##gff-version 3 ##date Fri May 24 03:02:03 CEST 2024 ## exported from the transgeneomics system molecule_59020384 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59020384 mpicbg region 9631 29655 . + . Name=dmel-5.43-3L;type=genome;start=15652152;end=15672176;strand=- molecule_59020384 mpicbg region 29656 30610 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2436;strand=+ molecule_59020384 mpicbg region 30611 30717 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3813;end=3919;strand=+ molecule_59020384 mpicbg region 30718 48464 . + . Name=dmel-5.43-3L;type=genome;start=15634405;end=15652151;strand=- molecule_59020384 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59020384 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59020384 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59020384 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59020384 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59020384 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59020384 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59020384 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59020384 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59020384 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59020384 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59020384 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59020384 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59020384 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59020384 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59020384 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59020384 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59020384 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59020384 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59020384 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59020384 coding_transcript gene 26428 26840 . - . ensembl=FBgn0262528;id=50454869;identifier=FBgn0262528;Name=CG43082 molecule_59020384 coding_transcript gene 26904 27459 . - . alias=L71-11;alias=EIG71-K;identifier=FBgn0014851;id=51072874;Name=Eig71Ek;alias=L71;alias=CG7325;alias=Eig71Ek;ensembl=FBgn0014851 molecule_59020384 coding_transcript gene 27692 28158 . + . ensembl=FBgn0014850;alias=L71;alias=Eig71Ej;alias=CG7588;identifier=FBgn0014850;Name=Eig71Ej;alias=L71-10;id=51230259 molecule_59020384 coding_transcript gene 28493 29000 . - . alias=EIG71-EI;identifier=FBgn0014849;Name=Eig71Ei;alias=CG7327;alias=L71;id=50672101;alias=L71-9;ensembl=FBgn0014849;alias=Eig71Ei molecule_59020384 coding_transcript gene 29255 30833 . + . identifier=FBgn0014848;alias=L71;alias=L71-8;ensembl=FBgn0014848;id=50672135;alias=CG7594;alias=EIG71-H;Name=Eig71Eh;alias=Eig71Eh molecule_59020384 coding_transcript mrna 29255 30833 . + . Name=FBtr0305334;parent=50672135;id=50672145 molecule_59020384 coding_transcript exon 29255 29515 . + . parent=50672145 molecule_59020384 coding_transcript five_prime_utr 29255 29289 . + . parent=50672145 molecule_59020384 coding_transcript cds 29290 29515 . + . parent=50672145 molecule_59020384 coding_transcript intron 29516 29578 . + . parent=50672145 molecule_59020384 coding_transcript exon 29579 30833 . + . parent=50672145 molecule_59020384 coding_transcript cds 29579 30720 . + . parent=50672145 molecule_59020384 CLC cds 29656 29715 . + . Name=2xTY1 molecule_59020384 CLC cds 29722 30438 . + . Name=SGFP molecule_59020384 CLC cds 30445 30486 . + . Name=V5 molecule_59020384 CLC cds 30487 30510 . + . Name=Precision cut site molecule_59020384 CLC cds 30511 30531 . + . Name=TEV molecule_59020384 CLC cds 30532 30603 . + . Name=BLRP molecule_59020384 CLC misc_recomb 30611 30644 . + . Name=FRT molecule_59020384 coding_transcript three_prime_utr 30721 30833 . + . parent=50672145 molecule_59020384 coding_transcript gene 31611 32141 . - . alias=gene VI;alias=71E-Gene-VI;alias=L71;alias=gene-VI;ensembl=FBgn0004594;alias=Ecdysone-induced gene 71Eg;alias=Gene VI;alias=L71-6;alias=CG7336;alias=VI;id=51409783;alias=eig71Eg;identifier=FBgn0004594;Name=Eig71Eg molecule_59020384 coding_transcript gene 32368 33114 . + . alias=Ecdysone-induced gene 71Ef;alias=V;alias=gene-V;alias=gene V;id=51409750;identifier=FBgn0004593;alias=EIG71-EF;alias=CG7599;alias=L71-5;Name=Eig71Ef;alias=71E-Gene-V;alias=L71;alias=Gene V;ensembl=FBgn0004593 molecule_59020384 coding_transcript gene 33759 35297 . + . alias=I71-7;alias=Ecdysone-induced gene 71Ee;alias=gene VII;alias=L71-7;alias=gp150;identifier=FBgn0004592;alias=eig71Ee;Name=Eig71Ee;alias=L71;alias=CG7604;alias=gene-VII;id=51409715;ensembl=FBgn0004592;alias=71E-Gene-VII;alias=Gene VII;alias=VII molecule_59020384 coding_transcript gene 36673 37225 . - . ensembl=FBgn0004591;alias=BcDNA:LP04160;alias=CG7350;alias=gene IV;alias=L71-4;Name=Eig71Ed;identifier=FBgn0004591;alias=71E-Gene-IV;alias=L71;alias=Ecdysone-induced gene 71Ed;id=50554267;alias=Gene IV;alias=IV;alias=gene-IV molecule_59020384 coding_transcript gene 37515 38290 . + . alias=CG7608;identifier=FBgn0004590;alias=L71;alias=Gene III;alias=L71-3;alias=Ecdysone-induced gene 71Ec;alias=III;Name=Eig71Ec;alias=71E-Gene-III;alias=gene III;id=51316543;alias=LP11175p;ensembl=FBgn0004590;alias=gene-III molecule_59020384 coding_transcript gene 38443 38878 . - . identifier=FBgn0262530;id=51035132;Name=CG43084;ensembl=FBgn0262530 molecule_59020384 coding_transcript gene 39228 39833 . - . alias=II;alias=Ecdysone-induced gene 71Eb;alias=71E-Gene-II;alias=L71;identifier=FBgn0004589;alias=gene II;Name=Eig71Eb;alias=Gene II;id=51125067;alias=L71-2;ensembl=FBgn0004589;alias=gene-II;alias=CG7355 molecule_59020384 coding_transcript gene 40108 40649 . + . Name=Eig71Ea;id=50832647;alias=CG16931;alias=L71-1;alias=Ecdysone-induced