##gff-version 3 ##date Tue Mar 05 02:56:16 CET 2024 ## exported from the transgeneomics system molecule_59005861 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59005861 mpicbg region 9631 17580 . + . Name=dmel-5.43-2R;type=genome;start=9056983;end=9064932;strand=+ molecule_59005861 mpicbg region 17581 17653 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59005861 mpicbg region 17654 18642 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59005861 mpicbg region 18643 50683 . + . Name=dmel-5.43-2R;type=genome;start=9064933;end=9096973;strand=+ molecule_59005861 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59005861 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59005861 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59005861 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59005861 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59005861 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59005861 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59005861 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59005861 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59005861 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59005861 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59005861 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59005861 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59005861 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59005861 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59005861 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59005861 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59005861 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59005861 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59005861 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59005861 coding_transcript gene 11556 14949 . + . alias=CG4023;identifier=FBgn0053138;id=50638702;Name=CG33138;ensembl=FBgn0053138 molecule_59005861 coding_transcript gene 15589 16228 . + . identifier=FBgn0053137;id=50637679;ensembl=FBgn0053137;Name=CG33137;alias=CG4023 molecule_59005861 coding_transcript gene 16247 39579 . - . alias=CG4037;alias=Histone demethylase 4B;alias=CG33182;Name=Kdm4B;ensembl=FBgn0053182;alias=dKdm4B;alias=KDM4B;alias=CG33182;id=50974899;identifier=FBgn0053182;alias=dJMJD2(2);alias=dKDM4B molecule_59005861 coding_transcript gene 16247 27027 . - . id=50516949;ensembl=FBgn0033802;identifier=FBgn0033802;alias=CG17724a;alias=CG4037;Name=CG17724 molecule_59005861 coding_transcript mrna 16247 27027 . - . parent=50516949;id=50516956;Name=FBtr0087771 molecule_59005861 coding_transcript mrna 16247 26428 . - . Name=FBtr0310499;id=50516986;parent=50516949 molecule_59005861 coding_transcript exon 16247 20228 . - . parent=50516956 molecule_59005861 coding_transcript exon 16247 20228 . - . parent=50516986 molecule_59005861 coding_transcript exon 16247 20228 . - . parent=50974912 molecule_59005861 coding_transcript three_prime_utr 16247 20228 . - . parent=50974912 molecule_59005861 coding_transcript three_prime_utr 16247 17577 . - . parent=50516956 molecule_59005861 coding_transcript three_prime_utr 16247 17577 . - . parent=50516986 molecule_59005861 coding_transcript cds 17578 20196 . - . parent=50516956 molecule_59005861 coding_transcript cds 17578 20196 . - . parent=50516986 molecule_59005861 CLC misc_recomb 17654 17687 . - . Name=FRT molecule_59005861 CLC cds 17695 17766 . - . Name=BLRP molecule_59005861 CLC cds 17767 17787 . - . Name=TEV molecule_59005861 CLC cds 17788 17811 . - . Name=Precision cut site molecule_59005861 CLC cds 17812 17853 . - . Name=V5 molecule_59005861 CLC cds 17860 18576 . - . Name=SGFP molecule_59005861 CLC cds 18583 18642 . - . Name=2xTY1 molecule_59005861 coding_transcript five_prime_utr 20197 20228 . - . parent=50516956 molecule_59005861 coding_transcript five_prime_utr 20197 20228 . - . parent=50516986 molecule_59005861 coding_transcript intron 20229 20802 . - . parent=50516956 molecule_59005861 coding_transcript intron 20229 20802 . - . parent=50516986 molecule_59005861 coding_transcript intron 20229 20802 . - . parent=50974912 molecule_59005861 coding_transcript gene 20383 31289 . - . alias=2R5;alias=CG17724b;alias=vr5;alias=Seq;alias=49Fc;Name=seq;alias=lethal(2)49Fc;identifier=FBgn0028991;alias=l(2)vr5;alias=l(2)49Fc;alias=CG17724;alias=CG4055;id=50760296;alias=sequoia;ensembl=FBgn0028991;alias=Sequoia;alias=CG4037;alias=CG32904 molecule_59005861 coding_transcript exon 20383 21325 . - . parent=50760315 molecule_59005861 coding_transcript three_prime_utr 20383 21288 . - . parent=50760315 molecule_59005861 coding_transcript exon 20803 21325 . - . parent=50516956 molecule_59005861 coding_transcript five_prime_utr 20803 21325 . - . parent=50516956 molecule_59005861 coding_transcript exon 20803 21325 . - . parent=50516986 molecule_59005861 coding_transcript five_prime_utr 20803 21325 . - . parent=50516986 molecule_59005861 coding_transcript exon 20803 21325 . - . parent=50974912 molecule_59005861 coding_transcript three_prime_utr 20803 21296 . - . parent=50974912 molecule_59005861 coding_transcript cds 21289 21325 . - . parent=50760315 molecule_59005861 coding_transcript cds 21297 21325 . - . parent=50974912 molecule_59005861 coding_transcript intron 21326 25991 . - . parent=50516956 molecule_59005861 coding_transcript intron 21326 25991 . - . parent=50516986 molecule_59005861 coding_transcript intron 21326 25991 . - . parent=50974912 molecule_59005861 coding_transcript intron 21326 22204 . - . parent=50760315 molecule_59005861 coding_transcript exon 22205 24449 . - . parent=50760315 molecule_59005861 coding_transcript cds 22205 24449 . - . parent=50760315 molecule_59005861 coding_transcript intron 24450 25991 . - . parent=50760315 molecule_59005861 coding_transcript exon 25992 26428 . - . parent=50516986 molecule_59005861 coding_transcript five_prime_utr 25992 26428 . - . parent=50516986 molecule_59005861 coding_transcript exon 25992 26390 . - . parent=50516956 molecule_59005861 coding_transcript five_prime_utr 25992 26390 . - . parent=50516956 molecule_59005861 coding_transcript exon 25992 26390 . - . parent=50760315 molecule_59005861 coding_transcript exon 25992 26390 . - . parent=50974912 