATCTGGCTATAAGGATA CCACACACCTCGCTTGTGAAAAAGTTATAGCTCAAATTCTATTGCATCTG CACTCGCATGTGTGGGCTTCGTGTGTTTGAATTGCTGATCAAAAAGGCAA ACTCAGAGCGTGTTCCTATCATACATTTCATTCTCCTCGATGCGATTTCA TCTGGGGGCTGAGCAACTTTGGCTTGGAAAGTGCGGAAAACGAAACATTC GCAAATAAGTTTCTAGTATAGTTGGACAAGTTTCTTCTTTCTGCAAAACT TTTTGGTGTCCTGCAGCGACAACAGTCTGCTCCAGAGCTTCCAAGTGGAG GATGTGCAACTGCAGTTGGTGCAGTTGGGGGTGGAGAACTCGACCTCGGC GCACTAATGAGATTAAAATGAAATGGACATAAACTTAATTCCATTAGAGC TATTGCTTGAAGAGATCGAAGATCGCAGCGAACTTAAGAAATGGATGGGT TATAATAAAAAAAATATATAGTTTTCTTCTTAGTTTATACTTATATTGAG GTAAAAGTCAATGGATTAAGAATAGTTTCAATGAAGCAGGCAAGGAAACG AATAACATCTGACATGTTGAGTAAGTGAACTGGAAGTGGTGCAAATTCTG CATCGTATCGAAATGACAATTCATTAGTTGACCTCTTCAAATAATCAATA TTTCGAGACTTGGGGCAACCAGGACTCAGGAATTCCCAGATGAAAATGTT CGTTGGAATTTGGGGCTAAACGAGGCGAACCTGATGCGAAATGGCAACAT AGCTGCTGTCAATTTCAGTTGGATTTGGCAAAAGTTTTCGGAATTGAAAT TCCTCGCAGCAATTAGAATTTCTATTTCTGCCATGATTTCTCATGAAAAT TTCCGACCAGGGATTCTGCGAGTTGCAAGCAGCCTTACCAGCTCACCAAC TTTCAATTAAATGGGGGCACAAGCGGATTCCTCCCACTCTAAGAGCCACG TCACCAGTTCTTTGCTTCTTTGGTCACGTACCTAATTTTGCTCATAATTT CCCATGTACTGACCCCCAGAAACTCCGTGTAAGCTGTCTAAGATTAATGA CCTTTCCCACTCGCCGACGGCAGCCGCCAGTGCGAATATTTTTGTGTGTG TATATTTTAATTATTAATGCATAAATTATGATTTACACAAGCTGTGGTCG CTGAGTGGCACAAAGCCGGAAAAAATGGTATACGACCACGAGAAAAACGG GAAAACGGCAAAAGTTGGCCAGAACTAGCTTCTACTAACCTGATTTCGCC TTTGCTGTTGCTGCTGCTGCTGCTGCTGCAATGTTGCTGCGGTGCTGTTG CTGCTGCTAATGCCGCTACTGCTGCCACTTCCGGTGCTCCTTCCACACTC GCGCTGTCTCACTCGCACAACATGAACAACAACTGGGATCAGTTAATCCA TCATCATTATGATTTTCTTATTGTGGTGCCGCTCTTAGTTAAGTTTAGTG GAGGAAAACACTTTTTCAGTTTCACTTCTCAGGTTGTGCTGTTGGCTTAT TTTCGGGGCGTTTTTTTGCAAACTTTCTACTCATTTTGGCAGCAACATAA TATCCTTTATCTTCTGTTCTAGCCTCGCTTTACTCTATGTACATGTGTTT CTGGCACTTTTCAAAAAGGCATTTACATAGTCGTATCTATTGTTTCTTAG CCATCCCGCTCGGCTCGACTGCTGCGAAATTCTCGTAATTAGCTGCTGTG ACTACAGTGAGTACAACAACAAGTGGCCACTCCGCCCTGTCTTTATAGCC TAATGCAAATTTAATTGCGGTTCACCCCTCCCAACCCATCGCCCACAATG GAAATGTGCTGTACTTGCCAATGGATTTTTGCGGTTACATTTTGAGACCT TATCATGTTTCTGCTGCCCCAATTTGCCACGCCCAGCACGCACACACTGC CGCCCGCTGAGCCAGACTATCCTATCCATTTGCTTCTCCAGCACTTTTCC