gene 71Ea;alias=gene I;alias=gene-I;alias=Gene I;alias=71E-Gene-I;identifier=FBgn0004588;ensembl=FBgn0004588;alias=I;alias=L71 molecule_59020384 coding_transcript gene 40676 41193 . - . id=50454844;ensembl=FBgn0262529;identifier=FBgn0262529;Name=CG43083 ##FASTA >molecule_59020384 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACAAACATTTATTAAAGACATC GCACGTCGAGGGTTGCCAGCGTCGAAGGTCCCATTCCCCCGAATCTTCAA GATATTCAGGCAAAAACTGCAACAAAAGGTACAATTTATAGTTCGACACC CTTGCCGGCTAAGTCCAACCCCCAAGATTTTTTGGGGGGGTAGCGCACGC CAAGGACATTGGGTGGGTGGTTCGAAAATGAAATTGCTGCCGCCCCAAAA TTTGGCAAAGACCTTGAAAAAAAACCCGAGGAACAAAGGGAAGGGGAGCT GCTTTTGTGGGGACAAGGGGCTGGTTGGGTTGGAGGTGAGTGATAGAACT TTAAGCTCAAACGCCCGGCCGTATGCAATGAATATTTACGACTAGGTCCT CTGAGGATTACATTGTCGGGCTTTTGGGCCTGGGGCTTTATGCAATTGTG CGCAAGTAAAAATCTAATTTATCCACCCACCACCCAGCCGGCGTTTTGTT TGACAATTGCCTGAAATGATGGCAATGCATTGGCATGAGTTCTACGCTCT GCTGGCACGTAATTCTTACGGTCCTTCGATCTTCCGGGGGAATTCCCCCA CAAAGCAGGCTGGAAAAATCGCTTCGCTTACGCATATCAATGCACCCTTT TTTCGGACTACCGAAGTCCGTGGATTTGGGGTGGCTCTGCAGAGTTCCAT GGGGTGGGTGGCTGCCGGGTGGGTGGTGGTTCGGCGGCTCAGTGGTTTAA AGGTCCCAATCCTCATCATAACACCACATGTTCCGAAATTCAGCGGCGAC GTGGCGTCTACTTCATGTAGATTTCTATCTATTCTATTGTCTGACTTTGT CGCGTGGTAAATTTCAGCATTCATTTCGTTTGATGAGGCGCAAAGTTGTG GAATTTATTGCGTACGGGAAAGAAGTTAAGTGGATTTTACGTAAATTAAT GAGTTTCCATCGGGGGTTGATGCCAGCCAGAGGCTATTTAAATTGCTATA CAGGATGTTGGTCATGGGTTGAGGAATGCTGGTAGTGCGAATGATTGCAT AGGATCGCTAAACAGATCGCTGGAGGATCCCACTGCAGTTATTGCCCCGC TGATTTATGCTGCAAATAATAAACATTAACTGAATGCCGTAAAACATTAA GAGCGCCATCAGTTGGACATTCTTCTATCTCCAGTGGGGGTACACTTAAA AAGGGGAAAGGTTTGGTCAGAGTTATCAGTCAAGAATGTATTAAAAAAAA ATGTCCGATTTTCAATCTAACCCAAGTGCCCACTTCCAGTTTCCCAATCC CACTACTTGCGAAATGAAAATGAATAATTTTCTTATGAAATATTTAAAGT ATCTGAATGTTTTTCGGTGTAACCATCATAGTGGACACACAAAGCACCCA CAATAAATTTCACTTATCAAAGTTTTCGCTAGCCGGCGGAGACAAAAATG GAGCAAAGGAAAGACGCGACGAGGGCCATTCGAAAAAGAGCTGAAAAGAA ACCACGACGACGACTAACTTTATTGCATAGCCCCAGTCCAGATACAGATA CTCGCCCTCCACGCACAGGAGACCAAAGACGAGCGACGACGCCAGGCGGC GGGAAAATTAAATGTCTTTTGTCAACAGACGTTGCAAAAGGAATACTGGC CAGGAGTCGGTTGATGGAGGACTTGGACCGGAGGAGCGGGCTCTGGCCGA AAGACAACGAAAAGCGAACGGACAATGACGCACTTTTTGGCCAAAAGTTT GCCCACTCTGATATGCATTAAAGCCGAATCGAAGGAGGGTGATGCCGATG GTCGATGGGTGAGGCTATGACTATGGCCAACTCCAAAGGAGCGCAGAGCA ATCTCGCTGTGCAAACTGGCATCATAATGGGCCACTTATCATGGCAATCA CTCAGCAGTCAGTCGGGGAGTTTGCCTCTGCACTGAGAGAAATACTAAGT AAATTGGTAAGCCTTTAGAGGCTAGTTCATAGTCATATGGGGCATATCTA CTTCAATTGTAGAAATTCGTGCAGTTTACATGGAAGTTATACTTAATTGA GACAATAATAATGAGGGCCGTTCTATTAACTAGTATCTGCAATATGTATT TAATTTATGGATTCAGTTCTTAGCAACATCTAGGTACATTTTAAATAATT TAGCACAAAGACGTGGATTTCTTTTTCTTTGCAAATAAGTTTTAATAATT TCTAATCAATTTAATGTGCAAAAGATCGTCTTTAAATTCTTGATTTGAAC TTATATAATTATATTCTGATATATTCGAAATTTAATAATTATCTATGAGT CCATTCGTAGTTATAACTAATTAGATTAATTCGAATTTTCTCCCGGTGTG AACAAGGAGCGCAACTTCAGTGTTATGTTCATGGACACCCCAGAGCTTCG CTCCCAACTTTGCTTTACTACTTTCCGATACTCAATCGTCGTTTGCCTTT TAATACTTTGGGCAAACACATTAAATGGAAATTTCGTGCAAGAAGACCAA CACCACCATCCTTTTGGCTGAACTGAGAAGCTGAAGAATAGAATGTCCTG CGGGTAGAGCTTTTCGGACTGATTTTCCGAGAGTGAGGGTGAGCCATGCA AAGTGCCGGCGTTTTTGGCAAACAGCAAACGCATTTTTCATGTGACATTT GCCAAAAAGGAAAAAAGCAAAACAAACTTTGGCCCAAGCGTAGGACTTTC AGCCGACTGTTTGATCTCTTCACATTGCATTGCTTTTCATAGTTTTTTAT TTTTCCCCCATCTTTGCCGGCCTGGGAAATCCAAGCGTCAATATGCCCGA AAAACAGTTTGGACATTTTTTCTCGTTTCGAGTGTTTTATAAATAAAAGT TCCCGTTTTCTCACTCTGTCTGGATAACTCAGAGGAAAAAATTTCTGTCT GTTTACTTTGAAAATTGCTGTGATTCGGGGCAGTTCGTTTGCATTCCTTG CGAGCAGGAACAGGACCAAAAAGGAAGGAACTCAAGTGGCGTATCTTAAG GGGGTTTAAAATTGAATGATTGTTGAATTAGCAGATTAAAATTATTCGCC CTAAAGGGGACTTCCATAATGAGAATTTTGCAGTGTGCTTGCGGTAGGGA TTAAATGAATATGAGATCTTTATCATATCTTGCTTTTCATATCATTTATT TGTTAAGATTATCAGATAATTATATTATATTATAGAACCATTAGATGTAA TTTCCTTTTTTACGTATCCTTATACACCATCGATTATTCCCGAACATAGC ATCATTGAAAAAATAACACTTCGAAATTAAATCCGATCTAATTTAGGACC CAAACAAAACTGGAAATAAATCGAAATTCAAGTTCAAGTTGCTCATATGC CCCGACATTTGTATCTGTATCTATTTAGGCATTCGTATCTGTATCTGCAT ATTTGTACATGCACCCGAAGCTGCAGTTTAGGACCCGTCTTTCGGCATCT GAGAGTGCCTAATTAATTGTCAAACATTGCGCGCTATGTGACGTTAATAA ATGTCAACTAAATGAGCTGCATGTACGGCAGCCAAGCGAGGCGAGACGAA CTACTCAAAATGGATGTGGTTCGGGACTGGGAGACCCAGGAGCTCTGGAG TTGGAGGAGGGGCTGATGCGACTCCCTAAACAGATGCTGATGATGCAGAC TGGGGCTACTTAGTGGCGTTGCCAATGCCACATGTTGCACTCTACGCCGA AAACAAATGAAAACTATTTTAAGCCGATTGTCTGTCGAGTGGCAGGCAGG TGTGACTGAAACTTTGTCGGGACACTGAGAAAAAAACACAACAAGTGTGA TCACATCACATTGTTTTTTAAAAAAATTTTACAAATTGTAATTGTGTTAT TCTAATACAATAGTGCTATTGCGAATCTAATGCATTTTTGTTGGGTTTCG GAACCGAAATAGTTTGAATTAGTGTATCATTTTGAAAGTGATAGAAAATA GTATTTCTTGCAGTGCAAATCGGTCTCCTTCGAATCACCCCCGCCATCTC CTCGGTCTGTTTACCAAATTAGATGCATTTGAATTGATGTGCGTGCATAA ATTACGTCTCAAATCCGAATCTCACATCGACTCTGGTTTTGCTCGGTGGG TTTCTTGGGTTGCATAGGACTCTGGGGTTGGGCGATTGCCTGTGGACAAG TTTAAATTAAATGTTTAACATTCAATCAGGGACGGCGGACAACTCAAACT ACTCGTAACTCCAGTTCAACCGAATCCCTCTGTTTTAGAGTCGGCAGTTG AAATGCATTTGTAAACTTTTCTATTTGTCAGATGCGAGATACCAGCTTGG AGGTACATAAGCTAAAGTGAATGGGGTGAGTATTCACTTCTAAACTTGCA ATCAAGGCAACTTCCTGCCTGCCGCTTTCACACTTTAATTTCCGGTCTTT ATTGTTATAGTTTCTTTGGGTTTGTGCTACGGTTTCGGCTTCAGTTAAAC TGAGTTCTGGTTGAGTTCAGCTGACAGGCTCTATATGGCTCAAGTGGTTT CGGTGATCTGTCATTCAAGGAGGGGGCGGGGCGGGGGCTGAACTCAAAGT GACTAGGATGTGGACAACCGCGTTTTGGAATTGAAAAGTTAGACAGGAAA ATTAATTAACATGAAGGCGCTTAGCCGAGAAGGAGACAAGGAAAATGGAA ATTTGGCAAATTGTACGTGAACTCTGGGTATTTGGACCGTAGAGAATATT AATACAATTAATTGTAAATATATATTATAAAAATTATTGCATCTAAGAAA TACTTCTTATTCAAAGACTTCCCCGTGCATTTGACCAATTAGGCAAAGTA TAAGCTCCTGGCTATGCTATCATATTAGTCTGTAAAGTTATAAATAATGT ATTTTCGTTTGAATTTTCCACAACCGGCTTTCAACATGCTTTGGTAAGTG ATCACTTCTCAGTTGAAGCGAATTTAAGCTGCAGCAATGGCCCAACTTTC CCTAACTTCCTGATATATCATTGACATATCATCCAGCTGAACTTTCGCAT CTGGCCCCGGGCTAACAACCTTCAGCAGACACACACACAAAAAATAAGTA TATAGAGGTAGCTGGCAAGCTGAATCCGCTTTTCACCTGCATGCAAAGCC ACCGAGGAAATCTCCTCTTACCTTGGGTCATTTTCAGCAAGCCAAAGAAG GGTTTAATGTGGTGAAAAAGGAGGGGATTCCCCGGCACCGCACACTTAAC CCACCCGCACACACTTGTCTCATTTGGTATTTGTTTTACGCTGAAAGTGT