##gff-version 3 ##date Wed Jul 24 04:43:33 CEST 2024 ## exported from the transgeneomics system molecule_59005525 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59005525 mpicbg region 9631 40973 . + . Name=dmel-5.43-3L;type=genome;start=8494860;end=8526202;strand=+ molecule_59005525 mpicbg region 40974 41928 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2436;strand=+ molecule_59005525 mpicbg region 41929 42035 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3813;end=3919;strand=+ molecule_59005525 mpicbg region 42036 46514 . + . Name=dmel-5.43-3L;type=genome;start=8526203;end=8530681;strand=+ molecule_59005525 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59005525 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59005525 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59005525 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59005525 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59005525 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59005525 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59005525 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59005525 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59005525 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59005525 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59005525 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59005525 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59005525 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59005525 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59005525 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59005525 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59005525 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59005525 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59005525 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59005525 coding_transcript gene 15340 17636 . - . alias=dZC3H3;alias=ZC3H3;identifier=FBgn0035900;alias=CG6694;Name=ZC3H3;alias=CG6694;id=51079041;ensembl=FBgn0035900 molecule_59005525 coding_transcript gene 17909 20875 . + . ensembl=FBgn0035901;Name=CG6745;alias=CT20937;id=51077681;identifier=FBgn0035901 molecule_59005525 coding_transcript gene 20637 26479 . + . identifier=FBgn0035903;Name=CG6765;id=50984239;ensembl=FBgn0035903 molecule_59005525 coding_transcript gene 21740 22762 . - . ensembl=FBgn0035902;identifier=FBgn0035902;Name=CG6683;id=50984507 molecule_59005525 