molecule_59005861 coding_transcript cds 25992 26390 . - . parent=50974912 molecule_59005861 coding_transcript cds 25992 26358 . - . parent=50760315 molecule_59005861 coding_transcript five_prime_utr 26359 26390 . - . parent=50760315 molecule_59005861 coding_transcript intron 26391 26998 . - . parent=50516956 molecule_59005861 coding_transcript intron 26391 26998 . - . parent=50974912 molecule_59005861 coding_transcript three_prime_utr 26749 26951 . - . parent=50974978 molecule_59005861 coding_transcript three_prime_utr 26749 26951 . - . parent=50975020 molecule_59005861 coding_transcript three_prime_utr 26749 26951 . - . parent=50975068 molecule_59005861 coding_transcript three_prime_utr 26749 26951 . - . parent=50975110 molecule_59005861 coding_transcript exon 26999 27027 . - . parent=50516956 molecule_59005861 coding_transcript five_prime_utr 26999 27027 . - . parent=50516956 molecule_59005861 coding_transcript gene 40066 43927 . + . alias=VRS;id=51345829;alias=BEST:LD45671;ensembl=FBgn0027079;identifier=FBgn0027079;alias=CG4062;alias=ld45671;alias=l(2)rI255;alias=Valyl-tRNA synthetase;alias=ValRS;Name=Aats-val;alias=l(2)03531 molecule_59005861 coding_transcript gene 43958 47737 . - . Name=CG34315;ensembl=FBgn0085344;identifier=FBgn0085344;id=51248115 molecule_59005861 coding_transcript gene 43958 47737 . - . ensembl=FBgn0005654;alias=Orc3;alias=DmORC3;Name=lat;alias=l(2)49Fd;id=51431446;alias=ORC3;alias=l(2)vr6;alias=Origin recognition complex subunit 3;alias=vr-6;alias=LAT;alias=latheo;identifier=FBgn0005654;alias=ORC;alias=vr6;alias=CG4088 ##FASTA >molecule_59005861 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACATTGGCGACTAATTACTTGT TATTTGTAGGGATGAGGCTGTCAACTTTGCCATTCAGAAGGGTCTGGATG CTTCACGAAGCACAATCGTTTTCTTTAAGCACAATGACGTTGAGGATCTA GAACGTCTGCTGATTGAGCAAGAAAAACGAGACCAGAAAAATCCGAAAAA GGCGGCTAAGACACGTCGCTTCCTCGTCGCCGAGGGTATCTATATGAATA CGGGCGAGATTTGCCCACTTCCCGACCTGGTGGCCTTGCGTCAGAAGTAC AAGCTGCGTTTGTTCATCGACGAAAGCATCTCCTTTGGCACATTGGGCCA GGGTGGTCACGGAGTTACGGAGCACTTTAATGTCGATGTAGGTGGTAAAC CGGAAAGAAAAACTAAAATTATAACTGGTATTTTTCTTTTAGCGTGATGA AGTCGATCTGATATCGGCCGGCATGGAGGGTTCGATGGCAACAGTCGGTG GCTTCTGTGTTGGCTCGCACTTCATAGCCGAGCACCAGCGCCTCTCTGGC TTGGGCTACATCTTCTCGGCCTCGCTGCCGCCCATGCTCACCCAGGCGGC TATTTCAGCGTTGGATCGTTTCGAACGAGAACCACAAATCTTCGAGCAGC TGCAGGCAAAGTCTAAGACGTTGCACCAGAAGTTTTTGCGATTCAGCAAG CTAACCCTGCGCGGCGATGAGGTGTCACCAGTGAAGCACTTGTATCTTGC CCAGCCCGCCGAGAACTTTGACAAGGAACTGAAACTTCTAACAGAGCTGG CTGATAAGGTAGGCATTTTATTTCCCCATGCAATTATGAAAACTATACAT TTCTACTCACTTTTCCCAGTGCATTGCTCGTGGAGTGGCTGTGGTACAGG CTGCCTACCTGCAGAACAGGGAACGCCAACCAGTCCGTCCCAGCATTCGC ATTGCTGTCAACCGTTTGCTGGAGAGTTCGGAAATAGACAATGCGTTTGA GGTCATCGAGAGTGTTTCCAGCTCCGTCCTATAAGCCTTGTTGTTGGAAA GGAATGATCTTCTTTCGACAATGGCCTTGCTGTTAAGTTTTAAGGCCTGC TGGCCCCATCATTTTTTCATCACTTCTTCACGACCAGTCCAGTATGAATT GTTTAAGTTAATAGCTAGCCTTGCACTTGCTCTTTGCACTTTGTTGCATT GCATTTTAATGAAAAATTTTAAGTCTAGGAAAACTTTCAAAGATTACACG TTATAGATAACAGAGCTGGTTAAATAAAACTATTAAGTTTATTTGGTAGT TACGTGCCCTTTTATTGGTGTTTCTTATCGCCTGCGCAATCGCAAACGTT TTTGAATATCCCGATAAAGATAAGGGTAATATTATGTGGCATTTGTTGTA AAATTTACAAGAACAACTTCCACAAAGAAACATTCATTATTTATTTATGT TTTTCTTGCATGACAATTAAGATACACATCACACGCTTAATAATAACTAA TATGTGGAATAAGCCAGATGGAATGGAAATGCTTTGAAACGATTTGATTG CCAGTGGAGCAGAGCTGTTTCCGAGTGGCGACCTAATCTGTGAGCAATAA TCATAACCCTTCGACTTTCAAACCCATGTTTGTGCATTCGATTCACTGAT GAACTTGACAACGACGACCCCAAATCATGATGTTGTGCACATAGCGCTCT GATTTCGATGCCGATATGCCAGCCGGCAATCAGCGCCAATTGAGCGTATA CGTACTATGAACTTGGGTGCGGTGCTATCAGTGCGAATACGCAACATTTG GCGACAAAAACATGCAATTACAGCAATTTTCGCTATGTTGTTTACATACG CGAATGGCGGGCGCAAAAGGCAAAGCTGCAAAAACAGCTGATCGCAAGCG AAAGCTTTCCGTGCGCAGCGGAGCTTTTGAGTTGGCCGGCAGCTGATAAA TGAGCACAGTTGTCGCTCGTCGGTCAACAGGCAAACAAATCAGCAGCGTC TTCGCCAACGCCGCCTTCTTCAGTTCCCACCGTTCAACCGAGACACCTCT CGGGGATTCATTCTCCTCCGCTATGGCCGAGGCTAAGGACATCGAGAAGC TGTTCGAGACGGACGGCTACTTGCGGCCGTTTGAGCATGAGATCCGTCGC CGGTGAGTTAAGATCCCTCCCCGGATGTACAATACATACATCAATACATA GATGTGTGCATAGTTAGATGTACATCAGGTAACCCAAGGTTGGCGCCGGC TTTATGCGCTCCATGCTGATAAGGGAGTGCGGCGTAACCATAGAGGGCAA TCGCTGACCGGGGCGCGTAGCCCGGAATTCGTAACCAATGCTGCAGCCGT ATCATGCAGTTGGAAAAACTGCGTTCGCAATGTCGAATGAAGGTCGCCGG TGTTTGCCGCCCCGCCCTCTGCGTGTGTGTTGGTTGGCCAGTGCGGTGCC GTGTGTGTTTGTCAAAACGAAATTTTAAATAATATGTTCGCTGCGTGCTG CCGGCGTGTTTGGGGCATGGATGTTCTTGGCCTTGGTGGCATTTTCCGGA TTTCCCCAAGTTGTGCCGGCGATATTTCTATTTTGGCATTACTGCAAATC GAAACATTTTGGCTGGTCTTCCGTTCTTGCGCCTTTTGTTTTGGTCTCTT TTATCGGGCGATTGTGATTGCCTTTTAGAATTTTTTTTGTTTACATTTTT AGCCGATTAAAATAAATAAATAGCCACTAAAATAAATTCTTAGTGCAGTG AAAAAAATTAATTATATTTCTAATAGAATTTTACAAATTCGAAAATATTT AAATTCTATTTATTTAATTAAAACAAAATCCATTAAACTAGAAAACAATT TGGCAATGACACGATCTGACCCACGATTTTCGTTATCGGATTTATAAACC TAATGAGAATATGCGAACAAAAATTGAAAAATCCATTAATAATCCATTAA TAATAAAAAATATTTCAGAGACTGCCTTACATCATTATATATTAGCTAAT ATCTAAAAACAGCTCTTAATTAGAATTCACTGAAACGCATCCATTAGACG TCGATTCCATCCTGTTGGTCCTACAAATAATTATTGCAATTATTTCTCCG CAGTCATGGCGTGCTCGAGGATTGGCTGAATAAGATAAACCAAAGCGAGG GCGGACTGGATGGCTTTTCGACGGCTTACAAGCACTACGGACTTCACTTC CAGCCGGATAATTCGGTGATTGCCCGCGAGTGGGCACCTGGAGCCAGAGA TGTCTATCTCACGGGTGACTTCAGTGAGTAATCCATCCTTCAATACGAAT TGATCTAGTCTAACCGATTGCTACAACCCCACAGACAACTGGCACTGGGA ATCGCATCCATTTAAAAAGCTCGACTTTGGCAAGTGGGAGCTACACCTGC CCCCCAACGAGGACGGCAGTCCGGCCATCAAGCACTTGAGCGAAATTAAG ATTATAATTCGCAACCATTCCGGTCAATTGCTGGACCGCCTGTCGCCCTG GGCCAAGTACGTGGTGCAGCCGCCCAAGTCGGCCAATCAGGGGGTCAACT ACAAGCAGTACGTGTGGGAGCCACCGTCCTACGAGCGCTACCAACGCCAG CATCCGGGTCCGCCAAGACCCAAGTCGCTCAGGATCTACGAGTGCCACGT GGGTATCGCCTCCCAGGAGCCGCGGGTCGGCAGCTACGACGAGTTCGCCG ATCGCATCGTGCCGCGCATCAAGCGTCAGGGCTATAATTGCATCCAGGTT ATGGCCATCATGGAGCACGCCTACTACGCCAGTTTTGGCTATCAAGTGAC CAGCTTCTATGCGGCCTCCAGCCGTTATGGCAACCCGGAGCAGCTGAAGC GCATGATCGACGTGGCACACTCGCACGGCCTGTTCGTTCTGCTCGATGTG GTCCACTCGCATGCCTCCAAGAACGTTCAGGACGGTCTGAACCAGTTCGA TGGCACCAACAGTTGCTTCTTCCACGACGGAGCCCGTGGCGAGCACTCGC TGTGGGACAGTCGTCTCTTCAACTACGTGGAGTACGAGGTGCTGCGTTTC TTGCTATCCAACCTGCGTTGGTGGCACGACGAGTACAACTTCGATGGCTA TCGCTTCGACGGAGTGACCTCTATGCTATACCATTCCCGTGGCATTGGGG AGGGCTTCAGCGGCGATTACAACGAGTACTTTGGCCTGAATGTCGACACG GATGCCCTCAATTATCTGGGACTGGCCAATCATCTGCTGCACACCATAGA TTCGAGGATTATCACCATTGCAGAGGTAAGCTATCCGTTGGTTTTGTTTC TTTCGAAGTAGACAAGACAGTTTTCTTAATTCCCCAGGATGTTTCTGGAA TGCCTACCTTGTGTCGCCCCGTATCAGAGGGTGGTATCGGTTTCGACTAC CGCTTGGGTATGGCCATCCCAGACAAGTGGATCGAACTGCTGAAGGAGCA GAGTGACGATGAGTGGGACATGGGCAACTTGGTGCACACGCTGACCAACC