GCCCACTTTCCCCTTTCCCTCACCAGGCCGCTTTCCACCTGGTGGAAAAC TTTCAGCTTATTTCTGGAATTGCCGCTTTTGCTGTTGCTGTTGCTGTTGC CTTTAATGAGCTTCCTCCTGGTTGTGGCTGAAATGGGAAGGCCATGCAGC CTCCGACTCCAAATGGCGCTGCTTAGAGCAGCAGTCCTAGTTGCCACCTG AGGGAACAAGGTGCACTGGCATTATAAAGGTGACATGAAGCACATCCAGC TGGAAAAGACCTTTGCCAAATGCAGTTAAGCAGATGTCTCCAATACAGGT CATTACTGAATTGGAGATTTACTTCTGCACTATTAAACGCTAGTAAAAGT ATCGGATTGCGTTATTGAAGGCATTCTTTGTTTATAAGAAACTATAACTA TAATAATTGTGGGGCATATTATGCAATGCAAGTAATGATAGATTTTATAA GTATAAGTATTATTTATTCATTCTAATTAAACAAACTGCCTAAAAACATT CAAACGTAAGCTGAGTTCATATTTTTGTGAGACATGCTGTAGTCCGTGAA AAGTTTCACCAAATTGAAAATAAATGTATTATAATGTTCTTCAACGCAGT TACTAATCGCCTTCCTTTGAGTTGATTACCCAATAAAAACTGTCCGCCAC CCAAACTGACCCTCAATGGTTCATTGGACAATGAGGTTCCGCACTTCTGC GATAACCCTTGGCACCCAATAATAATCATTGGGTCGAGCCTTTGAGAACG CCTCTCCCCCCCTCTTCAAAACTCGGGTGCAACAGTGCGTATGCGTTATC CAAAGTTTGAACAACAGTTGTGGCCGTGGCAATTGCGGGGCAAAGCGAGT ACTGTTGTCCTTGCCAGCTGATGGACGCCTGGCCTAGCAGCTGTTATCAC ATCCTAATGCTAATGAGATTTTCATTGCTGGTGCTGTATCGGCGGCATTA TCCTTCCCCTCCCCTCCAACTCCCCTCGCGAAAGGCAATACTCCTCACTG CCATACCAGAGATTCGTCATTCATAGCATTCTGATGGCAGCTGGCTGGCG CTAACGATGCCGAAGCTTTGGCCGTCTTCAGATGCTGCTGCCGATGATGA GGATGATGGCTTATGTAACTAGTGCTGCATAAATCCGAGAACACACACAC ACACACACACTCGCAAGTGGCGTGGGCAGAGGCCCACGAAATGCTTGTGT TTGGTGTTTTGCCTATGTCCTGGCTGCTCCTCATTCCCAACTACTCAAAC TGTGTCTTTTCATGTTTTCTCGCTCGCCCCAGACATCATATCCTTTCTGT TCGAGTGTGTATGTGGGGCAGTTGTGTGTCTGCAGCAGTGGTAATTCGTT TGGCGCACGAGATGCTGCGTGCCTCTAACACTAAGAAGTCAGCAGCAAAA GAACTAGAACCGAACGAGTGGACCTTTGTCGTTGTCTGACTTCAAGTGGG CGGAGGGCGATGAGGTCCTTGGACAACACACTGGCACTGGCACACACACT CGCGTCCACGTTTGTTTCACTTCACTACCTTCACACACACGCGTTCCCCT AGAATTGGCCCGGTTCGGCTGGCTTTGCCTTGGGTTTTGGCTTCTGGCAG CGAACTGGCTTGCGAATCTGCTGGCGGATGCTGCTCTCGGTGCTGTTCAT CTCCCGTCGATGGACCATGTTTGACTGGCTCCCAATAGAAGCCATTGGCT GTCGTTCGTCGCCACGCTCGCTTCGTCCTGGCCAAAATGCGGATCCCGTA ACAGTGTCTGTGGTTTCTGCTGTGCTGCTCTCCTCTGCCCTGCTCTCCTC TGCTGAGGAGAGATTTTCTTATACGAATCTCTGCAAAGAGCAAGGAACGA GTCCTTCGAGAGCGAGAGAGAGAGAGAGAGCTCTCAGATGGCGAGTCACT TCTCTTGTTGCATTTCACAGGCTCAACGAGCCACAGATAATGCACGTGAG TTGCTGAAGCTGCCAGATGGTTCAGATTGCTATGCCTTTAAATATAAAAT