coding_transcript gene 26759 28181 . + . ensembl=FBgn0035904;id=50676915;Name=CG6776;alias=T14;identifier=FBgn0035904 molecule_59005525 coding_transcript gene 28423 29367 . + . identifier=FBgn0086348;alias=sepia;alias=CG6781;ensembl=FBgn0086348;id=51392003;Name=se;alias=sepia;alias=cg6781;alias=CG6781 molecule_59005525 coding_transcript gene 29310 31371 . - . alias=CG6673-B;id=50676863;ensembl=FBgn0035906;alias=CG6673B;alias=CG6673A;alias=anon-EST:Posey29;Name=CG6673;identifier=FBgn0035906;alias=CG6673-A molecule_59005525 coding_transcript gene 31613 32732 . - . identifier=FBgn0035907;ensembl=FBgn0035907;Name=CG6662;id=50676828 molecule_59005525 coding_transcript gene 33115 42917 . + . Name=foi;alias=dFOI;id=50543340;alias=l(3)neo13;alias=kastchen;alias=fear-of-intimacy;alias=l(3)j8E8;alias=kas;ensembl=FBgn0024236;alias=FOI;identifier=FBgn0024236;alias=fear of intimacy;alias=CG6817 molecule_59005525 coding_transcript mrna 33115 42917 . + . id=50543354;Name=FBtr0076624;parent=50543340 molecule_59005525 coding_transcript exon 33115 33575 . + . parent=50543354 molecule_59005525 coding_transcript five_prime_utr 33115 33575 . + . parent=50543354 molecule_59005525 coding_transcript intron 33576 38430 . + . parent=50543354 molecule_59005525 coding_transcript exon 38431 39020 . + . parent=50543354 molecule_59005525 coding_transcript five_prime_utr 38431 38591 . + . parent=50543354 molecule_59005525 coding_transcript cds 38592 39020 . + . parent=50543354 molecule_59005525 coding_transcript intron 39021 39087 . + . parent=50543354 molecule_59005525 coding_transcript exon 39088 39436 . + . parent=50543354 molecule_59005525 coding_transcript cds 39088 39436 . + . parent=50543354 molecule_59005525 coding_transcript intron 39437 39505 . + . parent=50543354 molecule_59005525 coding_transcript exon 39506 39675 . + . parent=50543354 molecule_59005525 coding_transcript cds 39506 39675 . + . parent=50543354 molecule_59005525 coding_transcript intron 39676 39737 . + . parent=50543354 molecule_59005525 coding_transcript exon 39738 40745 . + . parent=50543354 molecule_59005525 coding_transcript cds 39738 40745 . + . parent=50543354 molecule_59005525 coding_transcript intron 40746 40811 . + . parent=50543354 molecule_59005525 coding_transcript exon 40812 42917 . + . parent=50543354 molecule_59005525 coding_transcript cds 40812 42038 . + . parent=50543354 molecule_59005525 CLC cds 40974 41033 . + . Name=2xTY1 molecule_59005525 