GTCGCTGGATGGAGAACACAGTGGCCTACGCAGAGTCCCACGATCAAGCG CTAGTGGGCGACAAGACGATCGCCTTCTGGCTGATGGACAAGGAGATGTA TACGCACATGTCGACGTTGTCGGACTCCTCAGTGATCATCGACCGAGGAC TGGCGCTGCACAAGATGATTCGTCTGATCACGCACGCCCTGGGAGGCGAG GCGTACCTGAACTTTATGGGCAACGAGTTCGGACATCCAGAATGGCTGGA CTTCCCACGCGTTGGCAACAACGATTCGTATCACTATGCTCGCCGGCAAT GGAATCTTGTGGACGACGATCTGCTGAAGTACAAGTACCTCAACGAATTC GATCGAGCCATGAATGAGGCCGAGGAGCGCTACGGCTGGCTGCATTCCGG ACCCGCTTGGGTCAGCTGGAAGCACGAGGGCGACAAGATAATCGCTTTCG AGCGTGCCGGCCTGGTGTTCGTTTTCAACTTCCATCCACAGCAGAGTTTC ACCGGATACCGTGTGGGCACCAACTGGGCGGGCACCTACCAGGCGGTGCT CTCCTCAGACGATCCTCTCTTCGGCGGCCACAACCGCATCGATGCCAACT GCAAACATCCCTCCAATCCGGAGGGCTACGCCGGGCGCTCCAATTTCATT GAGGTCTACACACCATCACGCACAGCCGTGGTTTATGCCCGCGTCAGTGA CTAGCTAGTCAGACGCAATTAACCGGATCTGACCGGATCTATAAAAATGT TAATGCCTAAACGAATTTCACATTTAGTTATAGTGATTGTTAATGTTACG AATCGGGATGCCATCATTAAAATATATGCTCACTGAGGTATAGTTTTCTA AAATGGTATTTTTTATGGTATAACCATACATTAAATGAATAATATAAAAT TTATATGTAGTTAGTAAACTGGGAAGTAGTCTCGGCAATTGATTATCTCT TATCATCGGCTGCCATTACTCATTATTCTTGATTTAACAAATGCTCATTG ATTCCATATCCAGGATTTAGGCATTTCCATATTAATTTGATATTAAATGG TGGTTAGATGATATATAACCACAACCAAGATATTGATACATTTCTGCAGT CAGAGTCATTGAATTTTAGGGATTTGGGCTTGCTTTCATTGGCCAATAAC AAAGTTATTATAAGCTATATAACAAAGTTAAAATCACTTACAAATCTCGA TTTTTATCACCCAAATTTTAATACAATATATGGTATTTGTTGAACAATGA CAAGCGCTTGTGCCTGGTTATTGAAGTGGAACAAATTAACTTTTGATAAT TAAACCCTTACACACAAAATTAAAACCGCATTAGAATATTGGGATCGAAT TCGAACACAGGTTCTTTTCCTATGTTTCCTGAGTAACATGCATTCCATTC ATCTACTTTTATTCGGCAGTTACCTATTCTGGAGTGTCGTGAGTGAGATG CTGTTCCACTATATACTCCTTGCAACCCATCTATCTATATGTATGACATT TTCCAGCTAAGTGAACCCAACATCGTCTACAAACTGAAAAATATCGAGTG CTCCACAGTGCCTGGATTCTCCGCGAATGCTTCGTGTCATATAAGAGCAA TAAATTGGAACAAGGCGGTGGCTGAAATGGATGTTTATCTGCTGAGGCCT TTGTACAATATAACAGTGAGTTTTGCGGACTTACTTCCTCATCTGATTAC TCCACTAATCAGATAATCTTTAGATTCGATTTCAGATCCTCAAGAAGGAC TACAGCAACAAGTTTCAGCCGTTCCTCGTAGACGTCGTGATAAACATGTG CGATGCATTATCCAGGCGTAGCTTTATACCATATGGCTTGATCATCCTGA AAATTGCCAGGACGTTCTCGAACTTTAATCACTCCTGTCCATATCGCGGC CATTTGATGGCACGCGGCGCCTACTTGAACGAATCCTACTTGCCCAACGT TTTTCCCCTAGGTTTCTACAAATTCAACATTACGATCATGGAAAACTACA TAACTCCACCGAGCGCACATGTTGGGGGTATTATCTGGTACGTTCAGGCC ATGCACGCAATCCAGCCGAAAAAGAAAACCAACAGAGACCGGGGTTTTTC CGGGGGCCAACAAAGAGAGCAGAACTAAATGAATACGTAATGATTTATTG CTTTAAATTTTTAAAATTGTATTTTTATTGTTTATAATAAATATATATAT GTGTACGTAAATATTAGCTTTAGAATTTGTATTATACATTATGTAGGCTA CTCGAGTTGCTTTATTTGTAGCTTTTTCGCTTCGTTATTAGTTACAGTAT ATCTTACAGAAGTGCAACTCAGTTTTGCTTATTTGTCTTAGAGTACGTAC TACAAGCTATTTTAAATCATTGTCTTCCATCGGTTAAAGTAACTCATCTT AAAGTATCTTAACCTGGTTTCGCTTAGCCTAATGTGTGTGTGGTATCTCT GTATTCTTGGGCCGTTGGTTTCACAAGAACGGGTTAAAAAAATAATTTAG TCTAAAGTATGGGTCGGTGCTATGCTTGAATTCCTATTTGTGTACGAATG GCATAACAAGATTGCAAATAAAATATATAAAATATAGATATATATATATA TATACGTAAAGAATATACAACATGGCAAAAGAAAGTGTAATGACAAAGGT GGCGGCGGGTCACACGAATGGAAATAGTTAACAAAAATAAATAAATAGAT CGAGAACTTATCGAATAAATACTACATGAAATACGTTGCATAGTCGCTCT AGCTGTCTATCTCTCATTATGCAAGGAACAAATTATATTTATAAGTATAT TTCTTGAGAACGCTCCCGGTAGTTACAAAAGTGAGCTATCCTTTTCATCG AAACGGAATCGTTCTTGCAAAACTAAATTACGCTAAACATATTCTGCCCG CACTGTAGGCAGGTGAAATTGTTACATCTGGTTTGGGGTGTGTGTCTCGT GTTTTGCACTTAAACATTTAAAATTTATCTTAGGCGTAAAAATTATTTTA ATTTACGATGCTCTTAAGTTTGCCGTGAACCGAATGCATTTGATTCCGCC TCAAATCCATTCGCGTGTGTGTGTTTGTTTCTGTGTGTTGAACAACATTT GATTTATATTCTTGTAGGCATTTGGTTTTTGAGTAAAAAAATAAATTTCG TATGCACATCCAACAGTGTGGTAATATCAATGAGTTAGCTTGGCTTAAGT TTGAGTTAATATTCCTTCCATTTCATTCGTTTCTTTACAGCAAACGCTCC TGTTGCATTTCTCCCCGCATTTTGGTGGCCAAATGTGACGATTTTTGAAG TATTCTAAAACCCTAAAAACATTTAAACGTTGCCGACGGCACAGAGCTGC GTTCCCAGCTTTGCGCCATGGGCAACCGAATCTGCGCGGAACATTTTTGA GATTTCTAAAAGAAGTATGTGGTCGGCATTATGGTGGCACTGTTCAAAAA TCGACCCATTTGGCCACCCATTAGACCCTACTTGTCGTCGTCATCCTTGT AGTCAATGTCATGATCTTTATAGTCTCCATCGTGGTCTTTATAATCTGTC GACGAAGTTCCTATACTTTCTAGAGAATAGGAACTTCCCGAGGATCCGCT GCCGCCGGCGTTGCTGCGCCACTCCATCTTCTGGCTATCCAGGATCTGGC GCAGGCTGCTGGCCATGCCCTGGAAGTACAGGTTCTCGGGGCCCTGGAAC AGCACCTCCAGGGTGCTATCCAGGCCCAGCAGGGGGTTGGGGATGGGCTT GCCCTCGAGCTTGTACAGCTCATCCATGCCCAGGGTGATGCCGGCGGCGG TCACGAACTCCAGCAGCACCATGTGATCGCGCTTCTCGTTGGGGTCCTTG GACAGCACGCTCTGGGTGCTCAGGTAGTGGTTATCGGGCAGCAGCACTGG GCCGTCGCCGATGGGGGTGTTCTGCTGGTAGTGATCGGCCAGCTGCACGG AGCCATCCTCCACATTGTGGCGGATCTTGAAGTTGGCCTTGATGCCGTTC TTCTGCTTATCGGCGGTGATGTACACGTTGTGGCTGTTGAAGTTGTACTC CAGCTTGTGGCCCAGGATGTTGCCATCCTCCTTGAAATCGATGCCCTTCA GCTCGATGCGGTTCACCAGGGTATCGCCCTCGAACTTCACCTCGGCGCGG GTCTTGTAGGTGCCGTCATCCTTGAAGCTGATGGTGCGCTCCTGCACGTA GCCCTCGGGCATGGCGCTCTTGAAGAAATCGTGCTGCTTCATGTGATCGG GGTAGCGGCTGAAGCACTGCACGCCGTAGGTCAGGGTGGTCACCAGGGTG GGCCAGGGCACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAG CTTGCCGTTGGTGGCGTCGCCCTCGCCCTCGCCGCGCACGCTGAACTTGT GGCCGTTCACGTCGCCATCCAGCTCCACCAGGATGGGCACCACGCCGGTG AACAGCTCCTCGCCCTTGGACACCATGAATTCATCAAGTGGATCTTGGTT TGTGTGAACCTCGTCCAGCGGGTCCTGATTGGTATGCACTTCCGCGGCGA ACAACTGAGCAGCAGCAGCAGCGGCAGCCTGTTGCTGTTGTTGCTGCTGC TGCTGTTGCTGCTGCTGCTGCTGCTGCTGTTGGGGATTTGTGGCCAGGAT GGGAATGGCCGTGCCGTCGGCGGTCAGGATCAGGGTCTGCGTGGCCTGTG GAGCCGATGTGGCTTGAGACTGCGACGCCTGTTCGGTGGCCAGGGCCACG TTGCCCGGCAACGCAATCAGCTGCTGCTGACCCGCCTTGCTGGGATGCGG CACCTGGGTGGCGGCGATTATGCTGCCATCGGGCGACTGCAGCAGGATGG TGTTGGCCGGCAGGTTGAAGCAGGTCACGGTGCCGTTGGAGGCCACAGTC TGCAGCTGAAGCGGAGGCGGTTGTGGGGCCAGCAGCATGGCGGTGCCAGT CGTTGTGGCAGTCGCATTGTTCGTGCTGCTCAGATCTAGGCCATTGGCGG TCGTCGTCTCTTGCAACTCCGGCTGCTCCTGACTGGGCTCCTCGTCGATG ATCTCCTCGACCAGGTCGTCCTCGTTGAGCTCCTCGATGATGTCGTCGTC GTTCTCTATGTAGCCGGAAGCCTCAACGCCGGAGCTAACCAAATTGACGA CACCCGGCGGCGAGGGTGTTGGTGTCGGCATGGCCAGGTAGTTCTCCCCC GACTTGGCCGTCACGGCCGTCCCCTTGGGTATGCGGAACTTTCGCAGGAT CTGGGCAGTCGAGGAGGAGAGCCCGGACAGGGCAACTGCATCCTCATCCA TGTCCTCGTCGAGCTCATCGTCCTCGGCCAACATCTCCTCCTCGACCACT GGCTGCTGGTGTTCCACAGGTGTTGCCTCCGGAGCGACGATAACTTGGCG CTGATTGCGATTGGTTGCATTGACGCGCACCAATGTAACACCGCCGCCGC CTCCGCTTGCATTTCCGGTTCCGGCCTTGGTGTTGCCATTAAGAATGCTG AGCTGCGGCTGCTTGGCGGCACCACGAGCGGCCAGCAGAATGACTGGTGT CTTCTTGGCCGCCGGCTTGAGGCCATTGCTCGCACTGCTGCTCACCACGG TGGATGCATTGTTGCTAGTGGCTCCGCTGCTGCTGCTGTTGCCGCCGCTG CTGCTGCTGCTGCTGTTTGTTTTGGGAGGAAGGATTGCATTAGTCGCATT TCTTGTGGTTGGCGGCACATGGGACTGGGCAGGGGGATTGGGCATGGGAG AAGTTCGGCTCGAGTGGGTCACAAAGTCAGCGAACTTGTCGACGAAACTG CTGCCGCGGCCACTGCTGCTGGTATTGCGGCTGGTGATGCTGTTGCTGCA ACGTGTGCTGCTGTCGCCAAGACGAGCACGGGCATTAGCCTGCTTGACGA CGATTTCTTCGTAGTAAATGCGATACGCTTCCACTTGCCGGCGTTGCGAA TCATCTTGTGTGGTGTTATTGATCTGACTCTGAATCCGATTCTGATTCTG ATTCGGATTCGAATTCGAGTTCGGACTTGGATTGGTGATGGTGTTCTGGG TTCTGTTGTTGTTGCTTGGTGTGGTGTTGTATGGCCTCTTGAACATTTGT