GAAAGCGTCGTCGAGGTGTGGGAAACATGGGTATAAATATGCGCTTGGGG TTAAATTCTATTTGAACTTTCTACATCCGTTTTTGTGCTGGCAAAAGGAG TACCGCACCGAACAGAGGGCCATGGAGCATTTCATTCACACTTTCATTAC AGTCTGTGGAATATATTGCACCCCCGGGACGTTTGTCACAATCCGTTGAA GGAGCCGGAGCACTCTGAGTCCGAGTTTGACTCAAAGTCAGCGATGGACC CTCAAACTGGTGGGAGAGATATATTTGCATTGAGATTCGCCTTTCAGCGT CTGCCATGCGGAAGTTCTCTGTGGCAATTGCATTGGAATTTCCACTTTTC TCCCGATATGTACCTCTGGATATCTCGTCCATCGCAACAATGCGGTGCAA TTAGTTGATAGCACGCCTCGTGCAACTCATTTCCCGAACAGCAACTGGGA AAAATAGGAAAATCCGCCCAGTCACGCGGCCACATTAATCAACATTGGCT TCACAGTCGCGTTGCAAGTTGCACGTTGCACGTTGCCGGTGCCAAGTTCC CAGTTGCATTCCACTCGGATATTGGTGCCAGGTTCTGTTCGGTATAGCCC ATCGCAGTCATCTCAGTTCCGAAGATTAATTAAGGTCAGCAGGGAGTTCA GGCTCAAAAGAATGCCGCCTAAGACGGCTGACCTAGTCTAGTCATGCCAA CTAATATGGGAAGAGCCGTGGAGCCTCTTCTCTCACTTCCCTTTTCAACC AAATTAAATTTCTTGCCCTCTGTATTTCTTACACTATAAAATAAAATTTA TAATAACACAGCGACGTTTGGTAATGGATAAAATTCACACCAAACGCCAC ATTACAAAAGCAGGAATGGTTTTGTATGCATTATTTAACATTGCTAAAAA TTGATTTAAATATTAGAGTAATTCGCTAGCCTTATATATTTTTCTAAGTG CATAGAGTTAGCCCAACAAACAGTAGCGTTGTTAGAGATCCGCTTCCAAA ATCTGACTTAAAGGCTTCCTGATGCATGTCGAATGCAGCATAATGAGCGG GGGGTGGTTCACCATATGTGGTCCCCATTTCCACATCCATATTGTTAACG GGCGAAATCTACGATGAAATCGACTTCAGGAGTCATCAAACATCATCAAT TTAATCAATGGTCAGCCCACTGGGGTGTCCTTGGCACGAGGGGGCGAAAG TGGGAGTCGCTGCACTTCCAAATTGCAAAGTCAAGCAGGCTGAACTTTTT CTGGGGGATGACCCGGGGAAGCTTACAAGTAATTAAGGGTGGCAATTTTA AGACAAATCCTTGGGGTAAGGTGTTCCCCCGAACAATGCTTAGGATTCGA TGGATTCGTTCGGATTGGATATGTAATTGAGGGGGGTTTGCTGTGGGGTG TCGCTTCTGTCGCCCTAAAGTACGTGATAAGGGCATTAATGATGGCTAAG CCGCCACCTTCCGACAACCAAATAAAACTTGATGAGTTTCAATTATTCTG CAGACGGGGAAGCTCCCGATGAGAAGTCGAATTTTGGCTGAGAATGCTGC TTTGAAGTAATAACGTTCCGTTCATTTCTTTGTTTTAGATCTATGATAAA GAAAATCATTAGCTATATTGGATAAGTATTTAATATAGAGAGAAATTTTA ATAGAATTTTAATTTGTGGATAGAAATATCATCAATAAGAATAAACTCTT CTACCAATGCAAAAAAAAAAATGTATAGGGAAGTTAAAGGAGTGGTCTTA CTCTTTACCCATTAATTATTAGTCAAAGGAAACTAATTGCTTTTCGCCAC TTCATAAAATAATCTGCTGTGAAAAGCAACTTTCGCTGAGCACATTCTAT TAAGAAACAAAGAGAAAATTGAAAGGAAAGACGAAGTCCGAGGTTTCTAT TTAACTGAAATAAATTCTACAATTTTGCAAGGCAATCTCAATAAATTAGT CTGCCAAAGCTTCACATATCCAATCCAAATTATGGACCACAAATTGTGTC TAACGATAATTTACGGTCAAGAGGACACCGCATCCATCAATCCGAGTTGC ACCTTGCTGCTCTGCTTTCATTCTCAGCATCATTACACATTCTAACCGCA GGATCGCAGTCAGACAACATCCTTCTCACATGGAATTATCAAATTGCACC TGCTGAATTCATTAAATTTGGCTAACGATCTGCTTGAAAGGCTGGAAAAA AAGCAGACTCAAAAAAAGAAAACATCATAAAAACTAAGGCCGAAATATTT GTCTTCCGCTGCTTAAAGTGCTACACATAGCCCAGCCACAAGCATCATTA ATTTTGCACGTAATTATGTGAGGCAAGTGGTAAAACACCTAACCGAAAAC ACAAACCAAAAACCCAGCCAACCAACCAAGCTGCAAAAACACAAAACTGT AAATCAGTGCAATTAAATGCGACTTTTCAACAAAATTTACTGAAAATTTA TGACAACAAACGAGACTAATTACGCGACGAGGAACAAGAAACCGAAAAGA GCGAGAATCTGATGATGAAGTTGGGGCAACGATGAAGACGGCGACACTAT AGATACTGCAAAATTGAAGGCAATAAAATTGCGTTGGCCAAAAGGCGCGA CAATAAAGCCCCAAACGAGAGCAGAACTATCATTAATCAAGGACCTAATG AGAGCAGGCGCGACACGGAATATACATCTAGACTGGGCAGGAAGGACTTT ATCGCCAACTCGTCATCGATATGTTGGCCAGTAATATATCACGCCAAAAG TATCCTTCGCCGTTGAGGCACAGCCCACTTAACTAAACTGACAGTTCAGC TGCTACAATTTAGTCGATTAACGTCAGATCAGCAGACGATCCTGACTTTT CGAATCCCAATCCCTGTTCCAAGGGATCAGCCCTCTGCGATCGTTCTTTA CCATTTTTATTTTTGCCCTGGCAACCTGTCGTCATCAATTTTGTGGAGTC GTCTGGGCCCGAAAAAAAAGTAGTGGCAGCTGTTTGGCCAGGTCAACAAA CAACGGCCAAAATCACTAAGTGGCCCCGAGTGCCGCAGGTAGCTGCCAGA CGGCAGGAGGCACGATCATTGATCAATGATCATCAGGACAAGGGGCAATG CAGCACAGGTCGCGATTGTACACTAAGAGAAAATGGGAATTTTAAGTGAT TTTAAGCCATTTTAAAAAGTACACTTAAAGCTTAGCTATTATTAACAAAG GATACATCGAACTAAATCAAAATGGAAGCCATGTTATATAAATTTAAATA TTACATTCTTGTATTTTATCATATAAATAGTTTATGCCCTTGAATGCTTA AAAATTTATTTAAATTGTTTCTACATTAATATTATTCAGTAATTAATTGT CTTTATTGTCTTTCTTATTTATTTCTTACTTAGCGTAATGTAATACAAAT GTATTCTTTTAAATTAAGTAAGAATCAAACTTTTTGCTTAGTGTTTTGTT GATCTCAAGCAGTGCGCAGGTGACTTTTTACCTTTATATATTCCATTTGA ATTATGAAATTATGCATCCCAAGAAGAAAGTTAATCCCGCAGATGCGTAT TCCCTCATTGAATGTCAGAGATTTTCCTAACGTTACATGATATGTGATCA GATCTTTATCGCTACCAGGCCATCAGAAGTATAATTAAAAATCGTTCATT TGGCTCGTTTTCATTATCTCGGTATACAGATGATTGCCTTTCCTGGAACC GCGATGCTGGCTTGTTAGTTTAACAAGCTGAAGGAGAAGCTGCGACTTGG CCACGGAGACTGCGGCTGACCATTTAGTTGGCCGGAATTAATGGTCAGCA GACTTCGGCTCCATCTGTTCGTCCAAGTCCAAAGGCTAGAGAACCATACG ATTTTGGTGGCCCGAACGCGTGTCTGCATTTAATTTAATAATATGGTGTC ATGTAGCAGTTGTTAGGATGCGCTAAATGCCCCATCCTCAGTCTACGAAA CTCGGACTGGCATCTGTTTGAGTTTTCGGAGTTGTGTAACCCAATGCCAG ACGGCTCTCGTAGACAAAAGCAAGCTGTTCGTTCCTGCCCCGAACAAACC TGATGCCGAACCTGAACATGAACCTCAATGGAAATTATAGCAAGTCTTGT CCATTTAAGAGGATTTAGGTTCGGTAGGTTCGCATTTGTATGCTAACAAG GGCGTGCGCTGAATGGTCTTTAAAGTAGGTGCCTGAAAATTGTAGAATTT CCCCATAACTAAATACGAGAAGAACGATTCTCTGGTTGAACAACTGCCGA TGACTGATCTAGTTACCTCAAGTGCCGGCTCTTCGTTTGCACTTACACTT AGCAGCTTCAGATGAGTATCTTTGAGTACGTGAATGAACCGTGAGATATG ATGCAAATACGAGATACGTATCTCCACTTGAGCTGACCACACAGTCACGT TCTTAAGTCACCCTTAGATATTTATTACCTGAAAATATTCCAATGCTTTC TATTTAGGTATTTGGGATTATTTCGACTTTTGGTGCAATTTAAAAAAATA TTATATCAATGCAAAAAAAATTGTCCATGCTTGAAGCAAATCAACTGTAT AAGTTCACGGCCATCCTAGATAAATTCCAACAAACCTGATACTTACAATT TGAATTTAGCTTAATTAATGGAATGCGTTTAGTGCAGACAGCTATGCAGT GCATAATATTTTAAAATTGCAGAATAAATAATCGCAATCTAGCAATCCCA TCTCATATCAGCCACAATAATAACACCACTCACATTGCCACAGTATTTCA AAAGTGCTCGTGTTCATTTGCATTCATGTTAGCATACCATAATTCGTTTG ATATTCTCTGTTTTTTCGGAGGAGGTCCTTTTCCTGATTATCATGCTGGG TATCCCATCAGTGAAATGTCCTCGCACTTATTACATATGCAAATGGCAAA CAGATTTATATACACCGAAACCGTTGACAGGACTCCCAGCCAAGTTTCAT TTGCCAACTTTCCAACTGTGGAACTATGCATCCCCCGCATACCATTCAAA TGCAAATCCCCAAACTAATTTTTATTTTGACAAAATATTCACGGCTCGTT GCATTTTGTGGGGGCCACCCTGAAATCAACCCTTTCGTGGGTTCAGATAG ATGGGTTAGCCAGCTGGTCCATGGCAAATGCACAGAACACTACATAATAC AATCGTAAAATTTGCCACAAAAGCCACTTGGAAATATTAAAAACAGCCGC AGGACAATGACAGTCACGCTCTCCAATAAATCGCTTACGCACAACTTTTC CCTCCGCTACTCGAGGAGTGATGAAAAATTTTCCATTTTCATTTTCCTAC ATGCAATAAAATCTAATAATTTTTGGGGGTTGTGATGCCAATTTCTGGGA GGCTGTCGCCGGACAAAATAGCTACAAACAATTGGCAACACTTGTGTTGT GCGGCGATTTTCGGGGGTAGAACAACCCTCAAGTAGTGCACTTGCCACAT CTCCAAAAAGGGGTGTGGGTGGGGCGGCGGGTGGTGGGGGATTAGCCAAG AAAATTGGGGGAGTTATTGCAATCAAAACGAAATCATTTTTATGCGATCC CCGCTTCCCTTCCGCACGACAAGTTTTCGCTTCTCTGATATATGAGATGT