CLC cds 41040 41756 . + . Name=SGFP molecule_59005525 CLC cds 41763 41804 . + . Name=V5 molecule_59005525 CLC cds 41805 41828 . + . Name=Precision cut site molecule_59005525 CLC cds 41829 41849 . + . Name=TEV molecule_59005525 CLC cds 41850 41921 . + . Name=BLRP molecule_59005525 CLC misc_recomb 41929 41962 . + . Name=FRT molecule_59005525 coding_transcript three_prime_utr 42039 42917 . + . parent=50543354 ##FASTA >molecule_59005525 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACATTTCTGGTTTTTGGCTATC TGCCATGCGATAGTTTTTTATATAGACCGGTGTTTTTTCCCCTAATCTGA GTTTTTGTTTGTAGAAATTGTTAGCCGATATTGGTTCTGTTTCTAGACCA AAAATATCGCTAAACTCGGTGCATAACTTAGTTAGTTCATTATTGAATTG TTTAGGGAATCTTAATTGTTTTAAAATTTCTTCAGTTCTATTTTCCTTTT CTACTGGTGTTGTAAAAATGTCATAGTCTTTCATTGATTCGCATTTGATC TTCGCGCTATCTATTATGGCGTCTTTATTATTTGTATTTATAATGCGAAT CAATGCGTTTTTGCTATCGGCAATGGTGCTTGCTACTATTATACCTGGTT GCAGCTCCTGATTTGGTACTACCACCGTTTTTTCGTTAGTGAGTAATTTG ACTTGTCTGATTACTTCGCATCTAGCTGGCAATAAGAGTGTGTTGGAGTC TAAGTTATGTGTAATTGGTACACTAATCTGTCTACTGAAGTTATTGGGTC TTATTGTGAACCAGTCTTTGTTATTTTGAAACTCTAATACGCAATTGTAT TTCTTGATAAAATCTATTCCGATTATGCCATCGCATGGTATCGGAAAATT CTCAGGTACTACATGAAATTCATGTGGCACTAGAACATCCTGCATGCGTA TGTCAAGATCTACTGTACCTATAGACTGTATGGTTCCTTGCCCAATACCT GTAATATTTGATATATTACTGAAATTTATATTATTATATTCCTTTGCTTT GGCTTTTAGCAATGAAATTTCTGCACCTGTGTCTATTAGTAATGTAAGAA CTGTGTTTGTTTCATGGTTTTTTGTCTTAATGAAAATACTCAGATTTAGG TTTACTTTAAACACTTTTACTGTTGATCGCTTAAGGGGGTCTGGCTGTTT TCCGATTGTACGTTACGCACATTTCGGTTGTTATTATTATTCTGACTTTG GTTACCCCTTCGGTTACCTCCGTCTCTGTTATTACCGTGGCCGCGGTAGC CTCCGCGACCTCTGTTGTTATTATTATAACCTTGGTTATAATTCTGGTTA TAATTATGGTTATAATTATTTCTGCCTCTACCACGATAGTAGGCATTATA ATTACCACGTCTATTATTCCCATTATAGAATAAGACTGTATTTGAATTGC CGGTTATTTCTGTACTGCAATGTAGGTATTTTTCCATTGCGTCGTTGAAT GTACTAAATGTACCTGCAGTTAAGATCATTTTAAGTGCCTCGTTGGCACA GTTTTTGGTCATTGCTGATATCGACTCTTTAGTCGCGAATTTGTCAGCAT TATCGGCGTCTAATCCGCCGTCTATGTAAGCTGCCTCGAGCTGCTTACGC ATACTGTCTATTTCTGTAACATACTGAGACGCGGTCTTGCCTCTTTGTTG GGCATTTATTAATTTGGCCTTTATAACGTCAGGCGATTCGCCTTTTACGT TTGCCTGCAATATGGTAATTATTGCCTGTATCGTTGTCGCATGTTCTACT TTATAGTTTAATGGGCCAATAATTTTGGTCTTTATGACCTCTACTGCTAA AGTTTCTTGATCTCCTTTAGTTAGATCCGTCAACTTAAGTGCTGTCACAA ACCTGTTTAAATGGAGTTTCTTACCATCGAATTCAGGTACTGTGGCAGAT ACCTGTTTAACGTATGCTCTCTGAGCTTCTAATGCGTTGGCCATGTTTCT TGTATTTGGTTGTACGGTATTAAATTTTAATTCTTCTATTGATTCGATAT CGCTTTCGATATCTAAATCTTCTAACGGCTGCGACTCGTCCAAGTCTCTT AACTGGCTTTCGTCGAATTCTGCTATTTTGGTTAGTTCTGTTGGGACTTC TATTATAATACTGTGTCTAACGCTGGTATTATGTAGTCTTTTACCAAATG