TTCTGGTGGTTGTCGTGTTTAGAAGAACCTGTTGTTGTTGTTGTTGTTGA TGATGATGTTGATGTGGTTGTTGTGTTGCATGATTATGAATTTTTGTGTG CAAATCATAGGGAATAACACAAGAACACAAACAACAGACGAACGTAAAAT GTTGTCGGGTGAAAAAGAAAAAATAAAAACAATTTGATTAGCATATTTGC TGATTTGTCATTTCAATTGGTGTTAGTTTCGATCGTTTCGACTCCTTTTA TTTAATTTAGTTGTTAGATATGCTTAAATCAAAGTCAATTTTGGTTAGTA AATGATAAGGGCTCTTATGACTGATAGCTTAAATGGATCGAATGTGGATG TGTGGATGGATCAGAGAGTGTTGCTCTCGGACAGTCAGTGGGTAGTGTTC AGTGTGGTCAGTAGAATGCCATCTCAGATACTTACACCCCTTTTGTACAC AAAAGTATCTGAGCAGTGGGCTTCCCATTTTTCCGGGTGTTAGGATGCAG TTAACCCAAGGGAACATGGTTTAGTAACAAAAACAGAAACGTGTTATGCA AAACAAAAAGGGGCAACGAGAAAATAAGGCGAATAAACAAAAGTACACAT ACCTTTCACTAATTGTCCAATATTTTTTTATATGTTTAATTTATTTTTTA TGTTTCATGGAGAGATCATTATTTGCTTGTTTCTTTCGATTTTTTTGGTA TTTGCTCGTTGCTGCTCTTGCACACACGCACACACAACAAGTGACGATGG AATAGTGAATGAATCAATGAATAAGGCGAGACGAGACGAGATCTCCTCAA GCAACCGACTATTATGAGTATGTGATGTGTCGGATGTAAGTACACAAATG CTTCGCTAAGTTAGTTTGGTGGATTATTTATTTATATGCTTGTCCGTTGA TCTGGGCAAACATTGAAAATGTCTTCCATTTGCGTTGCTTTCGTTTGGGG ATTATGATTGGGTGGTATTCACTTTTAAACTCGATTCGTTTAGCTATCGT ATTCATTGCGAACTCGGTGTTGAGTCTTGTATTCGTTAAATAGAATTTTT GGTACTTTGGCTGCAGCTTTCTGTGTGGATCGTTTTATTCAGAGAGCTAA TAGCACTGCCTCTGATATATCGTAGCTATAGTTACAAATCGTTTTTTTTT TTTTTTGATTAGGTATTTCGTTGTTGATTTGATTGATTGATTGATTGTTT GATTGATTGGTTGGTTGTTGGATTGGTTGTGTGTACATAAAATAAAACAA GAGAAAAGAAAGAAAAAGAACAAAATTGCATTGAAGTATAAAACGTATTT GAACACAAGTATTTTTCGAAACAAAAAGGGGGTGTTTGTATTGGTTATTG TTATTCGTGGTATTAATTGGGTAATATTTGATGGCATATCAATTTTACAA GAAAGCAACAACAAGCCACACAAGGAACAATCTATTCAAAATAGAGTGCG ATACCTCAGTGGGTTATGATTGGTAAATAAATAAATAAATGCACAAACTT CAATTCATACGACTAAATTACCAACTGAAAAACTCGGTTAAATTCTACTA AGTAATATAAGTACGTAATAAATAAAGATGTACATAATTGGATGATTACA AAAATAATACAACTAATATATGCATAATCCTAATTTAAAACTAAACAAGT CATACTTAATGTTATCCCCCATTCCCATGATGTTTAGTTTTCGTGTTTTG TAGGCGGCCATCGGGTGTTAAGTGTTTCTTTTTTTTTTTTTGTATAAAGT ACACCGTCGATTCGCGTTTCAAAATACGTGAAAGAAAGATCGGAGTCGCA GTCGCAAGTAAAAGGGGTTACGGTGGCAGAGATAGCAATATGGATAGAGT TTTAGATACAGGTACAGATACAGAGATATAGTACAGATACAGATACAGAG CGGCAATCTAATCGAGCGCGTTACACTAAGAGAAAAATCGAGCAGACAAG GGGGTATTGGGGATTGGGCAATAGTGGGCATGGTTAGTTGGAAAGAGCGT TTACCTAATTTCTTTGGTTTCCAGCAGCGACGAGGTGTTCACATCGTTCA CCGCATTGATCATCGAGGTGGGCGAGAAGGGCAGGTGGTACATGGAGGCA GTGTCCAGGGTGTAGGCGTCGCCGCCCTTAATCAGCAGCTCGTTCTTCAG CTCCATGAACTGCTGGTGCGGATTGTGATGCGTGGCGAAGGGCTGCTGCT GCAGTAGTTGCGTCTGCTGGTGGTGTTGCTGCTGCTGGTGATGGTGCTGC TGCTGCTGGTGGTGCTGCTGATGCTGGGTCTGCGCGTCCAGCGCGTTCGC ATTCAGCGTGGGCTGCGCTCCGGCGTGCGTCGTGAAGGTGTACTGCGAAT AGGGACACAGGTCGCCCAGCTCGGCCGTCTCCAGCTTGGGTTGGAAGTTC TGGAGGCCGTCGGGCGTCAGGATCTGATAGCTCTGAACCGTGCCGATCAC GTGCTGCTGCTGCTGTTGTTGCTGCTGCTGCTCGGCCGATGTCGGTGTGG CCGCCGCCGTGGAGCTCAAATAGGTAACGTTGTCCAACTCGTAGTGAGGC TGCTGTTGCGCCTGGCCGGCGGGCTGCTGCGCTGGCTGCTGTTGCTGCTG CTGCGTCGTCTGATATGTGGCCGTGGTCTGTTGGCGCTGAGCCTGCGGCG CCGTCGTGTATATCGCCTGGGTTCCGTCCAGCTGCAGGGGCACCAGGTTG CCGGCTTGATCCTGGATCATGATGCTCTGACCTTGCAGCTGCTGTTGCAG CAGCGCCTGCTGCAGTTCCAGTTGATTCGAGTAGATCAACGTGGTGGTGG GCGGCGCCGGCTGACCATTCGGCGTGGCTGGTCCTCGTTGCAGTCCCACG GAGCTGGTGGCGCCCGGATTGGCCAGTGCCAGCTGTGCGCCTCCAGGCAG GATCATGCCGCTGAAGTCCAGCGATGGCAGCGTCTGCAGCTGATGCTGCG GCTGCGATGGCGTCGAGGGAGCCAGCGTTGTGATGCTGTGCTGGATCTGT TGCTGCTGCTGTTGCTGGGAGTGACTCACGCTGACTGGCGCCATGGTCAG AGACTCCCCATTTTGCACGTCGTCCAGAACACTGTCGATCTGCGCTAACC GCTTCTTGGTCGGCGTGCTGCCATCCTTCGTCTTGCGGACGCGCGGAGTA CGAGCGGTACGCGCCCGCTTAGCCGGCGGACCGTCAGCCTTTAGCGGCGT CGTGGTGGCCGATGGTGGCATGGGAACATCGCCGTGCTTGTCCTTTTTAT GCATCTTCATTTTGTCCGGACGCGAGAACTCCTTGTTGCAAATGGGGCAG GCGAATATCTTGCGGTTTTGGCCCTCGTGAAAGAGGTAGGCGTGTCTCTG GAAGCTATACTTGTTCTTAAACGTCTTGAAGATATCGTTCTTGGCGCAGA CCAGGCAGTAAGCCACGCCGTCGATGATGTGCTCGTAGCGGGCAATGTCC AGGCCACGTACACTCATCTTTTCCAGGTACTCGCCCTGCTCGTCGTCGGC GATTACGCGCGTCTTGCGTTTGCGCTTCTGCTTGGCGGCCGCCGCTGATC CCGATTTGGGCACCATTGAGGACAGCACCGTGTTGCCTGAACCCGTCTGC TCCTGGCTGATCGTATAGCTGGTGGTGCCGGCTGCCAGCTCCGCCGCCTC GGCCTCCACCTCGGCCTTGATCACCTGGTACTCCTCGTACTCATGCTCCT GCTCGGCATCGTGCTCGTTTTCCGGATCGTGTTCGAGGCTCTGCTCCTCG TACTTCACATGCAGCATGCCGTTCTCATCGTCGTCCTCCTCGTCGCCGAC GACACCGTGCTGGGGATCGTACTTGATTATGTCGGCGGCCACGGCACTGC TGCCGTTGCTCAGGCAATCGCTGCTGCCGGGCTCGCTTTTGAGGACATGA TACTCCTCGTACGTGCTCCCGTCGAACTCGATGATCGTGCCGTCCGTGTT GACCAGGGCAGTGGTGGTCGTGGTCGCGGGTGCGTTGGCCTGCGACACGG GAACGGGCGTTGGTGCGGCAGAACTGACCGCTGGCATTCCGCCGTTGTAG TTCTCGAACACTATGGTGGTCGGGGTTTGTCCATCCTCGCCGGTGGTGGT GATATAGTGGTAGTGCTGTTGCTGTTGTTGCTGCTGCTGCTGCTGCTGTT GTTGTTGTTGTTGCTGTGTGGCGGCCAATGTGTCCACTCCGTTGGTGTTG GCGTTCGTGTGCAGGATGGAGGACGAACTAATAGTTGTGACCACATTGTC TTTTGTTTATATATATTTTGAAAATACATATTTGGTTTGGTTCATAAAAG ATGTGTTTGAATGTAATATTTGCATAAATCAATAAATCAATTCGTAATTG AAATCGAAATCAATCAACAATTCACTCAAATCAGGTTCGCATAAAACAAA TGTTGTGCAAAATGAAATCTACTTGCGGCCAACAGCAAAAAAGGCAAATG CCACAGATGCAGTGCATCTGCTGCATTTACGGGCGGGCCTCTTTATCAAA TCGATTGGATAAGGCAATACAGGACATATAGATAGAAAGTGAGTGAATTG GTTTTTGTTTGTCGGTAGAATTTGTGTTTACTTAGATCTACATTACAGCA ATCGTAATTCGTAACTCTGGTACAGTACTCGCAACTCAATACGTACTAAA TAAAGTTAAATAAATAATCGACTTCGGTAACTGAGGTGGTGGTAACAGGT GGACAGAGGAGAGGATGAAACTGGTGCCAACTTTGTGTAGACTCCTCCTC CTCCTCCATCGCTTGGGGCGGAGCAGGAGGAGCTGGCAACGGATTGTGTT TGTGTTGTGTCCAAAGAGTGGGAAACAATAAGTGAGAGATAGAAAAGACG GGAAAGTGTCGTTGCTAAAAGTAACTAAATCATAAACGCAAATCTATAAA TTATAAACTCTATTTTCAAAATTTGGCGCGCAAGTGCTGCCAAGAGTCAG CGCGCGCATGGGCAGCACTGATGCTCTCATTGAACTCACTGCTGCTTGGG CGCCAAAGTTTGAACTGCAAAACCTTAAACTAGCTAATAAAGTAAAATAA TACGTGATCGACAATTGTTTTTGAGCCTTTTTCGACGCGTTACTGTTTTG TACGGAGCTCCCTCCCTCGGTTGAAATGAATTGTGCACTTATTTATTTGA TTTTTCCAATGCTCTCGACAATTCGAGTAGAGACAGGACACAGACCTGGG AAATGGTGTCGCAAATTAAAGACAAGCATGTAGTGTGTGGAGCAGTTGAA AGCGGTTGTTGTTATTAATTGGGCGATGCGATTGGAGTTCGATTTATTGA GATAGGTCGGTAATGGTTAATTGAAGATTTCATTGCCTTTTTATTTCGTT TATATTCTTTTGTATTTTGTTCATTTTTTGGGAGGTTCAAAGGTGTGACA AGAACACGGAACACAAATGGAAGTCAAATTCAATGTTTGCTCTCATTCGA AACGTTCTCCCTTAGTGGCGCATTTGAATTTTGGCACAAAAAGTTGAAAA CTCAAAATGCAGTTTGAATTTGGAAAGTCAGGATGATATCGATTGGATGA CATGGATGTGCGACAACATTTACAATTGATTGGATTCAAATTTGGCCAAT TCGGTTGACGGTCAAAATCATAATTGTGTGAGTGCGTTTGTATTTACAAT GAGAGCGGTTAGTGGTAATAGCTTCAACTTAAACACCAAATACGAGTACA CAAGAGGGTTAGGTTAAACCATACACAAAGACTACAACCAACAAACAAAT TAATTAACGTAAAAGCGAACAAATTCAAGTTGTACACTTACCGGCAACAC TAGTTGCAACATTCTGTTGCTGCTGCTGCTGCTGTTGCTGCTGCTGCGGA CTACTGGCCGTAGTTTGATATGAGGCCGTGGCGGCAGTCACGGCATGTCC ATTTGCATCACAGAGTATTTCATTTTGCAGCTGATAGACATTTCCATCCG TGCTCGCATATTGTTGCTGCTGCTGCTGCTGTGGAATGCCATTCAGGGTA TTGGCCGCGGGCAACATGTTGACGTAGACAATCTGTTGCTGCTGCCCTTG ACTAGACTTGGATGTGGATGCTTCTGCGGCTGCCGTTGCTCCTCCTGTTG