AATTAAAGTCCGGACCACGAAATCAGTTTTGGTTTAGTGCAATAGTTTTG CGGTGGGTGGCTCTGAATGCGGGGGTGGTTGCCTGATGGGCGGTGGGCGT TAGTCGGTGGGTGGTGGGGCGTGTCGGTTGATTGCAAATTGGTCCATGGC CTGTTGGTGACGTGTCTTTGATTACGCCGCAAGTCGCTGGCGCTGTCATC GTGTTCCCGGATTCTGGCTTCTGGTTTCTGGCTTCTGGCCGAGATTCCCG GACTCCTTGCTGTTTGTTTTTAATATAAATGCAAATTTCGCCAACGGCAT TCGCCCGGAGCCGTGCTCCATAGTACATATGTGTGTATGCGAGCCTGTTC CGGAGATCTGTCATAATTAATATTTTGAAGCTTTGGCCACGGCATCACAA TGCGTGCGGATGTCTACAACTAGTTGCAGGACGCATATTAAACAGGATAG CCATCCGGCACTCAAAGAAAATCCCTCAAAGTTAATTATAATTTTGGTCA AAGATGATATTGTGCATTCTCTCTGAAATCGTACATAATAAATAATGAAA TAATAGCAAACGCAATCTAAAATAGATTAAAATCCACTATATATTTAAGA AACAAACCTTACTGCAAATATATAATATACATAATAATATATAATAATAT TAAAAAGGGTCATGAGGTAGACAACCACTAAAAACTTTCCATTTTAGACA GAGCTTTATTTGTGAAATTAAAAATAAGAAAGAGCTTCAATTACCATAAA TCGAATAACACATTTTTCCGAGTGAAGGCCACACAATTACGCCGCCGGCC TATGAGCAGTTTTAATGCAATCTAAAGTTTTTGACAACCCCTCACTTCAG TCCACTTTCATATCTGTGTGGTGGGCCGGAAAGGATCACCGCCCAGTGTC CTGTCTCCAGTGACCAGAGTCCTGTGAGCTTTCTAGTCCTTTTCGAGAGC CGGGTGAGGGTTTAATTTATGACTTGCAATTAGCAGTTGGCAAATGTGTA ATTTTCATAGATGCAGAGCCCTTTCGGAGTTGATATATAATGATAGGACA TGCCTCCACAGGATATTTCGGCTAATCGAGATTTGAATTTCCAGCCATTT CGGAACAAAGGGGAGTTTAAACTTTTAAGTGGAAGAGAATTGCCCAATAT TATGTTGCCATTTAATTGTGGTTATCTGAAGCGGTCCAGAAAGTTTGACT TTCAGGATATGTTGCAACCAATTTGTATCAAAATATGAATCCAAAACTGG GTCAGCTTATCACAATAAATTGAAAGTTTCTATGGAGTGCCCGATGAACT TTAATCTGCGTCTGAACAAGTTTTTCATTACAACGATTTATGGTTGAAAA TAAAATCAGCAACCGACCCGCAAAAGAGCCAAAGCTCAGCACTCGAGATT CCTTAACAATTCAACGCACTGCAGCAGTAATTTCTCCGCTCCGGACATTC GTTTTCCGTAAGCTGCAAGGGCAAGCTCAAATATTTATAATGCTGTCCAA CACTTGGTTGACCACAACTGCTGGCCTGGCCAAGAACATTGACCGCAGCC AAAAAATACACAAGAAAATAAACAAAAAACCCAGAGTGTTGGGCGGGCAA TCGATGGGGAGGGCGAAGCGGTAAATTGATTTTTGTATCTCCTCGAACAA GTTGAACAAGTGCAGGATCCGGGTAAAAGGAATAAACGTATCCAGAGTGC TCGCACACGCCCCGATAATTATGAAATTCGAGGCAAAGAAAATCTACAAA AAACCCAAAAATAAAGGAAACCAAATTTCTACAGAAACAAAAATCAATTT ATGAGGCGAACACGCCCCAAAAACTTTGCAGCAACGACGTTTAACTGCAA AACGCCCAATTTCCAAGGCGTGTCCGAGCAACAGACATTTGAAAGGATAT GTGGCGAGGCAGCCAAAGGACAATGCCTGGCCGCAACATATGCGAAAGGG ATAATAATTCACTGGCCGAAAGGCGATGGGAACAATGGTCGCATAACTCA GGCGCGCCAGATGAACTAAGGACATACATATATAGTATATGTAGGGATAC AACGAGCTGACCGACCGCATTATGGACTTGGGATCGCTTCTAATTCAAAG GACACGCGCACAGCGGGATGTATGCGATGTCCTTTTCGCCAGCGTTTGAT GTGCGTCGGCGACTAGAAATTGACGTTTAATGAGCACAGTCCTCGCTCCC ACGCAGCACCGATGGGTGTTTTATTTGAACACTGGAAAAATAAATTCGAC TCAACTGCGATTTTCCAAATCAATAAGACTCGATTTGCTCTTAAATGACT TATGTTTACCTAATTTAAATTTACATTTTTTGGAAATGCTGTGCACTAAA ATATAAAAATACTGTTTATTTAACTTAACCACTTTTTTCTCCTGTTTTTC ATTGCTCTTTTAGGGAAAGTAGGAGATTGCATCTGGACCTATCCATACAA CTCTCTATATTTTTTCTAGGTGCATCCTCTTACATAAATCCCGGCTAGCC AGGACCTCGTTTGTGCAACACCTTTTGTTATCGCCGAAAACACTTGTCCT GTGAACCAGGACTCCTTGCTGCCCAGTCGCCTGGCAAATATCACATTGTT ACCTGGACTGTCCCATGTTTGTTGTCTGGCCGTCTGGTCGATGGGGGTTT TCGATTAGCTCTCTCTTACACATATCAAAATCGGACGTTAATTGTTTTCA AGTTCGTGGCATGTCAACAGCTCCAAACACGTCGCCGGCTTCACCGACGT TTTCTGCTCGATTTATCTGTCTAGCCGGCTAAATTTTATGGATTTGTTTT GTTTGCCAGCACTGAGATTTCAACAATTACTTATGAATCATGAATCAAGT CGGCGAGACTTGGACTTAACGACTGGTTTTAAGGAGCGCTTTAATGCGAT TTTTGATGTGCACATTTTCTCCAGACTAGTCTGCAATCTTAAACCAACCA TTGATTTAACGAGATAGCTAAAAACAATATTCCATTATTTACGAATGTTA CGATTTAAGAATTGTTAACTAAAAATGAAAGAATTCATTATAAATCCTAA CTACTATTTTTAGGAAGTAAATGTAAGATCGCGAGCATTTGTTAATCCAT AACGAATATTTTAAAAATAATTTGTATTTTCTGCTTGTAATTTTTTTGTA TGCATCTGACTGTTTGCTTGATTTTTCTATTAGTGAGCAATTTGTACATG CTATTAAAATCACAGCTACCCCATTCCACTCGTTTTAAAATCGCAAATCG CTTGACTTTTGCGCTTTTGTTTGCCCTGCCAATGAATTAAAATCCCCGGC ACTCACGCAAACATATCGGCGAAAAACAAACAAGTGCTGAGGCGAGACAA GGGTCCTTCAAATTGACCACACTGCGGCCAAGTACTGGTCGCATTCTGGC CCTGGAGCACCAGCTGTTGCGTAGACCCACCCACTCAAAGTCGGACCAAC CATCCACCACCCACCACCCGGCACCTTGCAGCCACCACAAATTCCAGCCG CGTAACAACCAACTGAATTCTAATAACTTTAAACACAAAACAAACTTCCT GGCCACATGCCTCATGCCCATGCACTCGCGTATTACAGAAATTACAATGA GCGAGTTTAGAGAATTCGTTTCGAAATTTCACGCCACCGTCTGTGACGAA ATTTTTTCTGTTTAATAGCAAAGGACAAGTGCAGCCAGGAGCAGGATGAG TCATCCCCTTTCTGTTGCGTCCGGGGGCAACCCTCGGTGGCAAGTGGAAA AAGGTTGCAACACGAAACCTAAACCGAAAAACTCAAAAAAGCATCGCAAC CCCGTAGACACAGTTGCCACTTTTAATCAGCATGAAAGTTCCCGTTCCCG TTCCCATTCTCATTCCCAAACGGCTGTTCAGCTATTTAAGGACCCCGGAG ATTCCGATTCCCCCGAATTAAAACTCAGCCGAAAATGAAAATTTCTATAC TGCGTTAGTTTGCCTTTTTGTTGAAGGCGAAATAAATGAATGCATGAATT CCAAAGCAATTTTGATGTTGACATTGAGTAATGTTGGTTCCGTTCAGCCT GGCTGCTTTACTCTGGATCTATGGATCTCTGGATTTTTGGATTTTTGGAA TCGGGTTGCTCCGGTGGGTGGTTGTTTGGTTTGGCATTTTCATATCATTT TCGAATATTACATGCGGATTAGCATTTCCTCATCGGGATTGCAACAAAAC GTGTGCCCATCTATTGGGGGGGTTTTTTGTGGGGTGTTTCGCAGTTATGG AAGGGGGAGCGCTCCATAAAAGGGGGTGGTTCGCTGCACTGGGTGGGTTT CGGTGGTTTGGCCTTTGTCTGGGGGGAGTGTGCTGTCGATTACCCACGGA AGGTGTTTTTTAGTGTTCTTAAAGGCCTTTGTTCGAAAGAAATTAAAGTT GTAAGTAAGGCGTTGAGGAAGTGAAATTGACGCACAAAAAGATACGAATA ACAATGAAAATGTTTGAAAAGGGGTTCATACATCGCATACATCACAAGCA GCGTTTAAATTCCTTTATAGCCAATAAATAATTAGCATATTGTTTAAGGA TCTTTAAGGTAAGCGTATAAAGCATCGATGTATTGTCAGATGTTCCTTAT ACTACTATATTTAAATTATTCCTTACGTAATATAGCTCCTTGAACCCAAA AACTCCTAAGCTATTCAAAATGAAGCTGGAGAACACCGCATTGCACTCAT AGTTCGCAAAACTCAAATAGCTTTCGTCATTTTCGTACTTAAGAAAACTT GCCATAATCCCAGCATATATACCTTCAACAACTTTTGGCTTTTACAACCC GACTTTCGGACAAGTTTAAGGAATTTCCCAAATCAACAGCCTTTCAGAAA CCGAACTAGCACGGGAGGGGGGTTTTTAGGGGGGCTGACGGAAAACCCGG GCGTCGAACTAACTTTTCAATTTTCTTTTCACGCTCGCATTTTACAAGCT GCTACATGATTAGGGTCAATGGTTGCAGGCTCCCTACTTCCTCGCTCCGG TGGAAAATTGTAACAAGCTGCCAAATTTCACACTCAGTTTCTGATTCTGA AATAACTCAAACGAACACCTAACGAAGTAAAACTTTGGTGAGGGGCGGCT GGGAAAAAGGAGGGGATTTGTATCTCTCAATCTTGTCATCACTGCGATTG TAATCATAATCAAATTCACTGAAAATTTTATTATTAACTGTGAGTTTATT AAAAACGCATTGGGTTGCCTGGTCTGCTCTGATTTGTTTGCCGGGATTAC TGTTTGCTTTTGGTCTTGTTTGTTATCGAGATCATGGACACATGTCGGGG ATGGCTGATTACTGACGCTAGATAAATATTAAGCAACTATGTGGAGTGTT TCCTCTGCCAAGATTCGAAGAAGGATTCGGATTCGGATGACGACATCATC GTTCGCTTCCTTGCAGTAATTGACTCTGTGCCAGAGGGCACAAAACTGCT ACCCCCAAAATGGTAATGAAATTTTGGGTTCGAGTGCTATCAGCATATAC ATGTACATGGGGGAATCCCCCCAGCCAGCCAAACTCCACTCGAGTTGTTA TTGTTGTTGTTTTGGCACGTGGCACGTGCAACGTGGCCAGGAAATGCCCT