GGAACACGTCCTTAAAAATTAAATATTATATACATATATATATAAGAGAG AACCCAAAATGGTATCTAAGCAGAAGTGCAACAATATAAAATTAAGCTTA GAATTATTATTATTTTAATAGCTATCACTATCGATTTGCACATTTTTATC CGTATGAAAATAAAAATTAGGCAAGACACTTAAAATTAAGCATGCAAATT CTAATCACATGATTATTATAGATTCTATTAATACTACTACTGAGCCAACT TATATCGATATTCAAATAATATTTGTATTTTAATCTTCCACACGTTATAT AGGCATATTTAATGCACCTCATGCTTTTACATAATTGCCGAAAGAGTGGC AACGTCTTGCCACAGCGTCTCTTATAATTTTAAACTCGTGGAGCTGAGCC ATCTCAGATTTAACTCTCCCTGCGCATGCTCTCGCGTGGGAGAACAACTT CGAATTTCGGGCAGAAGGATAACAAAGAAAGCACTCCAACGAAACGAACA CCCTACAGACTAATATAGAACACCACAAGACCAAAACTCGTTTAGTTGCC GCGTTGACAACTTTGTGGCAGGCGGCAAACAAACAAACCTCACACTAGTC CTGAATGTCCTTTATGCGGACAGCTGTGGGGGCGGGGATCCTGTTGCAAT TCCATTGTGAAAGCCAAATGCATTGACCTGCTTAGACAGCTGAGAGATTT ACAACTCCCCTATAACTCCTGGCCGTGCTGCAGTTCTGGGAAAGGGAGCA GCGGCATTAAATGGCAAATAAATCTAAAGTTAAACTTTTGACACTGTCTC GGCGAGCAGCCACGAAGGCACTTCCTTCCGACTCCCTCGACTTCCGGTTG GAATCTGTCGCCCTGTCAGCGGCAACAGAAGAAGTGACACTGGCACGCAG ACAAGTGCACTGAGAGAAATTGCTTCGGTCATAGCTCAGTGAAATACTAA TTATTTCTGCTGAGAAATATTGACAATTTAAAACAAAAGTCATAAAATAT GAGCATACATTTTTTATGATTAACTAAATACTAATGCATTCGTTAAATAT ATATATACCGCCGAAAACAAATTAAGACATTTCCTATTCTGTCAATTACA ATTTCATATTCAGTTATATTGTTTTAAACTAAACTGGCGATATATAAACT TTCTGGCTGAAAAATCTTTCTGAAATTGTACACCAGCAATTTCTCCATGT GTACTACTGTGCGATGTATAAGGATTGGATTTATGAGCGCCCAGCACCTC TACCGAAATCTTATAAAACCCGGGAATAAATAATAATAATTCTTGCGCTT TTCGCTGTTGTTCGCATTTCCCGCATTTCTCTGCCATTCTTTTCCATTCT TATGACAATGTCAACATTTCTTTTGCTCCCCTAATGGCCTGAAGAAAGCA CACGCACACACACACACACATATAGACCACTCGCACACTATGAAACCGAA TGTGGCACACACCCCACGCACTTATTTATATGTATTTTCGATCGTCTGTT GTTTTTCCAAGTCGGTTATGCATAGCCATAAATTCTGGTAAAAGCCTTCT GTAGGTCGAGGGCCACGGCGGTCCGAAAATAAAGGAATTGCTCCTGATGC TGGCACTTACGCACACAGCCAAGCAGCAGGATGGGAGAGAGAGGACCTCG CACACACGGACTCACGCACTCACACGCAATTGGTGTTCTCGCCGTTTTTG TTTGTCACTTAACAGATTTTTCTGTCCTTGCTGGGTATTGATTTCTAATT TTTCCTTCGTCGGCTTTGCGCCCCAAAGAGGTTTTTATAATGTGTGCGTG TGTGTGTGTGTGTGTGTCGCATTGATTTCGCAATTTATGGGCGATTTGAT GGATTGCTTGAATAACTTTATATGCTTATTTTTGAGTTTTTATTGTTTTA CAACTTGCGGTATTTTATGTAGAGATCCTGTGGACGACCTAATGGAAATC