AACTGAGAACTTTGAAGCATTGGACTTTATGTTCTTCAGTGAGTTTGCTT TTGTTTGTTACTATTAGGTTTTGTAATGTGTTGTATTGTGTTATCAATAC CTTTATGTGAAAAATAAGCGTCTGAGTTTTGATCAGCGCGGTTTTATTAA TACATTTATAGGATTTATCAAAAGCATCTCTAATATTGTTTATGGATATG GTTAAGTTTAGCCATTCCATGTATGTACCTTTTAGCGATGTAATCGCACT TGTACCTTTTTGGTGTAGTTTCTATTAGATTTTGTCTAAATCATTGGCTC GACTCATGTAAGTCTTTTCAACGATCTTTTGTGAAACTGATAAAGTTTTA AGGCCAGGTTAAAAGGCTGATAGGATAACTAAAATCAAAAATAGTAAGTA CATTGAATTTAACTGTGGGGTTGTATCCACGACTTATGTCCCATTTTGAT ATGGGGAAAATTAGTCTTTATTTGTATATCAAAAGTACAAATAGAATTTT AACTTTGAGAATTGGTCAATTATTGTTATCTCGATCAGATATAAATATAG CTCGAAATTTTAATAGGTCTAAACTGTTGTTAAACATATTTTTACTTGAT AGATGAATTCATTATACTCAGTTTACATCGGTTGCAATTTGCAATTTTAC AATATTATTACTTATTTTAAGTTTAGGACTGAGTATAATGTGTTAGTTAT GAAATGGGTCCCTGATAAGTTAGTAATTTTGTTGCAGCGGAAACCGCATC GACAACATTAATATAATATTTGGGCGGTTGAGGCTATGGCGTATAACGCA GCCCGCCGCTTTACTTCGCACCACGAAGTTGTTGATTGATGGCTGCAAGG CGCTCTTTGTAGCGCTGCCGGTCTTCCTCATTAGTTGCCGTCTTCAGTAG TTCGATGTTGAGCCTCCGGGCGCTGAGCAACTTAATCCGGCGGCCACCCC TCTTCTTTTTAGGTGGCTGCTCCCTCGCTGCAGTCCGTGCCTTGTACTCT TGTATGGTCAAGGGCTTTGGTCCCGCGGACGGATCTACCTCTATTACCTC TTTGATACTTGGCAGATCCCTTTGCTCGACAGGAGCAGGGTGTTCGAACG TCTGCTTGGTAGACATTCGCTGTTGTCATGTGCGGCGCGCCGGTGGAATC CTTTATCCTTTATCCTAATCCTACCCTCGCAGGATGCCGTGCTAATTGCT GTTGCGGCTTACAATGGTCGAGGGCAGTCGTTCATGCAGACGTCGGGTCT TTTCGGCTTGGGTGATGTTGAATTTTCAGTTATTTCTTCATTGATTATTT CTATTTTTGCTGAGTGAGTTGTGGTATTCGGCTTTCTTTGCTGGAGGTTT TCTTTCAGAAAGTCTAATTCGGCAGTTAATTTCTGTGCCGTTGCCCATGG GGGCGGTGTTTTATTTGTATATCATAGCCACTTAATATGTGCTATACCTT TATTTTTGATTTCCTGACATCCGCGTTTGCCCATTACCACACTCTACTCA CTCAGTATTTTTGTTTCTTTTTTTTTCATCAGTGTCCCGTCTCTAGGTCT CCCGCACTGGTGTAAGGGGCGGCCTGCCTCTCACACCTGTTGTCGCTGTT TAGAATTCCCAAATCAAATCGGCAATATTAGCAGCATTTCCTCAGTAGTC CTCAGATCGCAGGCTCCTGCCTCACGGTCGCCATGTAATAAACCAATATA TGCCACCAATTGAGAACACGTGTTTTCCTTGCAGTTGGGTGCAGCCGTCA GGCCACCTTTTTATTTCTTCTTATCTCTTCGAGTAGCAGAAACGGTTCTG CCCGCTTAACCTCTACAGAGTGTCTGATCTTACCTAAATACTGCGACTGC GCCGCCGTCGACAGCGGCAGAAGAGCAGCGTATATATATATGTATAAGAG AGAGAGAGAGAGAGCTTATGCGCATATATGGCCAGCGGCCAGCGTGGGGA TGCTGACTTAGCTTAAAGCATAAATGGGTGATCTTATATCACGCTCACTT GAGACATTTATTTATGCAATGCAACTAAGTGTTGCTGTGTACTTATAGGT ACAGTGTACCCTCGATATATGCACATACTACAATGTAGCCCCAAAAGTAA AAACGCCAGCAACATTAATTTTTAGTGGTATCGTGATACAATGCATGTTA AAAGTCATTGTAGTAAAAACCGACCAAAAAGTAACCCCTATACGGCTACT AGGCACCGTTAGTCCGACTGCACGACCCACCGCGATGAGAAAGATTCCAA GATACCCACAGCGTTCCAAACGAGGCCCCAATTATGCAAATTATTAAATG AAAATAAAATCTAATATAATTATTTCGTGCTGGAGATTCGAATTCCTAAT GCCATTGTCACATAAATTTCAAGTTTAAGCATTTTCGGTTAAGACTTTCG