GAAATTGATTTTTATTTTTATTTTAGTTGGAAGTCTTCGCTTTTTTTGCT CCTCTTGCCCCGAGGTCTTGGCGTAATTATTTCTGTCCGCTGTTCCAGCA TGTGATTAGATTTTCCAGTAAAAGTTTACTCAGCTTTTGTTGTCGCTCGA TGATAATTAAAAATGATTAGCTCATAAATATTTCCTCCTGTCGAGGGTGA GATTTATGTGAAGGTAAACAAGGAGACAGCAGATGCCCCAAGGGCAAAAG AAAAATATATTCCACTCAAAAGTAATGCTCATGGAGAATTTAGGGGAGGC AATTGTAAAGTTTGTGGATATGCTAATAAAAACGATTCAAATTTAAATAA GTAATGTTTTATTCTGTACTTTAATATTTAAAGATGTATTATATCGGCAA TATTATCACAATTCGCGTCCATTGCATTTATCTGGTTCACTAGAGTTTAT AAAAATTAAAAATTATAATTGGTATATTAAATTACTTGCATGGATTCTTA CACAAACACTTTGTAGCTTCAAATTCACAACGGGTGATATTGCTCCACTT GGACCCAATTTCCTGGCTGCAGTTTCGATTCAACTCATTTGTCATTCTAT TGAACTTTCCCATTATGATTTCAGTTTCCTGACACTTTAGCAGAAAATCA TTGCATTTGAATAAATCCCCAAAATAGTTGCCTTCACTTGCTACAAAAAC ACTGACAACTTTTGACGCGAAATAGGTATTAAATAATATTAAAGCCATAT AGTAAAGAGGCTTACCGATCAGCACCGATACGATTGACATCTTTAAATTA ACTTAATATGAGTTCCCATTTTAACTGCATTTATAGAGTTGGACCTTAAA ATTACTTTGTTTGCCTTTATTAACTTTTGATAAAACAATGCGTTTATTGC CAGACTGTTATTGCTTAAGCTTTTGTTAATATCTTCTGTTGCTAAACAAA AGAACATTTTTTATCCAGACTTGATTACAATTCCAAGACATCTGCAATGT TGTTACAGGACATATCATCACAGCGTCGAAAAATCACTAAAATATAAAAT CAGTGAGCGCTGAATAAGACTTAAATTGAAAATGTGACTCACGAAGACAG GTGGCTTTTTCCATTTCACATCGAGACACACTGTTCCACCTTCCTCTGCG CTCCCGACGACAATGACGATTAAAGGAATCTATAGTCTCATCAAATCGTC CTATTCTGGATGTAAATCGTTGACAATCGTTATAGATATTCTCACAGTAC ACTCGACTCCATTGAGCATCAATGTGGCACAATTGCAGGATACAAAGAAC TGCAAAAAAAAAATGTGTTGTTAGAAATATAAACAATCGTTGACAAAATA AAACTCTTACCCAACAGCAAGAATATTTTCCACATTTTTAAGTTTTCCAA TCTGATATGATCTACACTATCTGCGCGGTTGTATTTATATTGGCAATCGG ATCAAGATTTCTTACCATGATAAAAGGAACACCTTTTCCCAGTTTCATTT TATTCAGATGATTCTTTTGTTGTACATGCTAATCGATGTCAGTAGGACTA TCCTTGCTCTAATTTGACTTTCATTATTATACAAGTGTTTTTTCTCTGTT CGCCCGTGTATAAAACGAGTTATCTCAGTTTCCAGCTATCAGTTGTAATA AAAATGCGGTATCTGTGCGTTTTTTCCTTAACACTTATCCTTTGCTGCCT TTCAATAAAGGCTCAGAGCTTAAATTGCACCAGGCTTCGAGAAAATTGTC GTCCTTGCACCCGCCGCTTGGTGGATCCTATTAACGACCTGGAATTCATT AATAGCGATTGTAGGGAGAAACTTAGAGGACGTTGGATTTGGCGGGATGT AAGGCGTTGTGATATGCAAATTGTTGCGTGCGAAAGTAAGTATAATATAT ATAAGTATTTAAAAAGTATAGTATATAGTATGAATGTTTTAAATTGCAGA TCATGAAACCCGACTGGATTGCGAGAATGTGGCTAGACTAACAGGCATGA GACGGATTCGTTGATTTTTCTTAGCTCTTGAGAGAAATTTAAAGCTATTT GTCTTTTTAAACAATATTTTTAGACATAAATAAAGAATTATGTGTGTACG AGCAATGTAAGTACTTGTGTGTATTTTATTTTCCGCAAGTCCATAGTTGG ACAAAATCGAGCTAAATCAAGCTGAAAAACGACCTTTGTCCAAGTTTTTA ATATATATTGTTATCTATCTTCTACTTAGCAAAGGTAACCAAAAGAATAA CCTATATTTTGGGATTTGAGATTATTAAAATATTTCATTAAAATATTGTA GCAAGAAAATATACATTTATTGAATTACAAAATATATCAAAGTTTTGCAG AAAGAACAACCCATTCGATTGCAATATTTAATGAGAGCTAGAACTTAAAA TATTACTTTTAAATAAAAATAAAGAATACAAAATTGAATCTTGTTAAATA TCATTTCTCGCTTTCAGTTTATTTAGGGTGGTTTAAAATTTTCACCAAAG ACGCATGCGGTGGGCAACATTCTTGCAAGTCGGTGTTTCGCAATCGCGCA CAGTAGCTGAATAATTAGAAAAATATTATATTTGGTCCTTCTTAAGCTTT TGGAGATGTTCACTCACATAAACAGGCTATTCGCAGAAGATCACATCGGC TAACATCTGACCATCCAGAATCCGAACGGCGACAGTAGTCGTTAAAGAAC TTTGAAGTATCGTCCTGTTTTCCCAACCTAGCTTCATTTTCAATACACTT ATCGTAGGTGCGAATGCAGATTTTATGACGCCTGTTAGCTTCTTCGGGAT TGGCTTGTATGTGAGCCATAAACAGGCACACAATAGCTGTGAGAAAGTAG CTTTATTACCACTTTATAAATACCTATTGATAGAACTTACCTAATGGCAG CAAAAGTTTTAACATGGCGTAACGCTTGAAATAGTTTTAAGGTCTAAACT GGCTACACTGGAACGTGTCCCGTGGTATTTATACCCATAACTATACACTT AAAGCTGTCATTTGTAATTGTCCAAAAAGCGCTACAGAATTAATTAAAAA CCCAACTGCATTAAACACATGTATTGGGATCATATCTGTTTCTTTGTCCA GATTCAATGAATAATAAATTCTTTATGTTCAATAAATTGGGGACACTTAA GACCTCGCTTCCTTGTTGGCCATCATATATAAGGCCCTATTCTGAATATG GTTTTATCAGAGTGTATATCACCAATAAGTGATTTGAAAATGAAGTTGAC TGTCTGCTTCCTGGTGATCCTGGGCTGTGTGATAGTCCATGGCCAATCGC CCGACTGCAAGGAAATAAAGGATATTTGCTCGAAATGCATCCAAAGACTT AATGATCCCTACAACAAGGTGGACTTCATAAATAAAGGATGTAGAAACAG AGTTAGAGGCAGCTATGTATGGAAGGACCAGAATCTTTGCGAACTTCAAG CGATAGCTTGTTCGGGTAAACCAATATCTTTTCATTAACTTTAAACACTT TCATCAATGTTTAATTGGTTATTTTCAGCTCCGAATCGAGCAATGAATTG TGTTGTCATCGCCGATGTTGCCAAAATGCGCAGAGTGACTCCAAGACCTC CAGGAGAAGTGCATACCAATCAGGACCCGCTGGACGAGGTTCACACAAAC CAAGATCCACTTGATGAATTCATGGTGTCCAAGGGCGAGGAGCTGTTCAC CGGCGTGGTGCCCATCCTGGTGGAGCTGGATGGCGACGTGAACGGCCACA AGTTCAGCGTGCGCGGCGAGGGCGAGGGCGACGCCACCAACGGCAAGCTG ACCCTGAAGTTCATCTGCACCACCGGCAAGCTGCCCGTGCCCTGGCCCAC CCTGGTGACCACCCTGACCTACGGCGTGCAGTGCTTCAGCCGCTACCCCG ATCACATGAAGCAGCACGATTTCTTCAAGAGCGCCATGCCCGAGGGCTAC GTGCAGGAGCGCACCATCAGCTTCAAGGATGACGGCACCTACAAGACCCG CGCCGAGGTGAAGTTCGAGGGCGATACCCTGGTGAACCGCATCGAGCTGA AGGGCATCGATTTCAAGGAGGATGGCAACATCCTGGGCCACAAGCTGGAG TACAACTTCAACAGCCACAACGTGTACATCACCGCCGATAAGCAGAAGAA CGGCATCAAGGCCAACTTCAAGATCCGCCACAATGTGGAGGATGGCTCCG TGCAGCTGGCCGATCACTACCAGCAGAACACCCCCATCGGCGACGGCCCA GTGCTGCTGCCCGATAACCACTACCTGAGCACCCAGAGCGTGCTGTCCAA GGACCCCAACGAGAAGCGCGATCACATGGTGCTGCTGGAGTTCGTGACCG CCGCCGGCATCACCCTGGGCATGGATGAGCTGTACAAGCTCGAGGGCAAG CCCATCCCCAACCCCCTGCTGGGCCTGGATAGCACCCTGGAGGTGCTGTT CCAGGGCCCCGAGAACCTGTACTTCCAGGGCATGGCCAGCAGCCTGCGCC AGATCCTGGATAGCCAGAAGATGGAGTGGCGCAGCAACGCCGGCGGCAGC GGATCCTCGGGAAGTTCCTATTCTCTAGAAAGTATAGGAACTTCGTCGAC AGATTATAAAGACCACGATGGAGACTATAAAGATCATGACATTGACTACA AGGATGACGACGACAAGTAATAAATGTAGCATATGGCCAAAGCATATGAT ATTCACTTTCGGGACTGGATAATATTTGTTTCTCATTTTCTTGAAGCAAA TATATTGAAATTCAATAAAATGCATTTATCAGGAATTCTGTTTGTTTATA TAGATTTACTACCATTGCCAACGCTTTTAAGGAGTATAATATAAATCTCA CAAATATTAAAACAGCTAGCGAAGTAATATATAAAGTTAACTACACTAGA CTTGCAGGCTTAATTACGACAAATGTAATTCATGCTTATTCACGTTCTAG AAAAATAATTAACTTGGAATAATTATCTGTTAAGTCAAAGTCCAGTTAAA GTTAAAATTTAAATCAATACGTTCAATATTACATTAACACAATATTATGG ATCTCCAATTCTGGTCAGATATTTATAGCACATATAGAAATAAGTACATG AGTAACAGCTGTGGAATTGCCTTGAATATCATTACTATATATATAGCGGT ATTTTGAGCAAATAATTTTCCTTTTCCGATTCAAATGAAATCAGATTTTT GTAAGTCCGATATAGTTTGAGATTCGCTTTGTGGTTGATTATCTTATTTG ATGCGCGTCCCCAAGATGAATCTATTCAAATGCAATGTTTCTAACAAAGA TTAAGTTTAAAAAATACTAAGTATACGGTGTTAGGAAAATAGATTGTTCA AAAAAGAGTTAAGCAACTTTCAGCCCAGTAGAAGTTTACGTTTTCATTGT GTTATCATAGGTATACAAAAAGCTTATATATTATTTACTATATTCTATGC TGTAAATGTTCAATTCATGCTAGCTTAACAATTGTTATCAAGGCAATTGC TTAAACAAATATAAATAACTATAAACAGAAGCCAATTATTGAAAAGTGGA AATTAAAATCACTTTATTTGCTCTCGTTGAAAACCTTTCTTTTAATTCGG