CTGCACTCGTTTGACTTAGTTTTGGTATCTTGCCCTCAAATTTACGCGAT TGTTGCATAAACTGCAGCGACTGTCGCTCCTTTTTGGCATCTGAAAAACG TCAATCGATAAAGTTTAGTACTTGATCAGGCAAGGATTTCAATTGTTTGT GAATAAATGCGGTTGATACGGTTACTGTTGGTGTAAACACACAGATACAC ACACATACACACATGTGGACTCGGGGGGTTTTCTGGATAGGAGGCAATGC GATTTGGGTGGAATGAGGATGTGTAGTCAAAGCGAAAGAGCAAGTGAAGC GGATTCTGGGGGCGGCAAAACAAGAGGAACGGATTCGGCCCAGACAGCAC CAACACCTTGAATTCGGTTTAGTAAAACAGTTTTGGTTTTCGGTTAGTTT TTAGCATAGACTTAAAAGCGTGATCGTATATTTCTCTGGCGCACTCTTAC AATTAGATAGAACGATTTATTTGTACATTAATCGCAAAACAAAAACGATG AACGATACATGTGAAACTGCTTGAAACATTGTCAATTTGGTTAGAACAAA AAACTACTGGGAAATTTGGAATGATTTTTGCTAAAAAAGAGACATTGGGG CATTGGGTTAGAGAATTTGGATGGCTTGGAGGTGGATAGGTGAAGCTGTG ATTATGGGGATGCAGTGGTGCAGTGGCTGCCTAAGCTGCTGCTCTCACCT CCTCCGCCATCTGCTGGTGGTGTTGTGGTTGTGGCTATTGATGTTGTTCC AGCGACTACGGCGGATGTCGGTGTTTTTACGGCAGTTGCTGCAGAACTAA CCGCCGGAGACGTGGTGATTGAGTCCTTTTTCCGCCGCGCAGGAGTCTTT CGGGGCGTGCCACTGGCCTTGCCACGCCTTGCACCCCTCGACGTCGAGGA GGTGGAGGAGGCCGGCGATATGGAACGGTCGTCCTTGGTGCGCGGACTAC GGCCGCGATTGTTTCGCGAGTTAGTCTTGCGCTTGGACGCCAGCCAATCG TCGTCATAGTCGGCATCATAGCGCCGCTTCTGCTTGCGCCGCTTGAAGTC CTCCTCCTCATCATCATCTTCTGTCAACAGGCAAAAAGGGGAAGACAAAG AACAGATGCGAGAAAGGAAACATATTATAGTTAAGCTGGGGAAAGGGGAA GATGATCGTTTTGAAGGGCACCTGCCGGCCCACACACCTGTGCCGTCGTC AATGTACTCAAGCAGCTCCTGCTTGGTCTTCAGATTCGCCGGACTCTGTA GACTCATGGCATCCTCGTTGGGAAAATCAGCCTCATCCGTGGCCAGATCG CCCGTGTCCAGCGTCAGCACGCTCTCCTTCAGCATGGCCTTGACGTCGTC GGGGACGTTGGGATTCTGCTGGATTTCATCCAGGTCCAGATCGGGATTAC GCTCTTTGAAACTCTTGGCCTTGGTAGGATTGCATTGCTTTTTCATTCTG CGGAGGAGCAGGAGATAGGAATAAGACTCGCTGGTAGCCCCACAAGTAGC GCAAGGAAACCTACTTTTTATCACACAGCAAGACATCGAGATGTGGTGGC AGGGGTGCTGCACTGAGCACCGCGTTTGGCGGATCCTCCGGATGCCGCCC CACGTCACGCCCCTCCATCCACAGATCGTAGCGATCGCTTTGGAAGCGCT TGACAAATGTGTCCATCGAGATCTTGACCATATCGTTGCTGCAGGTGCAC TGCACCGCCCGCTTGCCGTACTCGATCCAGCGCTCCATGGCAAAGTTGGT GGACTCGGCACAGTTAAAGCCGTGATTGAAGCCGGCATGATAGCCGAACG GAAATGTGATCATGATCTCGCCCGCCTCCTGCGTGATCTGCAAGAGCCGG ATTTAGTACGGCCACTATGGACAGGATTACTACCGATAAACGCACCTTAC TGACGGGCACGTCATGTTGCTTGAGAATCTGTGGTGAAATCAACGTCATC TTGTGGCGCAAATATGCGTTGCAATTCTTGTAACTGGCCGGAAAGTACTG GTTGGCCACCTTCTCCAATTTGCGACCACACTCCGGCGGCACCACATACC ACGTCTTTGGCGCCCCAAAGTGTAAGTAATTGATGGAATAGAGATCCATG TCCTCCGTGTGCCATGCAAAGGTCGTCTTCCACATGCCAAAGTACAAGTA GGCTGTGTTCACGCCGTCTATCTGGATGTTATAATCCTTGTTGACATAGT CAAGAATTGTGCCCAGCCGGTTGATGTTCCAGCTCTGCAACGGCAAAGGC AAAGGCAACGAATCATCAGCTAATGCCCAAACCTAAACCCTAACCCTAAC GAACTTACATCCTGGTCTGTGTCTGTGATACTTCCGCTGACATCTGCCCC ATAAATGGGCGCCACATATGTTATGTTCTTCCAGTATTTGCGCTCCAGAT CCTCAAAGTCAAAGTGTTTGGGTGTGGCGTAACGCTCGGTGCTGGCCAAC TCGCTAAACTGCTTAACTGTGAGTGGCTTTTTCTGGATGTTAATCTGCTG GTAGTATCCCTGTTTGCCGGTTACCACCTGGCAAATGGGCGCCGGAATTG TGACATTTAGAGCATCGAGATCGGCGTACCCACTGCGACGGGGCACCCAT TCCGGCGGAGGCACCACCTTGGCCAAACCGGCTTTGTGGGCACCCTGGGA CTCCATGTAGGCCACGTACTTGGGAAAGTCCTTGAACTCCTCCCAGGTGG GTCGGAAGACCTTGATGCGTGGCACCTCTGACATTTTCATTCTCGTCTCA GTTTTTCTCTTTTTTTTCAATTCCGACCTGTTGTCGGACACTTCTTTCAC AGCTAGGGTGCTTCGATCTGGAACTGTGATAGAAGCAGCATTAAAACTCC GTACTCCCGTGCACGGCCCATTAATCCCGGGCAGATGCCATTCATGATCA GCCCGTCTGCCTGCCCCATCGCTAAGCGCTCAGCGATCGGATCGCTTGGG ATCGGCATTCTGGCTGGCAGTCACAAAACAAACAGAGAAGGAGCGCTGAG GGAACAGCTGCAACTTTTCGAGGTTTTCTTTTTTTTTTTTAATGGGCGCG GCAGCTACAACAGCAGGCAGGCAGGCAGGACGACTGGCAGGAGAATAGAG GCTGGCAGGATATGCAGTTGCCGTTTCCCCCGCCCCTTTCATTCGAGTGG TTTTCCTCATGGGCCAGCCGGACCCGCAATAACCCATAGGAACCCATAAA AAGTGCAATGATCGTTCGTTTGATAACCTTACTAACTACGAGGAAATGTT GTAAATTAAATAAGTATATCAGATTTCATGCACAACCGGCTGAAAAATTG GGAGTTAAAGGAATAAGCGGTAATATGGAAATTATGTATGTTGCCTGAAA ATGGTAAATTCGATTCATTTCTTACCACAAAATTATTTCGATTAAATATT AAATGATTTAGTTATGCTATAAATTACAATTGAATTATGCTGATAATATA TCGATGATTGTGATAAATGTAAACAACTTTGCCAAAAAGTTGTAAAATTC AGGTATTCGAAATTTAAAAAACTAATTAAAATTAAAACTCCTATGTAAGT AAACATACGAAATATATTTAAACGATCCCCGCAGGATTAGGATAACTTAA AAAATAATTTTACTAATATTGACGCTTTGTCTTCACACTATCACTTAATT AATAGTTACAATTAGCATACAAAATTATTGAACTAAAATTTATTTAAGAC TAGTTCGCAAAACTATTTTGTTTACATTTTATAGATCCCAAATAAAATGA TTGATGAGTGTAAAACGTAAAATAAAACAAAAGTACAAGTCATGCGTGAT TGAAAAATTTCTCTGTGTGTATTTCTGTATACGATAAGCCTCCCAAAAAA AAACACAATAAATCAAGATGAAGGGGATAATTAATTATTGAGCCCCATGA CGAACCGTTATTCCCGCGGCAAGCCATTTATAGGGATTGAAAACGCCCAA TAAGCAAATGACACAAATCCGGCGACATCTTTTTCCCAGTCAATACCAAT ACCAATTGTTTTTCCGTTTGTTTTTCCTATTTTCCGTACAAGCAGACTGA AAGCTCTGCAGGCCAGAGGAACAGCAAGGATAACGATAACGAGGACAACG CTGTGCGAGACATCCCAGAGCACTAGATGAAAATTTACGCAATTTTTCGA CCACGTAGAAAACTGTACCACCACCCGAGAATTTCAGAGAGCGAGAAGAC CAAAACCGAACGAGAGCGGAGAGCCGACGATGTTGGGGAAGGGGAGGGGT AACGGGATAACTGAGAGGGGGGAGCTGACGAGTGCGCAAAACTATATGCT AGTTAACAAGGAGAGAGCAAATATGGTGGGAAGAGCGAGTGAGCGGGCAG GATATACTCGCTACAGAGGAGATTCGACATGGGCGAGTCGCAATGCAGCG AGTGCGTATGCATGTGTGTATGTGTGTTTACGAATATGTGAGTGTGTTTG TGAAAGGACGAAATTTGGAACTCACTTGTGATGTGCTTTGATGGGTTTTT TTTTTAGTTCTGCTTCTCTAGTTTATTCGGTGTTCTCCATGCGTAAATCC CAACAAAATGTCAAAAGTACTTTTATGACTATATGAGCAACTCCAACTGG ATGTGACTAACGTTTTGGATGCTGCTGCGTTGCCTTTGTTTGAAGTGATT TGTAGTTTATTGCACATTATTTTTTGTGTATTTGCATATGAAACTTCTGC TGGCGTTTTAACTAACTGTAACTAATTTGCACAATTTGATGTTTTATACG ATACACTTGAGCACTATTTTCTGGGTTTTGCAATTCTTGTAGAATGATTT AGCTTTGGTATTATTTTATGTTATCCTGCAACATCTGATGGCGTCGTTGT TTTGCGTTTTACACAGTCTTCGACTTGATGGCTGCTGCTCTCTCTCTTCG AGGATGTTAATTTATATATATGTATATTAATGTGGATGGCTAACTGGCAC TCACGACGGGCGCGACATGTCTGAGCGGTCTGAGTGGCAAGCGTCGACTG AACGCCAGTTCGATGCCAGGACGATGGCGACGCAGGCGTCGAAAGAACTC GCTCTTCGCTCGCACTCGCACTCGCACTCACACACACAGCAAGCACGCAA CACAGACACGCTCACGCACACACAGTCGCGCCGCACAAGAGCGTTGTCCT TTTAATGCGAATGCTCTGGTCAAAGCATAATGCGAAAGGAAAATTGGTGT AGAGCAAGAGGGAGACGGCGCAAACAAGTTTGACAGGATAATTGTGGATA GGGAAATGCAAGCCGTGTGGAAAACTGGCAGTTTTAATCGCTCCTCCTTT TTCCTCTATTCATTCGTGGATCGAACAATGCCTTTTTCCTCCTCTTTAGT TTCATTGCGAAAAGCAAATGTGGCGAAAGGAAAAATGCATTCGCCATCGC GAATCGTGAATCCATTCGCACATTCTCTCTCTTTCTCTGCATCTCAGTAA GCAGTCAGAGAAATCGCAAAGGACTTAATCCTCATTATGCATTGTCCTGG CACGGATTTCGGATTTTGGCGAAGATCTAATCTAGGACTTTACTGATCCC GGATCGCCAGTGATCGTTTGTAGGTAAACGACAGATACAGAGGCTAGAGG TTGAGGATCCACTTGAGACGGGTCGCAAGGACTCTCTCACTTGAGACGGC TTCGTGTGTCTCGTACTTAATAATTGCATATTTGTATAATAATTGCAAAA CCAACAAATAGCGTTCAGAGCAATGGCTCGTTTGGAATAATTGTTTGTTT ACTTTTATGCTAGCCAATTTCAATCTAATGCTTTTTATATAGTGTTTTCG ATAGATTTTCCATTTTAAATGTATTACACATTTAAGCTTGATCCTGTGAA CTCCGTTTGCAGAATTAGTACCATTTAAATAGAATTATAATTTCCAAGCC GATCGCATTATATCTTTTAAATCATAACGCCCTCAACTATATTTCTCAAT AATTTCGTTAATAAGAAAATGTCATATTGTTGCAACTGTTAAGGACATTA ATTTCCCCCAAGCGCAAAAGCATAATTTAGTAAATCCCCTATAATGTTCA ATTTAATGGCATATGCGCTTAGCGAATACAAATAAGCACATCTGCAACTG