TTGGGAATTTATGGGGATTCATGCTCACCATGGAATGTGGCTGGAGACTG GAAATCTATGCTTTGTTCTCCACTCTCTTTTCCCCTTTTTTTATTGTTTC TCGCTTTGTTTTATCACAGGCTGCCGCAGAATTATTTTGAATTAATGTAA TGGGTGAAAATGTGGCTCATAAAATAGTAATTATACGAAATTAGAGCAAA CTTGATGGCGATTTTCCTACAATTAAGCTGGTAATAGGTCAATATTAATG AGTAACGAACGGTTTTCGAAAAATTGTTACACTCAAAATGATTAATGGCG AATATATGCAACCGTTATTTGCTTATTTATCGCAACTTTTGGCTGCACAT TATGTAATTTTACATATTTATGCAGCTAAGCGGAGGTTGCATAAATTATT AATACATTTTTATGGCTCTTTGGTGTCATTTTGGTCAGTAATTTATGTAG AATACGGCTGGGCCAACAACAAGAATCCGAAGAAGAGGAAAAAGCAGAAG GAGAAGTCGCACTCACACACACACACACACACAACACAGCCACACACACT GGAACACAAACGCGGGTCAAACAAGTCAAGCAACTTTTTTCACCTCTTTG GCCAATCTTCGGATTGCCTTCCTTTTTTCTCTTTTTTCTCCTCTTGTTAT TAGTAGCATTTAGTTAGGAATGCACCAAAGCGAGAACGTATCGGAAAAAA TGTACCAACAGCCACAAGTGCACAATTGAACAAAAATTCGGTTGGAAAAT GGTTTTGGCCTGGTTTTCTGGACCAAGACGAAGCGAATGAGAGACGTTGT GTGAAAGAGAGTTTCGAAAATTCCCGATCGCGAACAGATGTCAAAGCCAG TGGACGAGTTCAAAGGCCATTTGCCGCAAATCTCCCATGTTTGTGGTCCG CATTTTATTTTTGGTAACTTCACAGCCTTTTCGCTTTTCTTTTTGGCCTG GTGAGCAATAAATTTGCAAGAGCCACCGCTACACACGCACGAGCACTAAC ACACACTCACTGTTTTTGTTGTTGCTCGAAACGGAATCCGCGTTTGTTGT TCAGGTGTTGTACGAGCCGCATGCAAAATTCAACTGTGGCGAGAAAATCG AGACTCGAATCGAGAGAGCGGCTTAAAAACAGGTACACAACTATGTGGCG CCACAAAATCCAACAACAAGTGGTGCCACCTGGTCACACTGCACGATCGG CATGTTGCCAGATGGTTGAATACACCGCGAAAAAACTGTGATTTATTTTG GTAATAATCTTAGTTTAATAATTTATATACATAAACAACATAAAACGACT AATGCAAATGTTTACATTTTCCTCGAGCGTAGCAAATATATACCCAACCA ATAAAATGTATCTTTTATTTATTTTACGCAAATAAATTTGTCTTTTTGAA TATTTTATTAAAACTTGAAAATAAGCTACTAAAGATAAATCTTAGACTAA ACGTTAAAACAATACTTAACCGAATTAATTTGTACCTGAAACGTTGGGTC CATAGCCTTCGCATAGCCTTATAGCTTTTCTTCGCCACCTAAGGGAATAA AAGAGGGTAGAGTTCCCAGTTGAGGACGTCGTCGAGGGCAAGGGGCACCC GCTTCCTTCTGATCCTCATCCTCCGCTTCAGGTTTCTTCTGTTCCACATC ATCTCTAGTCAATATTGCTTCCGCTGGTTCCTTGTGGGACCCAAAGTAGC GTGAACTGGTGGGCAACTCATCCGCTGTAGACGATTCTTTCGCGGTATCC GTGAAGGCGACAGGTTTACTGCCCAGTTTGGGACGCGACTTGACTTTGGC CAATCGCTTTGATGGCGACTTCTTACAGAACACGCACCTGGGTAATTCGC ACTTGCCCTTGCGCTCCAACTCGGGACAGGAAAACTCGTGACGTTTGTTG CACTTAAAATGTTTTGGAGTTAATAGGTTTTCAATGAAAATAAGTGGCAG ACCTATTTACCTCGGCAGCCAACGGACAGTAGCCGCGCACAAAGTCAATA CAAATCTCGGTCTTGCTGCTCAGCTTCTTGTGTAGGTACGGGCAATCCTC GCGAACGCAAACGCCGCGCAAATAGTACCGACAGACGGGCATCTTCTCCA GCGTGACATTATGGGACAGCAGGCATTTGGGTTTGGTGCACTCCCCGCGC AGAAAGCTGCAAGTAAATGATTTCAAAAAGATAACCGCATTGCGAATTTC GAACATTGGACGCCATCGAAGGTTTAGCACTCTTCGCTTGGCCAAGGACA AACCTGACACAGATGGCAACCTGCCGCTTGTCGTGCAGCTTGCGGCACTT GCCACGACTATGGGCAACGCACTTGCCCAGCTTCTGGAAGATGGCACAAG GCACATTGGTCTTCACCAACGATTTGTTGAGCAACGTCAGGCTTCTCTGT