CTGACAACATATTTATTCAATCTCACAAGAGTAAAACAATGCAATTTATT AAGACCGCAGGCTATCGGCAACATTTTTGCAGGACCCATTTTCGCAGCGA ACCATAGTTACTGAGGAGCCAAAATCTTAATAAACATCCTATAAAATAAA TATTAAATTTACTTACCTATGCACGAGGCTTTGACCAGCTCACAACGGGT TAATTTCCTCCAGTTTCGGTTATTTCGTCCGCAATATGAATTGAATAGAT CCACCGTATCATCTCTTGTTCCCACGGTTGGCTGTTCACGAAGACAGTTG GCGAATAAACGATCGCAAAATTGGCGACCCGAAGCTTCCTGAGTTAGGAC CTGGCACATCAATATGCAGCAGAAAGCTAAAGGATTGGAATTATAAAACT AAGTATTCTCCTTCATAAGGGTAGCTTACCCAAAAATACCAGAAGTTTTG ACATTGCAGAAGTTTTTGAGGTGAACTTGATAACTACTCTGACTATATCG TAGTATATCGCCCTGTATTTATACCGTAAACATCGATCAAGGAAGAATAC GTTTACAATTGTAACAGGTGTACAAGGGCTTTATCTTTTTTACAATTTTA TATGAACAATCCAAATTCAATAGGTCAGATTCATCTGAAAAACAGATGTG GTCCTATTTGGAACATAACACTTCCTTGTTTCCAACTTATATAAAGCTGA GATTTTTTATTTTAAGCCAAAAGGAAATCTCTAGTTGATTTACTTGCACA CAAGCTTAAAAATGCAATTGACAAGTATTATCTGCGTCATCTTGTTCCTT GGCTGTGTACTTATTAATGGACAAAGTCCCGACTGCCGAAAGTTAAGGGA CACTTGCAATCCTTGCATCCGAAGACTCAATAATCCCATCAATAATGTGG AGTTCATGAACGAGGGATGCCGTGAGAAAGTCCGTGGCAGATACATCTGG AAGAATCAGACTCGCTGCGATCTTCAAGTGATCGCTTGCAGTGGTAAGTT AAAAAAAACCAATACTTTTAAAAACCAAACCAAAAACTTTTGGAAACACT TTCAAAAGTGAAACAAAAAATTCGATTTCCTCAAATTTAAAATATATGAC ACTGTCACTTACCTTTAAAGTTTTTGGCATGGATCTTTAGATTTTAATTT AAAAATGTAAATACATCTTCTGGACTAAAAGTAAATTTAAAAACCAAATT GATTAAATTTTGAGGACAGGAGAAAAAACTATTTCATTTACTTCACAAAT CTGTTTGTTTCGGACATCAATCTACAAAAGTGCATTACAATTTTTTCCTG CATTTGCAGCTCACAAGAGGAAACTGGATTGCTTGGTAATAGCCGAGCTT GCTGGGATGCCAAGGCGAACTTAGAAGAATGCCCACCAGCATTGTGATTA CCACAAGGGAGCGCAGCTAAAATATTAAAAGTGATTTTGTCCAAATAAAT GCATATGTGAAGAGATTTGACTTGGTTACTCTAGCTTGTCTGTGCGGCCA ATAAAGCGATATGTTCTTGTCGTAGTCGCGGTCTTGGCCTTCAATTTTTT CTGGGCCCTCAGCTCTCAGCCCTTCCAGGAATCAACAGTCGCCCGACCAC GAGAGCATCTTCCACGTACGGGGCATTATCGTAAAGACGGGTCCAGACCA GCATCGCGATGAGTTGAGCCAGGCACGCACATCGTGCACATCGTCATGCT TGTCTTACACTTGATGCATCCTCGTCATCTCGTCTGGCAGTTCCTCAAAA CTTCTCACTCCACTCCTTCTTACTCCAAAACATAATTTTTCAAACGAAAT GTTTTTGATTTTCTTGATGCCATAAAAAATGGTAGTTTATTATTTGGCTG TCTGAGATTGCAGCCAATGCTTTTGGTCCAAACGCTAGACGGGAGTTCAT CTGAAGATCCGAACTTTAGGGAAATTTTCCATGCTACACGGGCAAACAGA GTGGCGCCTATTAATACATGTCCCAAAATTTGCAGCCGCCCGAGTTCATG TCTATAATTACATTTTTCCTACAGTTATTGACACAATTGGCATGTCAACT GGCGCATTCTAAACGGTATATAAGTTCTTTATGGAGGTATGGATGCAAAC AGTTTCCGACAACTTCCTAAAGGGGTTTCACCATGAAACTAACTGTGGTC TGCTTAGTGGGTAAGTTGAATTACTAAAATGGATAGATAATTTAGCTAAC AAGATCATTTTAGTAAGCTTCTTTCTGCTGCACTATGCAGAGCACAGTGA TGCCTGCTTGGAGGTAATTGAGAAAGCGTTGGGTCTCCAACCGTGCAATG AAGGTGGTCGCAACGAACACAGGGAGCCTCACAGGGGTGGACCAGGACCT GTGAGATCTACTAGGAGGCGCGGGAGAATCCCTAGGAGACGTGAGACACC AAGACCAATACATCACAATACCAGAGAACGGAGGCATCACACAAAAACAA GGAAGCCTAGAAAACCCGTTCCTTGTATTACGAAGAGGACGGAACCTCCA CCGGTTACAGATTTTACTACTCGAAAATCCAATCCACCATGCACTTGTAC TGAAAGCACTACTCGAAAGACAAATCCGACTTGTACTTGTACGGAAAGCA CTACGAAAAAGACAAATCCGACTTGTACTTGTACTGAAAGCACTACTCGA AAGACAAACCCGACTTGTACTTGTACAGAGAGCACTACTCCATGGACGGA ACCACCAGTTACAGATATTACTACTCAAAAATCCAATCCACCATGCACTT GTACTGAAAGCACTACTCGAAAGACAAATCCGACTTGTACTTGTACTGAA AGCACTACTCAAAAGACAAATCCGACTTGTACTTGTACGGAAAGCACTAC TAAGAAGACAAACCCGACTTGTACTTGCACAGAGAGCACTACTCCATTGA CGGAACCACCGGTTACAGATATTACTACTCAAAAATCCAATCCACCATGC ACTTGTACGGAAAGCACTACTCAAAAGATAAAGTCGACTAGTACTACTCA AGGGACTGAGCCACCAAGCACTCAGAAGACTCTTCCACCCAATCCACCAA GCACTAAGAACACCGAACCACCAAATAGCACTCCTCCTCCAGAGAAAACC ACCCGAAAACCATGCGGATGTAGTAGCTCTCACCCGTCTGGATGGAATCC TGGCGGTCCTATAATCCCAAGCTTTTCAACGACTACCAAGAAACCGGACG AATGTTCGACAAAACCTTCAGGTTGGAATCCCGGAGGTCCGATTGTGACA ATACCAACAACTTCTCGAACGCCCTGCGGGTGTGTCTCGTGGAATCCACC AGGTTGGAATCCCGGCGGTCCTTGGCCTCCCACATTTCCCGGACCTTGCA GACCAGGACCTGTCATTCCCAACAATGCAGAATGCGGATTCGATCCACAA TGCCCACAAGGCTGGAATCCCGATAGTCCTCTATTACCCGATCCCGAAAT TCCCGGGAATTTTGGACCCGGACCTGTCATTCCCCGCAGTGGAGAAAATG GATGTGGCTGCTCCTGCTCGTGATTTGCATGTCCACCATTGATGTCCACC AAAAGCGGAACTTAGGAAAGAGCTTCGTATTACCGTGAATCGAATACAAA TACTGATGGAAGATTGCATCCAATAAAAACCATGTTGATTGAAGAAGAAA GCTGACAACACGATCTATAATTTTTACCTAATTATTTTTCATTGAATTTT ATTGCTTTGCAATCAGACATTGCGGGACCCGCCGGGATATGACGGTACAG GTCAGCGGGACAGGTCGGCGGAACACTTTGGTGGGACAGGTCGGCGGTAC AGGCCTGCAGGACTGATCGGCGGTACAAGACGCGGGACACATCGGCGGGG CATATAAAATATTGCGAAAATAACTCGTAGTCCATTTTTAAATAAGTTCA AAATCAAACTGAATGTGGTAATTCTTTGCGCTTTTTGGATACCAAATATA CCCACTACAAAGTAAGGGCATGGATGGTGATGATTTTCCACTCAGCCTGT GCCAACTGCTTATATAATATTTGAAAATTGAACATTTGGCGCTGCACTTG AGAAATGCTTAGACCAGGCCATGATGATGAAGTTTATAAAACTCTTGACC ACATTTGCCGCACCCGTCGCCTCGCCACTCCCCTCCCGTTTTGAAAAGTC TTTCCTTTTCGTTGCCTTCCACTTTGGACATGTCTGGCCAGCTGACGTCG GAAAATGTGGTTAGAGAAGAGGTCCGAATGGATCGGGGTTGGGGATTTGG AGATGGTGATGGGGATGGGGATGGGGTATATGGAATGCATTGCACTTGAC TTTAGCGCCACTTGTAAGTGTAAATTTTATTTGAGCCAGCGAAGTAGGTA CACATGTAGACACTCACATTCAACAGCCATGCCCTTTGTCAAGAGAGCTC CACATCCAAAGTGCCTGGCCAGCGATATTGGCGTTCGCACTCGTACTTGG TCTGGGACTTGGAAACATTTTCGACTTGGTCTTGGATTCGGCTGGGGAGC AGTGGTTTCGGTTCCGTAGCCGGTTTTTTGGACCGGAGTTTGGCGTCGTG TCGTTGACAGCTAAGTGGTGATAATCGCTTTGGAATTGAATCTGAGCAAG TACATTCACAGGCAGACGAAGTTAAAATTCAAAAATGCAACAGACTAAAG ATGCAAGAGTTTTGGTCAATGGCCATCGGACAAAAGGCGTCACTCGCTTT GCCTTGGTCTGTCTCAATTTTTGGGTGGGCGTTTGGGCCTTTGTGTTTTG GTTGCGGCTTTACTAGCTACTACGGTTTCTTTGGCTGGTTACTGTGGCTT TAATTTGGTGAACTGAATTTGCAGCATCACGAAGCGAATGGGCTTGATTT AAATAAATGCTTAAAGTCATAAAATTATGACTTGAGATGGTAAATGGAAT TAAGTTCGTGAAAAGCACTTGCTTGTGATGAAGAAGTAAGTGTAAGTGTC CATTTCAAATCCTAGCAAACAAATTGAGTTTCTTCTCGTCTAAATTCTTG ATAATATATTCAAGTTGGTTTTCAATGCTCTCTGGTGTTTTTATTTTCAA TCAATAAACAAGCATTTTTATCATTATTAATTAATACGATCCATGCCAGC GAGTTCAGCAATATCATTACAGTTCATGCGTCGATTAGAACCTGATGGCA AATGAGATGGTAGGTAAATAATTATAAGTATATAGTAATGCATTCTTCTA CAATATATACAACTTACCCAAGCAGTTCAGCCTGGTCAGCTCACAACGTC CTACATTCCTCCAACGCCAATTGTTCCGAGTCTTAGTTCTGCACTCTTGA TTGAGGACGGGCAGGTTACGATCAGCTGCATTATTCAATGTTTCCACACA GCGTTCACATCTCCGGGTCAACTCGTCGCAGTTCCGATTTTGTCCAGCCA CCAAGACCACAAGCAGGACTTTAAGCCAGAATTGAAGCTAATTATTGTGG ATCATTGCTACACACAGTTAAAAGTCCTAGTACTTACCAGAAAATAGGGT CACAACTGCTGTAGTATGCATAATTTAAGTATTAAACTTTTTGGCTGTTG ACTGGAACTTATCAGTTAGGTAACTACCGAAGACTTTGACAGAACCTGAC