CATCGAGCAATTATGTGATAGCGTTTCGATAACAAGGTTTCTTGCATCCT GTGTGCAGAAAACCCATACAAAAACCGACGCAAAATAATAAAACAGGACG GGGAGTGAAGGAGAGGAACAAAAAAAGGAAACCGGGCTGAGTAATTACAG CAGCTTGAAACGGTGAAAGGAATGCCCCGTGGTAGTATAATTTACAACAT GTCATTAGCCCGGCGACGCCTATGGGAAAATGGAGCTTGGGGGAGCGGCT AACGGCAGGATCAAAGCGTGACCAGAGCACAAAAGAACGGTCACACTGCT CGGCAGGACTTGAAACGAAAGAAACAAAAAGTGGCGGGGTGTCCAAGGAT CCTGTCCTCAAAACTTGTCCAAAGCAACTCAGGCATAACCCACAGAGAGA GAGCAGGAGAGAGATAGAGAGAAACAGAGAGAGGACGAGCGGAAAAGGAC GAAAGAGAGAGAGCTTGCAGCCAAGCAGCGAGAATGACCAGGCGGCGGCT TCAACTTCCGGCAGGAATGGCTCACACACACACATACTAACAGTGCAGTT GTGTACACAATGTGGTCATTGACTGAACGGTAAAAAGCGAAAACAGGAAC CAACAGCAGTAGCAGCAACAACAACAACAACAACAACAACTGCCGATGAC GTCGTCGATGAAGAACACACGGAGAACCGCCATAATGCGCGTCCCCTTTT TCCACATTCCCACCGCGCCCCCCTCCAACACCAAACCACTCCGCCTGTCA TTTTATATTCCATTTTACAAACACACACACGCACGCACACACATTCGTCC TGTGCCTCGTGTGATTTCACAAGGCATTTCTCTTCAGCACAATTTCTCAC AAAATTTCAATTCGAGCTCGGCTTCGCCTCAGCTGCGACAACAGCTACAA GATTATTTATGCTTTTTTCTATGCTTGTTCCTGCCGCTCGTCGTTGTTGT TGTTGTTCTTGTTGTAGTTGTAGCTGCTGTAGTTGTTCCTGCTGCCAGTT GCCTGTTTATATCCTTTTGTGACGCTAAGCACGCGCGACGAAGCCGCACA GTGGGATTTTTACATTTGTAAAAAGTTGGAGAAATTTACTTTCTTTTTAA AATCGACTGATTAAAATTCTTATTTTTTATGTTTATTGGGGATAAAAGAG GGCATTTCCTATTTTTTTTCGTAATTCGTTTGTATTCTTCACCTTACTTA ACTACCTAAACTATATGGATATGCATATATTTGGATTGAACAAATTAAAC TAGCTATTATAATTTTGATGAGGCAGTTGCCAGAAAGCATGCAACGATTG TTACAAGCTTTGAAGCTTTAGTGGTAATGATTTAAAGGCTTTAAAGGACT TAAAGGACTTAAAATTAAAGACATCCCACTGTGCGGCGAGGACAGGCATC GACCGAAAAGCAAAGCACGCGTCCCCTTTTCGAAGTTTCCCTTTTGTTGT CCTTTATCTCAATTGCACAACTGTTTGGCTTTGGCTCGTTTCTCTGCCTT TGCCGCTGGCCTTTGTTTTGTTTTCATGCTTTTCGTTCGTTACATTTTGT GATTCTGGTGCGTGTGTGTGTCTATGTGTGTATTCATGGTGTCTAGTCCT CCTGCGAGTCCTTTTTTTTTTTGAGCAGGCGCCCAGCTACATTCGTCCTG GCGTCCATTCTTTCGGTTATTGATGTTGTTGTGCTGTTATTGTGTGCTAA GTGAATAGAAAGCGCAGAGGAAGGAGAGCAAGAAGGAGCAAAATTCGAAT TCGATGACAAGTTTCCCGTTGCAGGCTTTCCGCGCACACTCGCTGCTCTC TCTACCTATCTCTATTTCACTCTTCTATTTCGCTCTCTCAGCTGCAGCAC GCCCAGCAGCTGCCAATCTAATTAATTCTCCTTTTTCTCGCTATCGTTCG TCTATTGCTCGACACTTTTCGCATCCCAAGTCTTATTGGTCAACAAAATG GCGGCCATATGAAACAGAAAGCGCCAGGATATACGGCTAAGTATATGTGT GCATATTACATGTGGAGCAAAAAGCATCAGGATGTATGACTAAGGATATG TATATATACTACGAGGAAAAGCGAAAACTTTTCAAGTTGGCCGTGCCCGT GTCCGTGCTTAAGTGGCTACTTCGTTATCCTGCGAAAGGAAAGTCGATCG GAGCAGGATGTGCGCACCGGGACCTTAGTCGCAGCAGACAGACACACATT TTATGCTCCGCATTCAGATCTGTGGCATTGCAACAATACATAGAACGAGG CCAAGGGACACTAGAATGCAAAAGCAAATTCTAAGGACACCTAATTGTGG TTTAAAGAATAAGTATTAAGGTGAGCAGTTAAGTGTTCTCTTAAAACGCA AGCATTTATTTTGAGAGGAGAGGAATTTACATTTGATTATGAAATTCTTA TATGTGCGATCCATTTACATGCAAGTTTGTGTATTAATTAAGACAAATGG ACTTGAATTGAACATTATTGCATAAATAATAGCAAGGAATTGAATATTGT CACCTTAAATTCAGAACAAACCAATAGGTAGTTTCCTTTTTCATTTTTAT TAATTAATTTCCTTTTGAAAATATCGAGCAATGTTGCGAAAAATCTCTGA AAAGTATGCCACGATTTGCAAAAGAAGCCCCAAACAACAATTTAACCTCA AATTGGGAATGCCTCAACCTTTCCCAACACCACCTAACCCGCTTACTATA CACTTAAATACCCTTAGTTGGATTGGTAAGGATCGCATCGCACCACCCAC CGGCCACCAGTGCATCACAACCACCCGGCGGGGCGGCGACCTGTTGAGTT GACAACTTGTTCGCACTTCATCCACTCGGAACCACCACACCTGACCTACG GACGGGATCTTTGCCAAAAGCACCACCTAGTCGGTCCGGGGGTATGTTTA TTATGCTTTATGAATGGGAGCGGGAGCGGATGCTCCTTGCTCTGCCTCAA CTACCACCGACCACCGCGGATTCGCTCTGTTTTGGTCTCAATTGGTATGG TTTGGGTTTTTTTTTTGTGTTTTTGGTTGGGAAAACCCCTAAATGTGACG TCGAAGACGTTGTGTGGATGGATGACATGCCGGCACACGCCACCATATCA GCCATATCAGCCGTAACCGTATCCGTTCCGTAGGTGGTGGGTTCGGAGGC ACATGACCAAGAGCAAGAGCGGATACGGTCGGTGCCGGTATCTCTGCTGG GGTTGCTTGCGTTTGTTTACATTTTGGGGGGTTTTCCCAACGTCCTTGCA CCTACGAGAAGGCCGTGCTGTTCGATGTGGTGCGTGCGTGTGAGCGGAAC CACCCCATGCGCCATGTGGCCCAGAGCAAGTGCGCCAATGTAGGTCGGTG GTTGCTCTGGCTCTAGCTCTGGCTGCGACTCTGGCTCGGGCTCTTGCCCT GGTGGTGATTCCAAAAATATGCCCAGACGTGTCTAAGGGTTACTGCCACT GCCGCTGTCACAGTTTCGCTTTTTGTTTATAAACATTGCGCCAAACAGCT GATTTTTGGCCATCCCCCAAACGACAGTGTCCCGCATTCCGCTCCACACA ACCCCACCAGCACCCTTTCTCCACCCACAAAAATAAGGGGAAACCCGTCA CTCGGCAAGGATAAAGTGCGCTCCAGGCGGAATATACTGCATCACCTGCA TGCCGAGTCCTTAGTCGAACCGCTCTCCTCGTTCAGGACAGCTGGCTGGC TGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTGGCTG GCTGGGTGGCACAGCGGCAGACCGGCCTTTTCAGAACCGACAGATGTCTG TCGATGTCGGCCGTAAAATGCAATGGTCGCTCGTGGGCAGGCAGTCCAAC GAATTGCAGCCGGCCCTGAGGTATTGTGGCATTGAGCAGGAGCGAGCTGT AAAGGACGATGGCTCCGATGGGATCGAAAGCGAGCCTACGTAGCTGGCCT GCTGTTGCATTGATTACTTCACGGACGGAACAGCAGCGGAGCGGTCGTTA ACATCTGGTCCGCTTTGCCCTGCTCATCGTTCATCGATCCTTGCCTTGGC ATGTGCCACGAACCAAAGGACATCTGCCAGCTGCACAAATGGGCCCCCAA CTATTCTATCTAGTTCCTGCTATACATTTTCAGTTTTTCAGCATGGCAGT GCGCTCTTTTTTTGCGAGCAGGGAGCGCGAAAAGCTAATTAAACAAGAAA TATAGGGCGATTCCAACTCGTTTTTGATGAATGACATCCTTTGTCCTGCT GCAGTTTCAAGGCAGTTACAGTTTTTTTTTGCGGTGACACCAACAAACAC AAAGAAAAGTACTTTTTTCGGGGTAATGATAATAAATCAATCCTAACAGC ATTACTTTAGCAATGAATTCGTTTTCACTAAATTTACACAAACCATTCCT ACTTTTTAAGCCTTTGTATATTAATATATACAGCCGAGAATACCCTGTGA ATATTTTTCTTATATCAAACCCCAAAACTGATGATGATGAAGTTTGTTAG CAAAGCTGATATGCTGGCTCCATGCCCAGCTGCTTCTCCAGCATCACCAT TTGGATCGGCATCAGCTGCCCGACCCCACAGGATGCCTTTCCAATGCCCA ACGAGCCAGCATAAAAAACCTGCAGCAAGCGCAGACCAAACAGCTTTCCG AAAAATGAACTCTCCCAGCTGTAACTGGACACCGAAACCCGTAGGGATAT GGCTGGGCATGGGAGTGGGGCATAGGGATAAGGTCGAGTACAGGAAGAGG GGAACGATGAGTGCCCCAACCGGGAAGAGTTTCGAGTTGCGTTCTGAACA ACTGGCGGACTGGGTAAGAAAACCGGTATGTGAGCGGCGAAAGGACACGA CTGCGATCGAAGGCGATTACATTCAATTTACGAGGAACGAGAGCTGGTGA AAAGTGCCAGCCAAAACTGTTACACAATTCGAGACTTCCGCTTGCGACTG TCGTCAAAAAGGAAGTGCTAAATGTCGCTAAAAAAATCACGGCTTCCCCG TCGGTCTAAAGTCTGCCCTGCTCCAGTGGCAGCTGCATTTTGCCACGATG TATGCGCAGGCGTACATTGAACCTAGTCCTTTTAGCTGGATGAGGCAGGT AAGAAGAGACCCAGACAGGACGGCAGATGTTCCTCTTCGCCAGTCCCTTT TGTCGCAGGTCAGTTGCTGCCTCCAGAAGAGTTGATTTCGTTATCCTGTG GGCACGTCAAAGGCTTGTCAAACATTTGTTTACCTTTGTTTGCTTAGAAG AAGTCATTGAACGGTAGAGCAAGGTTCTATCCAAACCGCAGCTGCTTTGT ATATAAAGACTACAAAGGCAGCTCAAAAATGCATAGAGACTCCTGATCAA ACAATTCACATTGTAAAATGTGGTCCGGTTCATTGATAAGAAGGTTAATT GGTGCAACTCTATAGAGGTAGTTTAACATTAAAGAATGTAATCCAAAGAT GTACAAGTTTGAAACGCAGTAACCCCATAGTGTGTATAACTTCTTGATCA GTGTTAACAGTCCAGTCGTTCCAGACATGTCCGTATTTTCGTTTTTACAC AACCTAGTACCAAATATTTTAAAAACTCCCAGAGAATATTTCTGTTACAA GTAGTTACTTAGTTGTAAATTCCCAATAAAATGGAATAGAATGTGGGTTC CATAAAAATTATCGAGAAGAGGGACCAATTTTAAGAGTCATTGCTCAATA TCATTGTTCCTTATGTAAATAAGAAAGACAAAATTTTTAATTCTTTCATA TTCTGAGTTACGTGAAAAAGGAAAAAAAATCAGAGAAACGATCGGAAAAT TAATCTTGTAGTAAGAGGAAAGCCATTATAGCTTCGTTCATTTTATGAGT CTCTTTTACACTGGCAAAAATATATATGGATCTGGAAACTAATATTATGT CCCAGTATAACCGTGAGAATACTAGTAAAAAAAATACGTAAAACTTCGTC AAAATCATTTAAACTTTAATGGTAACTATGCTACTCTAATTTATATTTTA AACGCCAGGCAAACTTTCTAAAAGGGGTTTTCAGCTTTTTCCTTAATTGT TAGCGCTAAATAACATTTCCATGATATTTATTGACATGTGGATCTATAGT