TTGGCGGTGATTAAATGGGCTCGCGACACGTGATTACTGGTGCGTACAAA GACATTCAGTGCCTTTGGCGAAGCAACGTAGGTAAGGCCGCCGATATCGA TGCGCCTCAGGATGCTACGATTTACGCTACTCTGGGTAGCACCAGTTGAT GAGGTTGAAACTCTGGTCAGGCGGCAGCCGGAAGGATCTAAAATGAACTT ATTGCCGCTGACGAAGAGCGTTCTGCCGGACAAGGTACGCTGCAAGGTCC TGGGACTCTCCGATTTGGCTACCCTAGCGGAGGAACTGGCATCCAGCTTG GTTATTTTGTTCTTCGATATCTTCTTGTACATCACACCGTGTATGCTGAC CATGCTCAGGGATTTGTTAACGCCCAGCTTCAGCGCCTGCGGCTTGGAGC TGTAATAAAAGTTAAGTTAGTTGATGTACATTACCTTGTCTAACAGAGTC GCCTGTTGCTTGACTATTTTCAACTGCTCGTATCCGATTTTCATTACCTC AGTTTTCTGTTGGGCTGCGCTTCATTGGTGCGTCTCAGGGCGTACTGGCC CACAAACTCGCGTAGAGGACGACGCTTTTTGACCAGCGGTGTGCAGGTAA GTGATATGGAACGCACTAATTTGTACCTAGTGCGTTTAGCAGGTGGAGGA GGATGGAGGGCAGCAACCGCTGGCGCTGCTTTCAATGCTCCTTGCCTCAC AATTTTCCGCTTGGAAATGCTTACCAATGGAGGCTGCACCAGGCTGGAAA CAGTGGGCACAGGTACTGAAGCAGCGAGCTTCACCGCCGGACCACTTGCC ACCACTGATGGCTTGCGCACGAGACACGTGCTCACTTTGCTGATGATCTT GGCGGGCGGAGGAGGTGGAGTCGCCAGTAGGTGTATCGTTGGATCCAGTC GATAGTGCGAGGCGGAAACTTGTTGCATCATAAGCTGCTCCTGCTGCTCC CGCTGGTATTGGTCGTACATGGCCCGCTGGCGATTCAGAAAGTGCGGATT GATATGGATCGCGGGCTGAGGCTGCAGTGGCGCCTGGAACGCCTGGAAGG GCACTTGGAACGGCAGCTGATGCGCCGTTTGACCTTGCAGCTGAAAATTC GGATTGATGTACACCTTTCGCGACATAGACGGCTGTGCCTCGTCGGCACT TATATGCGGCAACATTTCGTTGCTTCCTTGGCTTAACCTAATGAATTAAT CCGTTCCAATTTTTGGTTATTTCTCAATTTTTACACTTCTTTCCAATGCT TCTTTGTATTGCACATTTTCTTTACATTACGTACGCAGTGTGAACTTGAT CTGGGACCAGAAAAATACCAAAAAATACTGAAGTATAAATGAGGAAAATA TACTAACAAAAGTTTTATGATATGTTAATATTAAGCATGTTTTTAAATTA TATTTATCATACAATATAAAAAAAGAGGAATATTTGCGGATGAACTTATG CTAACAACCATTTAAGAAATCTATTTCCCGAATAAATGGCACATGCGGCC ACCCTAATAAACCTAAAAAGCTTATTGTGAATGGGCACATCATATGTTGT GCAAAACGTGGATTTCATTTGCCGACAAATTTTCAAACGCGAATTTTGAA CCAAGATGGGCAAGGATCGGGGCAGAGGACGTAGGAATAACCATTCCGGG CCATACAACAAGAGCAACTGGCGTGGTCAGAAGAAGGATCGCCCCCAAAA CAATGGTGGCGGTCAGCGCAACAGGTACAAATTAAATCCCATAAATAATA TCGTTGTTAACCGGCGTTTTTCGTTGGACAAAAGTGCTCCACAACAGAAA TCCACGCTGCTGGAGACCCAAGTGGGCATTACGGAGTTCACTAACCCGGA GGCACCTGGCTTCACGGGAATACTTAAGTCTCGCTTCTCTGATTTTCACG TGAACGAGATTGATAGCAATGGAAAGGTTCTGGAACTGAACGATCTCAGT GTGCCTAAAGTGGCTATTGTGGGTCTGTATTCACCAATTATCCTGCATAC TTGCTTATGCTCATGCATCTCATACTATAACAGCTGTGGCCGAAAACGAA CTGGACAACTGGCGGAAAGAACTGGAGGCAGTAATCGGCCCGGAAGTTTG GCAGGATATAGCCAATCTGGCTAAGGCCAAAAACGATCCCGCGATCGAGC AAAAGGTGGAGATTGATGTGACCACTCTGGATAAGGAGCAGCGAACACAA GTCCACCAGATGATAAAACAGCTTTACAAGGGCAAGCTACTGTCCACAAC CATTGGACAGCAGCAGGCTAAGCCGAAGGTCCAGGAGGAGGCATCTTTGG AAAATAAGGATGCGGCTGAAGGTGAAACCTCAACCCAGAAAGACTCACAG GTGCCGGCAGAGGAGAAGAAGACTATAAAAGTATTTAAACCAAAGCCAGG