TTTATATAAACACTATAACCAATGCGTAAGCAGATGTTTCACAACAAAAG GTAAAAGTTAAAAATATGAAACAAAAGCTTAACAAAATTGTTATAAACCC TATTCAAACCCTTAATAAAAACTGGACCATCTTTTGAGCGCATTGAAGGG CATTATGACAATAACTTCCTTGTTTAAATAAAGGGCTTAATGGATAAAAG CAACGTGGTTCTTATTCCGAAGGCTGTCAAGCACTTTATAAAAGCCCAAG ACCGAAGCACACTTATCACTGAAGTCAAACAAGTTGTCAGTAGCAGTACC AACATGTCGAAAATTACTCTCATTTTTGGTAAGGATATAGACCGCTATAC CATAAAAGATTATTAACCCTTATGATAACTATTTTAGCTATTCTCTGCCT TTGCGTGGCTGTTCAGGCTCAAACTCGTGAACAAGAAATTTGCCGTCAAG AAAACGAAACTTGCCGTCGAAATGAACGGAGATTGGGAGTTCAAAATGAT GTTTCGACCACATTTAATAATCACTGCCGCCGCCAGTCAGGCATTCGAAA CTGGCGAAATGTCTCTCGTTGCGAATTGTCTCTGGCTACTTGTCGATGTA AGTATCTGATTTGAAATAACTATATTTCATATAAAAATATAATATTTTAT TATCAAACTACTATCGATTTAACAGTGACACTCGAGCGTTGTGCTGTTAT AAACTGCAAAAATGTGAGAAACAGCATTGATGGTGGGGTCACCGCTCGCC CTCCAACTTCAAGGAGGACAACCCGGCGAATTCCTGACACCCGACGACCT CGAACTACTCGTAGGACCCCAACTACCCGTCGTGCTCCAACTACTAGATC TTCTCGTAGAACTACACGTCGTCGTGCTCCAACAACTAGAACTACTCGAA GAACTACACGTCGTCGTGCGCCAACTACTAGAACTACGACTCGTCGACCT ACTGAAGAATAACTCCTAGAACCATTTCATTCAGAGTAATATCCTGCAAA ATGTATCCTGCTGAAAAACAATAAAAACTTTAATGCTCTCAAATATAGAA CTCTCAATATTACTATAACAGGTTCTGCTTAAAAAACAAAATATATTTGG CTCAACAACTTTGATCGAACTTTTTTACAATATTTTATCATATCATTTTA TCATAGAATATTTATTTCATATATCATTACTTAATTAATATCTTAGGGCA TTGAAACTGTTGAATTATTATCAGCTTTATTAAATTCAGCAGGGGTTTCT TGTGTAACCGCTACGCTACTCTCTTCTACATTTTTTGCGGCAGTATCCAA TTTCGATGTGGCGTTTTTGTTTTGAGGTATTTCCACTCCAATAATGCTCA TTATATTCCTCGAACTTTTCCGGCAGTCTTCGTTCATCAGCGAGTAAAAG AGTATTCCGGCTAAAAAAACTCCAAGTATTATGCCAAGAAAAAGACAACC GATAGACTTTCTGGCAGGTAGTCCTTTGAATCAAAAATGTATTAATTTTA ACCAAAAATAGTTGAATAATATTTTCTATAATAAAATTCAATATTATTTG TAATAAGCACTCACCTTCATTTAGGAAGGGTTTACTTGCCAGTTTCCTAT TTAATTTTGATGAGCTTATTGGGATCATTTTTGGACAAGGTCTCTTTGGC GAATAAATTTAAAACGTGTTGAGCTCATTCTTTTCTTATAAAAATTAAAC GACTTTGAAACAATTGAGTAAACATACATTTTAAATGCATAAAAATTGAG CAGACAGAAATGCGCACGAGGTAATTTAACACGTTTCGTTTATATAATTA ATATAAACGAAGTTACATATATATTCAACTTTTCGAATATCCAATTTTGA GCGGTAATCGAATATTGTTTCATTGACTGACCAGTTGCACTAAGTGATAT CTATATCGATGTGCTTTCCATATCTAGATAATGATTGCGAAAAGCAGTTT GGAAAAAATATTATATATTGATTGTTTGTATAAGTAAGTTTTATTTATTT CATCAAAAAATTCTAAGCATATATATTGAGAGCATCGAAGTATTTATTTA ATTGCAGTAAAGACGGATTTTTTATAGATGTCGATTAAATGTTTCGAATC TGATCTTGGTATTTTATTGTGCAAGGGCTCGCCGGACATTCTCGCAGGAC AACGTGTTACATCGCTCAAGGGTCACTGCACAAAGATAACATATGTATAA AATATATTTTTTAAAAAGTGTTTATATATACTTACATATACAATTAGCTT TTGCGAGTTCGCATCGGGAGATTTCACGCCAATTTCTTTGTGTTCGCCGA CAGTTCTCATTGAAAATATTCGAAATATCGTTGTTTCTGCCATTTCTCAC GACCCTTGACTCACATCTGGCGACAATCCGTCTACAAATATCTCTATCAC TTTGGGCCTGAACGATAACGAAAAGGCAAATAAAAGCTAAATAAAAGAAT AAAACATATATTTGATAATATAAGTATTTGGATTGTGAAATTCAATTTAC AAATCCTTACCAATAAACAGAGTAATCTTGGACATCGTGAATTCCGTACT AAAAATCGTTTACGAACTGTTTTCCTTGAGCCCAAACATGAGCTTTTATA AAGTGTAGCCCGCTTTAACGAAAAACACCCGGCTTTTAATTTTTGATGTA CTTTTTTACTGACATCCAGGAAGCAAAATAAAAGGCTTATTCAACTTAAC AAAAACTTGTCCTAGTTTGAATACATTTCCTAAAACTTTTGCACCCTTTA CTAAAGGTTTTTATTTCTGGTTTGCCATATTTTTAAAACATCTGTCATTT CTGAGACATATTGTTTATGGTATTTATATAAAGTCCAGTTGGATCGGAAA CTTCTGTAGTGAGCCAACTGATAAGTTCCCATAGTGAGAGAGTTTAAACT ACAATAATGCGCCTGAAAACAGTTTTAACCATCTTTTTCGGTAAGTTAAA GCTGGAAATAATTATGATATCATATTTAGAACTTAAACATTTGGTTCTTA GCCATATCGCTGACTCTGGTTGCTGGTCAAGATCGGGACTGTGATGAATT GGCAAGGAGATGTGAATCCTGTGTGAGGCGTCTAAATAATACAATCGATC GCGATTTACCCCTCTTCAATAGAGAGTGCAGACAAAGGACCGAATTATCT TGGCGCTGGAGGAACGTCGGACGCTGTGAGCTCTCCAAGCTAAATTGCTT GGGTAAGTTTTGCACACAAAACTTATATGAATTTGTATCTTTAATAAACG TTTTTTATGCTATAGGTTGGCAATCACCCATGAACTGTGAAGACATTGCT ATGAGGGCTGGTATGGAACGCAGGCGTACTTAATAGTTATCCACTAATGC ATAAATGAAATGATTAAAAAAAAAATAAAAAGAGCATCGAAGTAAAAAAC TAAGTTATTTTATTTGTCATACAATTCAAATTTCTTCGCGCCACTTATGC ATCGCATATCGCACTATCCGATCTTCAATTTCATGTTCAACGTGTGGCTC ATACTGACCGTAATCTGTGTCTTGCTGATTTTCTGGATTTCGTTAGATAA ACGTAGAACATTTAAAATTTGCTGGACTTTCGATATATCATTCATACTAC CTTCAAGATTATCCATTCCAGTGGTATAATGATCAACGTACGATTCGACA TAATTATCAGTTGTAGCATCTTCTTGAGGACCTGGGTGGTTAGTACTGTC ATGGTTTTCATTGTGATAATCATACGACATTGTCATCTCATTATCACTAC TTGCCACATCCTCATCTGGCCGTGTTAGGTGATCATCTAAGGGCTCTTCT GGATTGAAATATTCTGCATATTCTGGTTGTCCAAAGTCTTTGCATAACAA ATGTTAAGCACCCGAAATAATTTACGAATATTCAGTTGACTTACCAACTA GCAGTAGAACGCAAAATAAATTAAAATTTATAATAAATCCCATGTTCTCC TTGTCGCTCAGATACTTATAATACTGATGGATGGCAGTAAAAAACATTGC ATTTACCATTTCGAGCTTTTAATATTTAAACAGCATGTTTCTTATTAAGT ATTCATATGTATGATGTTTACCTGGATCTATTTGCTTACCGAAAATTATA TTTACGATATCAAAGCTCTTAATACCCGGGCCAATTGTCAATAATTAAAA TAAATTACAATTTTTGTATTTATTCGACTGGTCAAGAAAACTTAGAAAGG TCATTATCCCCATCCTTTTTTTTGTCGAAATTCCTATGAAATACCTCGAT TAGTAGACAGTGGAAGCTCTTTAAAGAATTTCAGAAAGCTTCTGGCCATT CTCCAGCACCAGAACTTCACCACGGGCCCAGGGAGAATTCACCACGACCG ATCAACTTTAGCTAAACCTCTCACTGGTAAACAAAACTCGGCCAGAACCT GCGAGAGGAAAAGGCCAAAACAGGCCTGTCTGGCTCAAAAAATAAAAATA TTAATTAAACAAAATCTGGCGGGTAGGCGTTAATACGCGTAAAATATTGT TTAAACAAGAGACGAGATTCTGTCGCTGCCACTGTCACTCGATCTATCTG CTTAAATACATAATGTGATAACGAAGATTGCGGGTATGGGCATTAAACAA TCTTTCCAAACTGCGGTTCAGTCGTCAACTGTTGTCGCTGTTTTTCACAC ACAAAATACGAAATACGAAATACGAAATCCGACATCCAAAATCCGAAACC AAAGGAATAAAATAAATAATATATGCGCAGAATAAACGTTGAACAGACCA ACTAGTTTAGTTTGTTGGCGAGTTACCAAAGAAACGGTCACGTTTGGCGG CTTCAGTTTATATGTACGTTCTCGTGCCAAATTTCAGTAAATAATAAACT GGTACAGTGATTGATTGATTGATGGACTTGTTGAGTGAGTGAGCTGCAAT CATGGCTAATTACACAGTGGTGCGTGTGACAAAAGTGCAACCATACCTGC ATGTGGTGGACAGTGGTTATGCAGCTTTAGCCCATGTCGATAGCTTTTAT GCGCCGACCTTGGAGGCCGGATTACTGGATTTCCATGCAAATGGCACTGC GACCCATGCCAATTTAACGGCGGAAAGAGTCCTCGTCCTCATCGGCGAGG AAAACTACAGCTATCGATCGACCTCGACCATAGTCCTCATGGTTTCCGCC TGGATCCTGCTCATTCTGGGCTTTGTCTTCTGCTGCTGCGCCGAGTGCTG TGGCGTCAGCGTGTGGCGTGGCAAAAAGACACGGTCCAGCATCGATATCG ATGGCTTAAATCAGGCGGAACAAGGTGGAAATGGAAATGGGAGTGCCTCC GCCCGCGATGCAACTGCAGGTGAGTGCTTCAAGTTCGCTCTATCATCGAA AGCTTTTGTTTTGGGGCTCGTTTGCATACTTTTAGGCTGCCATCGAATAT TGATTGGCCTGGGGAGACTGGCCAAGTTCTCCCTTGCCTGTGGATAACTA AACTCATATTTCACGAGTATCCCATAAATGGCTACAATAAACGAGCAGCC ACAGGGATATCCAAGAATTTGCAAGTGTGCAATATACTCTACGATTCGGT TAAGCACAGAGCTTAATGGATATATATAAAATTCAATAAAAGCAGAATAA