GTTAATTTTCAATCGAAGCCCACGAATCGTTTGCACTTTAAAAATATTCT ATCTTGGTGTAAATGACTACAAATAAATCTAATTAAATAATGTGGTGTCA AGTATATTATATATATTTATGTTTTAATGTGTAAACACCCCTAGAAACAC GACCTCGAGTGTGCATCGCAGTCATCGGGAAAGGAACCACACCGCCAGTC CGGTGTTACCGGAGCTACCCAAGTTAATGGAATTAATTCGCGTCCAAGCG TTCCAGTAAAAAACGGACGGAACGCTGTGGGTGGTTGGGAGGCAGCCCCA GTGGACGAATTGAAAAATCGATTTTGCACGGCGGACTCGCTGCTGCGAAT CGCCAATTGGTAGGCAGTGCACTTTCGGCTGGGAAACTCACCCGATGGAT ATGACGCCGATGCTGCTCTCCTCCTCCCCGCGCACTCCTCCAGCTCCTGC GTGTGGCAGCTCTGGGCGGCTGGTTTTCAGGAAGATGTGGAACACCTGGT TTTTCGCGAATTCCTTGCAAAGCGCGCTGCTGGTTGCAACGGAATCGGGG AATCGGGAATCGAGGAATCGCAATCGGCGTACGTGACCGAGAAAAGGTGC TCGTTCACAATGGACGCAGACGCAGTTTATTTACAATAGATTAGCTTTCG GTTGCACATGTCTGCGAGTGTGTTGTTGTTGTTGTGTTGCTAAACCTATT GTTTTTCGATCTCGTGAGCGGCTAGAACGGCCATGCTATCGCTGCACGAC AGTAGTTCTTAGAATTTATATAAATTTGGCAGGAATTTCCTTGCCATTCT TATAGGAAGATGGCTGCTTATCAGACGCTTCCTCTGCAGTCCAATGGACA CACACTCGAATGGGAGCACTTACACTAAACGGAATAGTTTGTCATTTTAT GGGGTGGTACACTGTGATAGTATTTACCGATCTCTGATGTTCGTCCCACT TTACATTTCACAAAGGAACAACACACAATACACTAGCTTCTGAATTTATT TTTCGCAAAAATCTTCCCATACAAAAACACCAAAAAACACGACTGTAAGT GTGACCAGATTGCAGCGATAACGCAATCTAAATTTTGAGCAGGCCTATCG AATTCCGACAGTGCTGTTAAACTACATTTTCGTTAAAGCTTTTAACAAAA TAAAGCATTTAAGATATAAAAAATATATTTTGGAATAACTTGACCATTTA AGTTTTGATTCCGGAGTAAGCAATTTCAGATTGTTTTATATAATTTAAAT CTTTTTCATACTGGAAAAATTTAAAAACTTTTAAAATATTTATACAACAT GTTAAAATATAGTCGTATTTAGTTATCGTAAAATATATTATCATTGATTT CTAAATATTTGAAGCACCTTATATTTTAAAAGGTGATAAAATTCTATTGT TTTTCCGTTTAAAAATAAATGAATATTAAAGAATTTATGTATACAAAATA TTAATCTTACATAAGAATTTTAAAATACACTTAATATAAATCATAAATTC AGTTTTTATACCTTTTAAAAATGATTAAATGTTATGTGCCAAATGGAATT CAAAATAATAATATCTGTTGGCAACCCTGGTCCCAAACTGCACACGTTTT CATATGTTTTTCTGCGACTCCAGTCTAACTGCATGTGAGTAATGTACTTC GTCCATTTCGTCATTTAACTTACAGTTGCACTATCCAGATTTAATCCTGA GATCAACTGAAAAATGCCCGAGGCTGAACAGCAGAACGATGCCAACGCAC CAGCCGGAGCCGGGGGTGATCCTCCCAAGACGGCCAAGCAACTGGAAAAG GAGCGTCTGAAGGCGGAGAAGCTGGCCAAGCTGCAGGCGAAGCTGGACAA GAAGGCTGCGGCTGCTCCAGCAGCGGGTGAGAAGAAGGAGAAGCCCGAGG TTAGTGAAAAATCCATCCCAAAAGTGCCTCCTATTTTGTGATCTCAAATC GAGGTTATGTGGCCAAGTGAGAGGCAGTAATTGCTGCCCATTGTTACTGG TGAAAGCGAGTGCTACTTATATGTAATGCTCGAATTACTTTACTTTGCAG AAGCGCACCAAGGAGGTGAAAGAGGCTGCCGTGTACACGGCCCAAACCGC GCCCGGTGAGAAGAAGGATCTGAGTGGAGCCTTGCCGGATGCCTACAGTC CACGGTATGTGGAAGCACAGTGGTACAGCTGGTGGGAGAAGGAGGGCTTC TTCACGCCCGAGTACGGAGTGAGTTTATCCTTGGTTTTGGTTAAATGCTG GTTTCTAATACTCTTTGAACATTTAGCGCGCATCCATAGACGCCCCCAAT CCCAATGGCAAGTTTGTGATGATCATTCCACCACCAAACGTGACGGGCTC TCTGCATTTGGGTCACGCCCTGACCAACGCCATCGAGGACGCCATCACGC GCTACCACCGCATGAAGGGACGAACCACTCTATGGGTGCCTGGTTGCGAC CACGCCGGCATCGCCACCCAGGTGGTGGTAGAGAAGCTATTGTGGCGCGA CGAGAAGCTATCGCGGCACGACCTAGGTCGCGAAAAGTTCATTGAGCGCA TCTGGGACTGGCGCCGGGAAAAGGGCGGTCGCATCTATGAGCAGCTGAAG TCCCTGGGCTCCTCCTATGACTGGACCCGAGTGGCCTTCACCATGGACCC CAAGCTCTGTCGCGCCGTTACCGAGGCTTTCGTCCGATTGCACGAGGAGG GCAGCATCTACCGTAGCTCCCGACTGGTCAATTGGTCGTGCACCCTACGA TCGGCTATTTCGGACATTGAAGTGGACAAGGTGGAGATTCCCGGTCGCAC ATTCCTCTCCATTCCCGGATACGAGGACAAAGTGGAATTTGGTGTTCTAA TAAAGTTCGCCTACAAGGTGGAAGGCAGTGACGAAGAGATCATTGTAGCC ACCACCCGTATCGAGACTATGCTGGGCGATACTGCTGTGGCTGTGCATCC CCAAGACGATCGGTACAAGCACCTGCATGGCAAGTTCGTAGTCCATCCGT TCTCCACGCGCCGCCTGCCAATCGTCTGTGACGAGTTCGTGGACATGGCT TTCGGTACGGGTGCTGTGAAGATCACCCCAGCCCACGATCCCAACGATTA CGAGGTGGGCAAGCGCTGCAATTTGCCCTTCATTACAATCTTCAACGACG ACGGCTACATAATCGGCGACTACGGAGAGTTTACTGGAATGAAGCGGTTC GAGTGCCGCAAGAAAATCCTGGAGAAGCTTAAGGCCCTGAATCTATACCG CGAGACATTGAACAACCCGATGGTGGTGCCCATCTGCAGTCGCTCCAAGG ACGTGGTGGAGCCGCTGATTAAGCCGCAGTGGTATGTTAGTTGCTCGGAC ATGGCAGCCTCTGCCACTGAGGCAGTGCGCTCCGGAGAACTAAAGATCAT TCCGGAGCATCACACCAAGACGTGGTACCACTGGATGGACGGTATTCGCG ACTGGTGCGTGTCGAGGCAGCTGTGGTGGGGTCACCGGATTCCGGCATAC CATGTCAGCTTCACCGACCCTTCTCTTCAAACTGGATCGGTGAGTAAATC TACTTTGGATAATAATAATTTGTATGGGTAATATATTTCGTTGGATATCT TAGTCTGCTCATGGAAGTGTGGTGCGTAAAAAACCAAAACATAACTCTAT AAATTATAGACAACACTTTTAAATTAGACAAATTAAAATTTTCCTATTTG TTTCATTTTTAGAACGACGACGAGCAGTACTGGATTGTAGCACGCAGCGA AGCGGAGGCTCTGACCAAGGCAGCCGAACGTTTTGGAGTGGACGCCAGCA AGATAGTACTGAAACAAGACGAAGATGTCCTGGACACATGGTTCAGTTCG GGAATCTTTCCCTTCTCCGTTTTTGGCTGGCCAGACCAAACTAAGGATCT GCAAACGTTCTATCCCACATCGCTGTTGGAGACGGGTCACGACATTCTCT TCTTCTGGGTGGCTCGCATGGTATTCTTTGGACAGAAGCTGCTGGGCAAA CTGCCGTTTAAGGAGGTCTATCTTCACCCCATGGTGAGGGATGCGCACGG ACGCAAAATGTCCAAGTCCCTGGGAAATGTTATCGATCCTATGGATGTTA TTCGTGGCATTACGCTCGAGGGACTGCATGCTCAACTTGTGGGCTCCAAC CTGGATCCTCGGGAGATCGAAAAGGCTAAGGCTGGACAGAAACAGGATTA TCCGCAGGGAATTCCCGAGTGCGGCTCGGATGCACTTCGATTCGCGCTGT GCGCCTATATCACGCAAGCGCGCGACATCAACCTGGACATCAATCGCGTT CTGGGATATCGTTTCTTCTGCAACAAGCTGTGGAACGCCACCAAGTTCGC CCTGCTGTACTTCACCGGCTCTGAGAAGTTTGACACGGAGCTAAGTGCGT CTGCAGCGATCAACCAGATGGACGCCTGGATCCTGTCACGCTTGGCAGCT GCCATAGAAGCTTGCAACACCGGCTTTGAGTCGTACGACTTTGCTGCAGC GACCAGCGCCTGCTACGCATTCTGGCTCTACGATCTGTGCGACGTGTATT TGGAGTGTCTGAAGCCGATCTTCCAGAGCGGCAGCGAGGAGCAGCAGACC GCCGCAAGGCGCACGCTCTACGTATGTCTAGATTATGGACTGCGCTTACT CTCCCCGTTCATGCCTTTCATCACGGAGGAACTTTACCAGCGGCTTCCGA GGGCAAATCCCGCTCCTAGCATTTGCGTGGCTAGCTATCCCAGTAAGTCG CATTTGATTTCTTCATGATGATAGAATTCAAATAAATTTAACTTCCTCAT AACTAGGCAATACATCCTGGCGCAGCACAAAGATAGAATCGGACGTTGAA TTTGTGCAGAAGGCGGCGCGAATCATCCGATCTGCCCGTTCCGACTATAA TCTGCCCAACAAGGTTAAAACCGAGGTGTATATAGTATGCACGGATTCGG TGCCCAGTGAAATACTCAAACGCTACGCCAGCGATCTGGCCACAATCTCC TACTGCTCCAATGTGGTCTTTGACAGTCCCGCACCGCAGGGCTGTGCGAT CCTCACCGTGACGGGCCAGTGCGAGGTGCACCTGCTGCTCAAGGGACTCG TGGAGGCGGACAAGGAGATAGCCAAGCTGCAGAAGAAGAGCGACCAGCTG GTGCAGACGGTGGGCAAGCTAACTCAGGCCATCCAGGCCGCCGACTACGC AACTAAGGTTCCCGCCGAGGTGCAGGAGGCCAACGAGACAAAACTCTGCG AGTCGCGGGCAGAGATCGAACGCATCGCTGCCGCCATCGAGACTCTGAAA CTAATGTGAACAGGGAACGTGGTAACCGCTAGTCGGGAAGACTGGTAATT GATATTTAGTACGCTTGCCTTGCCAGCTGCTGGGCTTTACTTAAAAAATA CAAGAACGCGCTTCACTCGCAAACAAAGTTAATGCATTTCGTACAGAGTA GACAAATCGATTGATGTTTTATTTATTCATAACGTCCCACACATGAAATT TGCCCCAATATAAATAAATAGAAAAGATAAAAATACCTAAGGGATTTTGG TTATTCATAGCCCGAGCGAGCTACCAGGTTAATCGAGTGGCATGATCCGT CTTGCGCTTCGACATCTTAATGTACCCCAGAAACTGCAACTCGGCTACGG CACGCGTGAATCGGGCCCTGGTTGAAAGGAAAACCAAATGAAATTGATGA TATTACAGAGAGAAATCCATTTTTTTACTCACTGGATCTGGGGATCGATT TGTTCCTGGGCCACTTCCTCGTGGTCGCTGTCGCTCACAACAGATCGAAA GGCCTGCAGCCAGTCGAAAAGGTTGATCATGCGACCGCACTCCAGGTGCA GCTTGTAAACCACGGAGAGATCGGGCAGTGTGCCAACCAGCAGTGATTGA TCTTGTAGCTCGCAGCACTTGCACTGCATGTAAAAATGTGGATTATTCAG GGCAGTGTGCAGTGCAGCCCGCGGAGCACCAATTATGTTTCGCCGCACGG TAGCAATGTCGCTGAACACAAAAAGTTCGTGAATAGGTGGTGCATCCTGC AGCGCACGGAGATGATCCTGTACAATCTGCGTTTCGATAAGCTGCAGAGT