ACGCGGTTAGTAGAAATGATTACCCAGGGAATTCCTTTTTTTATGCATCG AATTCCATAGGTGACAAACGCTGGAGCTTTCCGGCGGATTACGTGACCTT CCTGGTGCACAAAACCAATTTGGTTACCAGCGATGTGGCCTCTACTTTAG CAGCGCGACTGAAGTAAGTTTGATCAAATTTTAAATGCTTTAATATACTA AGAAAACATTATTTTTCTACAGCTTACGACCATCGCAGGTGAACTACAGC GGCATCAAGGACAAGCGGGCCAAAACCACCCAGAAGTTCTCCGTCAAGCG TCGTACACCAGAGAGCATTTTGGTTGCAGCTCGCTCCCAACGGAATGTTC ATATCGGCAACTTTGGATTCGAATCCAATACACTGAAGCTAGGCGATTTG CAGGGCAATCGTTTTCGTATTGCCTTGCGACACATTGCCAAGGAGAAGCG AGAAGAAATCGAGCAGGCACTGCAATCATTGAAGGAACGCGGCTTCATCA ACTACTATGGCTTGCAGCGGTTCGGCAACAGCGCCAGTGTCCCAACCTAT GAGGTGGGTGTTGCTCTGCTCAAGCACGATTACAAACTGGCCTGCGAACT GATCCTGAAACCCCGGGACTCGGATGTGGAGTTTTTGCGTCCCATACGCG AGGAGTGGTGGAAAAATCGCGACTCCGCGGCGGCAGCTGCACAGATCTAC GGCGAAAAGTTCATCGAAAAGAAGCTGCTGGACGGCTTGGCCAGATTTGG TGAATCAGATTACTCATCAGCTCTGCGGCAGATACCACGCAACATGCTCA TGCTATATCCACATGCTTACCAAAGCCTGATCTTCAACAGGATAGCGTCT AGACGAATTAAGGAGTTCGGCTTGAAATTGATACCCGGGGATTTGGTTTA TGTGGAGCAGGATCAGTCGGAAGCCTCGGAAGAGCAGGCGCAGCAGGGCG AGGCCTTGGAAGAGCAAAAAGAAGAGGAGCCTAACGATGAACCTCTGGAA GTCCCCGAAGGGGATGAAGCCATCGAAGAGGAGTCGATTTTCAAGCGAAA GGTTCGCCCGCTCACAGCAGAAGACATCGCTAGCGGCAAGTACAAACTTT GCGATGTGGTCCTTCCCCTGCCTGGACACGACATCACCTATCCCAGCAAC GAGTGCGGCGCGTGGTACGAGGAAATGCTCGCCGAAGTGGGTCTTTCCTC GGATCAACTGAAGCACAAGGAGAAGACATACGCATTGGCTGGCGCCTACC GCAAGATGATCATATCGTCCAGTGATCTCAAGTGGAGCTTTAGAATGTAC AATACGCCGGAGGATACACTTATCGCCTCCGACTGGGAGCTATTGAAGAA CATTCCGGTTGCACCAGAACCAGCTGAAGCTGAGGCCAATTACATGGCAC TCCTGCTGGAGTTCTCGCTGCCCACGGCTGCCTATGCCACCATGTTTTTG CGAGAACTCTTAAAGCAGGACACATCGTCAGCATCGCAAACGCAGTTGGA GAAACAGGCAATGGCTAAGGAGGACAATGAAAAGAAGGCGGTAGGAACCC AGGAGGAACAAATGGAGGTGGTAAAGGAGGTGGCCGACGAGGATGGGCAG GAAACTGAGCAGGCGGAAACTCAGGGGGCCGAGGAGGCGGTGTAGGCCAA GTGAGATACCGAAAATCAATATGCTCAGGAAATCAATTTTACGCGCGCTT CGTATCCAACTTCGAACCAACCACAACAATAACAATGCGCACGTGAGGAC GAGGGCTGCTCCCTCTCTCTCTCTCTCTCACTGTCGCATCCCGTGGCTCG CACCCCGTCAATCTCAATCGCTCTCTCTCTCTCTCTCTCTCTCGCCTGGG AGAGTCCTTTTGGTCCTGTTTCTTTGACTGCGATTTTATTCGTTCGGTGG CCACCAACGCGAAAGCTCAAGCGACGCGCTGCGCAGTTTCCCCAGCTCAA AAGTCCAAGTCGCACGGTTTTCCCCAGCGTTCTCAATGAAGAGCAATAAC AAATTATTAATTGACAACAAATAACGAACAAGCACGGTCCCCCAAAAATC CACGGACTCCATCCAATTCATCCAGTGATTTAAAGAGATTTTAAACCAAA TAAAAAAACCAAGAGGCGAGACAAGGTGAATTTCCAGTTAAATGTAGCAT TTAAACGTTTTGGGCGCGTACTTTGAAAATCCATTTATTAAGGCGTAAGT ATACATTCGAGTCTACAAATTGTTTATAACTTTTACGACAACACTGAACT AAACAATCACAGAACTGTACAATATTTGATTTTGGCTCTGGCAGCCTATT GATTTTTGTTGTGTGCTTGTGCTGGAAATCAATCGATAATACGGTGTTAA TACCAAGAGCTGAGTCCGGGGATTGGGAATGGGAATGGTCTAGTGGGTAG