ACATGCTTATGTACTAATTTGAAATATTAAGTTAAAATTACGATTAAGAA ATCTAGAAAAGAGAACAACAAAGCGCGTAGATACATTCTTGATACAACTT ATTTCCTGATTCTACCAAATTTCACTTCGGTCGGGGTCGAAGTGCAGAGT ATAAAAATGCATTCGAATGGCCTGTCAATGCGCTTTGCTGTTATTGCTGA ACTACTTTTCGAAACAACACGAAGGGGTTTCTGTGGGCTTGAGAGTTGCT CTGCGGAACTGCCTGCTGCCTCATCGATATCATAAAATATTTAGCTATTT CTCTTATTTCGCTTCGCTCCGTTTTTGGCAAATTTGGCATGCGTTTTGGC TGAAAATTGGCTTTTGGCCAAGTTAACGAAACGTTCACAGAAATGAATGC TTCTACGCAAACATTCACACACAAATATGCCAGTCGGGCTTGCACATACA CAACGAAAATATTGCCGCAACTTTAAAAACATATTGGTATTTAGTGATTT AGTTTTAAAAATATAAATAAATGCTTTTTGAAAGAAATGCTGGCCCATCT ACTTATGAGTTAGGGGATTATTGATTGATCATTGTATATTTATATTAGTG CGATAGCATAAAATATTTTTCTCAGTGCACGGGCTGTAGAAATTTCGTCG GATAATTTGGTTGCATATGCTGCGCTCAATGCAGCTTCTGTTTGCATCGT TGGCAATTAGCATTGTCTCGAAGATATTGCGTTTCATTAGAGCGATATGT GTTTTAGAGTGTTTGTTTGCGCCTGAATGTGCGTATATGTGTGTGTGTGT GTGTATGTGTGAGCCAAAGAGCACAGCAGTCAATGGGTCATTTCGATAAC GGCAAAATTTGTTGCAAAATTTGTTTGGCATTTAAGCCAAAACTGGGATT TGTGTATTGTGTGGGGCTGCCAGAGCTTAAGTTGTTGCATTTCTGCCATG GTTTCTGTCGATTTTTGGTGTGCTTTTGTGTCCTGGCATTTCAACTTAAC AACTGATACCATAGTTGAGCCATTGTGAGTAAGCACAGATGATAGGTTCA AAGTGCACATAAATAGGGCTATGTTACGCCCATTTGAGTGTGCAAAATTG TGTTTAACTAAAACCGATGACTTTTGTTGCCTTGTTTTTTGATAAACCAT ACATTTGAATGAACCAGCAAGAGGTTTTCATATCTTAAATCTAAGATATA AGTACATTTTCTAAGCATGCTGTGAGATAATCATTTATTTCTACCTGTGC AGAAGCATTGGTAGTTTCAATTTATCAACTCGCTTATCACCTAGTTAGAT AAATTGCAGATCAATAATGCCACAACTAACCTAGATAACATATTTCTCTG TACCTACCTCATGGTGGGGCACAATCAATTTATACGCTCGAGCGCATTTG GCCCATTTCGATAACGAAATAGGAAGCATCTTAGTATGTCAGTGCAATAA ATTCTTCTACTTTCGTTTCGAACTGTGGCCACAAAACGTGCCTGGGTTCC ATAGACCTCCCCGACCAATAGTTGGCTAGTTAATGCCCCTGTTCCTTACT CCACTTTTGGCCCACACGGGCAACTTAAAGTCGAGAGCCATAAAAATTGC ACAAAATCACAAATGTTTTATGAAACTTTTTATTTTTTCATATTTTATTT AGCCTGACGCTCATTTCGCTGCACAAGTTTTAATAAAAAACTTCAGCCTC TTGTGCGAACCAACTGCAGTCGATGCCGATGCTCCCCGACTTTTCTGTTC AGGAATTCATAACCGCATTTCTCTGCCAGGCTGCCGGGCTGCGGGGGAAA ATCGAGCGGGGCAAGTCGGAAAACCAGGAGGCGCAGTTGTACATACCAAT TGCTTATGTATCGACAATACGGGGCTGTGAGTGCAGATCCCCACTTTTCC GCCCAACCACCCACTTGGGGTCCCAGCTGATGCGGCAAAAGCCCCGGCGT ATAATAAGTTTTTGTCTTCCATCGAGGAGGAGCGCCTGCCAAGTTGGTTG CCCCGAGTTGAATCTATAATTCAGTTTCGCCAGCTATTTTCTTTTGTCTT CGATGCGTAGACCACTTTAAATTTCCTTAACCAATTCGCCAGGAAAATGC TGAAGCAACGTGTTATAGTCTAGCATTGAATCCTTTCTATCGAACAAAAA AAAACTGTATCATATTGATAAGTCATAATTTAAGATTAAAGAAAGCTTAA AATAGGAAAGGAATTTTCGTTTAATCTTCTTTAAGTTTAGTGTTATAAAA GAATAACCAAAAATACACGTTTTTCTACTCCGCGAAGCAAGCCAAAGAAA ATAAGGCAAATTTTTATTATTTATGCAAGTAAAAAATGCGTAAAAATTTC TCTCAACTTTATTTGCTGTTTACGCGCTTCATTTACGTGAACCGAAACAC CGCCCACTCAGCTTGAAACCACCCACACCTCCCAAAGCCACCCACTGTCC CGATAATTCGTGTACATCATTTTTTACAGCCCCTCATCAGTTGGTGGCTC TGCTTAGTTAGTCTTTCATGGCACTTTGATTGCTCATTTGGCATTTATTT GATGATGCCAGGACCCGTCTGTCTTCGGGGTCCTTAAATTATTCATTGTG CGTGTGCGTGGTGGCTCCTGCGCCTCCTCGTTCGCCATCTAAGAATCTAA AACATCGTCGCAATCGTGCAATGAGCCTGGCGAATTTTTTTTTTTTAAAT ATTCATGTCCCGCCTTTGGCTAGCGAAAAGAGCAAAAAGGAAAAATGAAT TCGGCAGACAAGTCGCCGAAAACATCCGCGGACGAAGGCGACCAACTAAG AGTGCGTAATTTTTACCGACAGCGCATTGAAAATATCGCCCTCGGCGATA ACAGCAGACATCAAGGATTGGGTGTGGGAATGGATTTCGCAGGACTCCAT CAGGGGTTGGGGGTCACGGCGTTCTACGTGAGCTTGAAACTTGTACTTGG TCAGGACTCGGCCAGGCGGATTGGATTTGCACGATGTTTCAGCTGGAGAC GAAGCATAAAAATGCTTTTAGGGTGGATCTTAATTCGACTTAAAAATGCT AGGTCATAAAAACATCATTTTAAAATTTTTTTCAAGCTTAATTAGATGTT ATGTAATGATATGGTGCAGAGAAGTGCAAACAAAGCAAAACTAACTTACG AGCGGCTAAAAACAAATGCTTCGCTTTATAGACTACCAAATAAAATTTAA ATACAAATAATTTTTAAGAATTTTTTTTTTTTTTGCACAAATATATATTT ATAAAAAACTTTTACAAAGTTTTAAAGCAATTGAATGCCTAATATTTCAA GATAAGAAAATAACTAAATTGAACAATTTGGTTCACCCCAGCGATCAGTG CCTATGTAATCCACTTGGCCTGTTTTTCCTTTGACATTTCATCTAATTTG TATTTATTGTGTTGGATTTTCCTCTTCAAATTGCGCATACAATTTACATT TTATATTAGCGCCGACTACTTTGAGTATAAATTTCCCCGACACTACCAAT TTTTCAACATCATTCTGCCATATATTTTTTTCACACGTTCGATTATTGAT TGAACTGAGGCAATGAAAGATGTTCGCTACTTCAATTCAAGGGAGATGGA AATTCGTGCAATTTGAAATGCAGGTCAATTGCATTTGTTTTATCGAGGGG TGATTCTGCATTTGAAGCTGTCAATTTGCAATTTGATTAAGTTGAATTTA ATTGCTTTTGTTGTATAATTATAGAGTAATTGCAAATTGCATTGGTCTTA CTGTAGTGTCACTTATTTTGATAAATAATGCTCAATTTATTTTATAGGTA TGCAGTTTTTTAATTCGACCTTTTCAATTTAAAATGACTGAACAGTGTAT GTTAAAGTGGTTTATAAATGAATTTTGAGCTGCATATTGAGTTCAAATGA ATTAATTGATTAATTATAGAGTCAGAGGGAAAAGCAATGCAAAACAAAGG TACGTCATTTGAGTAACATTAATCAATTAAAAAGGTTAAATCAGAAAAAC AGTGTGTGCAAATGAATCAACTGATTTAATTATTTAACCAATATTTGGCA ACAGCTCCTTAATTGGCATTTAATGCTCCTTCTGCTTTAGCCGTAAATCT TGCACCCATTCAACCGTTTCAATTGCCCACTTAGCAGCCTTTCAACACAA ATTACCATAATTCGAGCTCTTTCTCCATTCTCTTTTTGAAAAGGATCACA CACACTTAACCTTTAATTAAGATACTCGAAAGTTTTCAATATTAAGCTCA ATTGTATGCAGTGGCGCCGCATTGTCGGCTCCCTTGCACCATGGTGCACG TTCCCATTTTCCGCTTTTCCACAGGTTCTACGACACGGGGGAAAACAAGG TGATCTAAATCATTGGAAATTAATTAAACTAAAGAAATTAATTTGCTAAT TTTTAAATCTTTTCTTCTTACTCTTTTCATATCATATTTAACGAATATTT ATTCTTACAATTATGTGCTTTCTTTAATAGGAATAAATTTGTATAATTAT CTTGTATAAACTAAAATGTTTTCTAGTGAATATCATTTAGTAAACCAATA TCGGCCATAAAAACATTGTTAGCTAAACTAATTCCGATTCCAAGGACTAT TTTCCCCAGTGTCCTGTCCCTCTTATGCCCATTACCATCCGACTTTCCCG ACTCACATCATCCGGTTCCCCATCGCACGCTCACATGTCAAGTCGTTGCA ATTTTCCATAACGAAATTAACGCCATGCCAGGCGGCGCTGCAAAGTATGC AACGTAAATTTTTGCGCCGAACCAATAAAAATAATTGAGGCAAAAGCGCC ACATGTGATGGGCGGTGGTGTCGAGGCTGCAAGGGGTTAAGGGGGCATGG TGGCTCAGGGGTATTGAAAATGCAGGGGGTCCTTGCTCCAATGGCAATTT TCCTTTTATTGCCTGACTGCCTGATGACGGCAGCTCCTCATTGCACAGCC CTTTTCAATCCGTCCAGCTGACACTGCACTCAAAAGTTGTACTCTTTTAT CAATAAGTTATGTATTTTATAATGTTGCAACATTTATGACAGGAAAATAA GACGTTTAGAGCCAGAACCTTATAATAACTAATTATTTTGTTTAATATAA TGAGTTTTCATAGTTTTAGAACCGACTATACCCACTTTCTATGCTCTTTA ATTACAAAGTAAATTAAGAAGCGGGTTAACAAATTATTCATAATTTTACA TACTTCATAATATTTTAAGTTAAAGTTAAGCATACATTTTTCTCAGTGCA TCCATGCGATGTTGACGCTGGCGCCTTCGCATGGCTTTTAAGTGCTCAGT CTTTGTTGTGGCTCGCCTTTGTTGTTGCAGCTTTGGTTGTTGTTATTGGC GGTACTTACACTCTCTTCCTTTCTTTTTTATGCCGCTGTCATCGCTCGGT TTGCACTTGCATTTATTCTTGTTTTCATTTCCGTTGCGCTTATCACATTA TTGCAAGCTCATTGCCGCGGCTTCCCTTCTGACGCACACGCACACAAGCA ACCGGATACTCTTAAGCTCGCACACAGATACACACGCAGACATATCAGTC AAGCTGTCTTGCTTTCTGTTTGGCAAAAGGTACTTGTGTGCGTGCAATTG AAGAAATATTCATA