CTTTTGTAGAGCTCGTCCGAATTGGGTGGTGGGCGTGTTCAGCTGATGCC GCATCTTGTCCTCCTTGCTACGCTGTAGGAGCTGATCTTTCAATTCTTGA CGCGAGGCCACCGGAGTCAAATGGTCAGTCGCCTGGCGGGTTTCATTGGG CGATGTCGTTGTAATTGTCGCCATGGTGGCCTTGACCACTTCGTCCACTG CAAGGCGTATAGCTTCTAACTTAGGTCTCAGCACAGCAGTGCAGGCCTCG CCCAATTCCAGCGGAGCAATTTCTTCAACCAGGAACTGTTCGGTTCTTTC CAGGGCTCGATTCACTTTAGCAACAAATTCGTCCTTGGACAGAAAGCTTA GCATCTGCAGGCACTCCTTGTACTCCGGCGTCGAAATGATCGCACGATTA AGACAGTTGACGTACAGTTCCCGGCGTAGCTTTCCCAGCGGACAGCGCGG CAAATCACCAACCAGCTCTGTAAGGAACTCCAGAGAGCAGCGGAAAAGCA GGAAGTGGAGCAGGCAGTCGCGCAGCAACTGCGGCAGTTTCTTCTTTAGG TAGTCATCGTCCGTGAGCACGGCTATGATGCGTTTGCAATCATTGATCTG CTCGACGTACGGACGAAACGATGGGAGCCTTCTGATGGTTTCCATATCCT CGTGGGTCAGCTGCTTTATGCGTCCCAATGCTTTGCTGTAGTCTGTGCAA AGAGCAAAGGCATTCCCACCAAAGAAGTGTTCCATCAGGCAGTACTTGAA GCCCTGAATAAAGCCGTGGATGGAGAAGTCGTAGTATAGGAAGATGTGCG TCAGGAACTTGAATGTCTTTCCCGACAGGTGGAAAGCGTACTTGGGCGAC AGCAGAACTTTATCCAGCACCTAAAGGTTGTTAGAAAACCGATTAGTACA TAAACTAGCACAGAGTTAAGGAATATTACCTCATTAAGGCCCGTGGGAGC AGCTTGAGTCTGGAACACCCTTAGACGAATCTTGCTGCTGACGTGGTATG GTAGTGTCCCATGGACAGCTGTCATGGCCGTGGCCACTCCCAGGACCAGG ACGAATGGAAGCGAGCCGCAGTGAGCGCTCAAAATTAGAATAAGATCCTG CAGCACGCTTGCGTTAAAGCACTCAAAGTCGGGAAGGATGACGACCAGCT GGCGGCGCTTCTGTTCCGAGTCAAAATTGTTCGTGTACCAAGACTTCAAC TGCTTCATGGTGCACTGCGAGCGACGTAGCCGCTTGCGATCCCGTTCGGC ACCATCCTCGTCCTCGTCCTCGTCTTCCATTTGCTCCACTTCTGCATTAT CTTCTACGAGCCCGAAAACCAATGTCTCAACGGCCGCCTTGAGAGTGGCG CAATCCCTGGACTGCAGCACACATACCATTGCAGCACGTTGGGCATGGAG TCGCTGGGTAAGTGCCGTGAACTGGCTGAGATGATCCGGCTGATTAATGC CCGTTAGCAAGGCGGCGGTGGGCAGCACCTCGTCCGGGGTGTCGCGCTCT GCCTGCCCCACCACAAAGTCCACCAGTTGCTCCAGAGTGCGGGCATAGCT GCGGTGCTGCAGGTCGGCAATGTGATCGTTTATCTGATTCCAGGCCTTGC GATATTCCTCATAGAAGGGCTGCTGCACTACCTCTTTGCCAAGAAGACTA CTGGATTCTGCGGCAGGACGCTTCCGTTTGCTGGCCGCCTTTTTCCCTGC TCTCGTAGCGCCATTTTTGTAGACAAAACAGCCCTGCAGACAACAAAAAT AAGTAGTTAAACATCTATGTCCAGTTTGGAAGCCGAAGCCACTCACCTTG GACACTGAAATGGTGGGATCCATCGCTGGCTTTGCACTGCGGCCCGATGT CGTGGAGTCTTTAAGTCGCCGGGTTGCGTTTATTTATTTATTTGTTTAGG TCAGCTCTGTGCCAATTAAAGTTTCTTCACCGGTAGGAACGCGAAATGAA ATCAGCTGGCTGTTGTGTTTGGCGCCAAACGGGCGGCAGTGTTGGCTAAC GACTTTAGGGGGTATCTTTGAAAACAAGTGTGAAAAGTATAAATTAATTG AATATTTCATCTAACATGAACTAATAATAAGAAATCATACCCTTCGTGCT CGTACGCCACCATTTTGGTGGATACGAATTCGTCGTAGTTTCTGTGAACA GCACCAAGTTTTTTGAACGTTCGCCATCGCAACGATCCGACCATTTTGGG GCCACTTGGAATGAGAAAAGATAGAGGAGCAGGAAATCGAGGAACAGTAT GATGGCTGCCAGGAAGTAGTCCTTCGTGCGCATCTCGGCGAACCTTCCAC CGTTTATAATCTGCGCGTGATACATGACAAACTGTAAGGAGGAAACTAAA TGACAGAAACTAATTCAAAAATGTATGACTCAGTACTAACCATCAAGATG CTGATCACTATAAAGCAACGGGCGATTATAAACGAGTATGCGACATTAGC CACGATGTAGAGCATCACGAAGTATATGGCGCCGATAATGGAAACCACTG CAAGCACAAATAGCACCACAACATCCAAAGTAAGATCCAGCTTAAGGGGA TAACAATAAAAATGTGAAGCTTCAGATTTGAATCAAATGGCTTTCATGTG GACTCTTCTTACCGGAAGAAAGGAACCACAGACAATAAAAAGCGCCAATG CTACGGTCCATATAAGGAAGCTGAAGAGAAACTGATACTTGTAGTGGCGG GCAACCAGCGGTGCAATCCCCAGTACAATGCATTCAAACTGGAAAGAATA AGTTCATACTGCCACCCAGGTTATGTTTCACATTGTAGACTTACAATTAG AAAGGCAAACAACCAGTTTACCATTTTATTAAAGCGCAGTACCTCGAAAA ATATGAAAAGTACGAGGAGTATCAGGCCTATTCCAAAAAAAAGGCAGCTC AACCAATGGTACGAAGTAAAAAATTCCCTTAGAAAATTTCTGAAAATTAA GAAAAAGTGCAGTGAGGATGAAGTAATGTGAAAATACATACGTACACAAA GCGGAAAGTGGCCCATTGCAACAGCGCAAGGATCAGGAATATCGCGGTTA GTAGGTAAGTGATCAGAGCGAACTTTCTTCTTTCCTTCTTGTAGTAAGAA CTTTTTTCCGGAATGTCTGCCATTGTGTAGTGTTTCTCGAGTATTATTGT TTGTATTGTGATGTTTTTTTTTAACGAATTTAAGTGTACAGTAATACGAA ATGGGAACTAGATTGATTTTAAAATTATATTCTTGGGAAAACACGTAAGT GCATAATAAAATTTTTAAAATATTCGTTTTGGCGCCAAATGTTGCTGCTG GATATCGATATCCACTATCAGGGTTGCCACATTTTCAGCCGGTCAGCTGT TGCTTCCGATAATCAACTGCATCTTCTGTTATCGATTGGCGGCAACACGG GATTTTCTAACAATATTAAATAGAATAATAATAATAATTACATTTATACA AATACACGGCAGGGAAACAAATTGCACGCCAGTTTGGAGGAAATGCTCAG GACAGTGACCATTGAGCTTTAGTGGAACTTTTATTCCCTGAAACAAAAAT CAAGAACATTGAAATTCTTTTGTGTTTCGAATTTTGATCAATTTATGACT GAACAGGTAATCAATAAAGTAGCTCCATTAAAAAACAGTAACTCTAACAA TTCATTTTATGTATCCTTGTTTAAAGGGCAGCCAAGAAGAAACGTAAGCG ATTGGTATGGAAACGCCTGCATATGCCACGAAATCTGGCGGAGAACTGGT GCTGCCCGAAGCTCTGGAGGACTTGATGGATTTGGAAGACCAGGACGCGG GCGGGATGAAGTCCAACGTTAAGGATAAATCCATGGATTTGGATATCTAT CACGATTTGTACGATATAGAGCCTGCAGGTTCAAAGAAGCCTGACCAAAT GGACAGATCCCTTGAACTGGACATCTACGATGATTTGGACGACTTTCAGA AGGCCGAAGATCGTGTAAGTTGTGCAGGAATACGTCCTTTCAGCAGAGTT ACCCATTTACCATCTCACAGAATACCAAGGAGCTACAGGCATGGGAAGCC AAATACGAAAAGGCACTGGCCGAAATTGAAGCGCTAAAGGTTGAGAATAA GGCACTTGGCAAGAAGATAAAAACCATGGAGGTTAATCTACAGAATCTAC TGGACACAGCTAAGGCGGAGGTAAAGAGAAAAGAGACACTGATTGCCGAG CTGCGAAACGAGTAAGTTAGCATATTGACTCCCTGCTTCTTAACAAACAA CACATTGTTCAACAGAAAGGACGATGTATGCTTCCGACGAAAACGAGCAC GGGCGTTTGACGTACCAGGTGCAAGGGAACCCGAAAGTAAGCGTCCGAAA GAATTTCAATCTACACCAATCGATGTCAGGAAATATCCGGAAACGAATAG AAATCCGTTCAAAACGGCTGCAAAGGACGCCGCTAAGGATGATGCTAGGA AGATGATGACCAAAAAAGATGACACAACGAAAGTCGTATCAAAAGATGTT GAAAGAGGCGTAAAATCCAAGGAGGATAATAAGATGGCGACCAATAAAGA TGATGACAAGAAGTCATCCTCAAAGGATGATGCTTGGAAATCTAGGACAA GAGAAGACGCCAAGAAATCGGTCCAAAGAAGCAAGTCTCCCAGGCCGGAA CACTCAAAGACCACCGATCGGAAATCTACTGCACAGGCTCGTCGTCCAGA TCCACATCGCAGCCGGAGTCCAAAACATAATTCCCGGCGAGATCATCACA GGAATCAAGAAAGCAGTTCCCGGCACGCCAAACGGCGAAGCCAATCCGCA TCGCCCAGGTCAGTAAAGCAGAGGGACATAAGTTACATTTGTTGATAGCA CCATCTGATTTTTGTAGCAAGATACAATTGCCAAGAGAAAAAGCAAATGC CATCATCACACTTACTGACGATGAAACAAATGACCAACGCAGCAAGAGCC CAGTCCCCGTGACCGTCAAACTCGTAACTGAATCTCAACCGGCTGAAAAA GTCGTTTCCAACCGAAGGGATGCTGCTTTAGAAACCAATGCAAATTCCTC AAAGGAATCAAAAGTAGAGACGAAGGATATTACTCAACCGACAAATGGTT TAATTGCTGAACCTTGTATTCCAAAACATGAGATTATTCCGGGGTTAAGC TTAATTAACCCAGAATCGGCGGATTTTTCTAAAAATGAGATCAAGTTAGA TCCTGTAATCTTACAGGATCGTACAGAAGACTCTGGCCACCAACTTTTAA ATAAGGAGCCTATTCCCAAAGTTGTAGTACTTGAAAAATGTAAAAACATT TTAGCTGAAGATTGCCCAGCTGATGAGCAACCCCTGGACAAATTCAAGGA TGGAAAAGAATCTGAAGAGACACAGGCAAAGTTAGACAAAAAAGAGCCTT TTGCAGTTGAAACTGCTGTTGAAACTCCTAGCAAAGAAGAAAGCAACGAC AACATAGTATTATCAAAGAATACGACGTCTCAAGCTGATGTGTGTTCTCA GCATGATGAGAATGATGAAGCAGAGATCCGAGAACCGATGGATCAAGTTA ACTCCGTGGTCGAGTCCGACTTGGGAGTAAGGATTATTGAGGATATTCGG TTGCCCAAGATGGCGAATATCGACCATTTTGCTGTAAAGGTCGACAACCA TGGTGAAGCGCCAGCAGCTGTCACAGATTCCGCTTTAAATCAAGAGAACC TAGCCACACAGGACCAAAAGATTTGCGCAGAGATGAAAGATCCAACTATT TTTACCACCTCGGACGAAACTCCAATAAAGTCTGCTACTATATTATACGC CAAGCCCGATTCAACAAAACTGGATCACAGCGATGAACATGACGAGGTTA TCCTGGAAACTGCCATTGACATGCTGAAGAAGGAGCAGGATGCAGCGAGC ACCGCAGAATCCACATATCCGAAACTGCGGATCGCAGAAGATGCCATTGA GATGGCACTAGAGCAATTGCACCAGCAGTCGCCGGACGAAACTGTGGTGA CCTCAACGTCGAATAGAGCGCCGCAGACGCCAAAAAGCCTCATCACAATA CTCACCCAGACTCCAAAACAGGCTGATCCACTA