GTGGCTGGCCGTAGGAGTAGTTGGTTCATATAGTGGCTTAGTGCGTCGGA GGGTTCACCATGTACGTGTGAAGTAAGGGGGACTCAGTCGGTACGAGGGG GTAGTGGTAGTGTGGCATCAGTCGTTAAGGGTGCACGACGCTCCTCGCTC GTTATGTTTTTGTTTCGGCCCACTGCTCCCCCTGCGGCAGTCGTCAAATT AATAAACTAAATGCTTGTTTTGGCGTCGTCGTCGCCCTGTCCCCGTGCTG GAGGCCTTCCCCCGATCCGATCCAGACATGGATATTGGACATGTTATTGC TTGCGCGCGCATTCTTTGACTCTTTGACCAGTTCCCAGCAGCAGCTGCGT CATAGTAGGAGTTTTTTGGCGTGGCTCAATTCGATTTTCCCTCGCCTACT CCACCTGCTCCCCGCCCGCCTGTTCAAAGTTGGCTTTTGCCACACAGATA GCTTCCTACTGCATTACTATACACTCCCGCAAGTCTCTGGCTCTATAAAT GACCTCTGGCGACAATTGATGCTTTGTTTGGGGTTTACCAGTTGTCTTGA ATTTTAAATTGCTAATCTTAAGCCTCAAATAAAATAAACTATTTAATCAC AGGCGTGTTAATGTTTTATCATATCATACAATGCAATAGTTAGTTTGTAT AGTAAACTTCATTAGATGCGAAGATTAGGTTAAATGAATGGATTAACAAT ATTTTTTAGGGAAGCATACATTTGGAAAAAGAAGTTATTTAGTATTCGCT TAAGATAATTGTCCAGATATATAAACTATAACAAAAATGACTTAATTATT AAACAATTATATGATCAGTGATGTTTGCTACTTTTGATATCCTATCACGG CATGTATGTATTTAACTTATCATCATGGCAATCTTCCTTTATAACTATAT CATCTTGGCAATCTTCCTAAATAACTATATCATCGATTTGCTCGTCGTTC AGGGCGCGCAGATTGCATTTGCATAGGTAGGCCAGAATGCGTTTCTCCGC CTTAATTCGGTTTGCTTCGCCCAGTCCTTCAAGCAGGGCTTCTATCCTCT TTTCTGCTTGAGCCACTGGCGTTGCATGGGCAGGATTTGTGGGTGGTGCT GGTGCAGCTCCCGCAACGGCCAGCTGCTCATCCATGGCCTCCTGGAGCGG ATCCTCATCATCGTTGACCTCGTCGCTGGATTTCAGTGTGCTCCTACTCA GATCACCCGAATTTCGGTGATTAATCGGATGGTGGTGATGCTGCAGGAAT TTCAAATGCGGCAGAAGACTCCAATCGGAGCCAGTGCCTCCGGCCTTTTC TTTGGCCAGCTCCCGACGCTGTTTGGCCACCAGATGATTCCAACGACTGA CACAGGCACTAGCTAAGTTAAAATATAATGAGGAATTAGGGAATATTTAT ACAATTTATCAGTTTCTTACCTTCTGAATTTAATGAAGTGGCGATGCTGC TCCAGATTTCCGGATGTCGCTTCTTATGCGCTTCGTAGGGTGCGTTTCTA AGTTCGCGCTCATAAAGCTTGGGATTAGCCCTAACCAGCTCAATAAGTCG CGTGTCGAACTGCGACATTTTGATATTTTCAAAATAAACACAAATGAAAA TATGTAAACAAATGGAAGCTAGCGAATAAGTATGACCGTTGCTTCGTGTG AGAAATATGCTGTCACAAGAGCATGGTGGCTAAACCCTCTATTCACCACT CCTTGGGTGGTGTGGTGGGATCGGGAGATTCAAAATAAACACCCCACTGG CGGCATTTATTGATTTATTTATTGATTTTATCGTTGTACAGGAGCTGCCG GCCGCAGAGATGGCCGCCGAAAACTATCACCTTAAGTGGGACTCACACCT CACCTATCTTAACTCTTCCATAGCCACACTTTATAAGTAAGTACCACTGT ACCATAGTTGGTACATATTTGAAGTTTTTTGTTTTTTGTAATTGTGATCT AGCAGCGTTTTTAATTGTTTAATGTTAAAAACATTAAATGTATCAGGGTC AGAGGATTAAACACACATTTTCTAAGAACCCTTCTTCAATATTCTCCAAG AGTACTACAAAATACGTAGATATGCTATATTAACGCATCATATTTCCCCT TTAGGAACGAAAAGTTCGCCGATGTGGTTCTGTACAGCTCCTACAACAGC AGCGGCATCCCCTCGGATATACCCACAGTGGGCATCTCGGCCCACAAGTT CATCCTGAGTGCTTCGTCCCAGTTCTTCGCCACCATGTTCGAAACGGCAC CGATCACCAATCCCAATGGAGTGCTGTATGTGGTCCTGCCGCCGGATCTT AGCCATCGCGCCATCCAGATCCTGGTTCAGTACATGTACAGCGGCGAGGC CACAGTTTCCAACGACATACTTAACGAGGTCCTGCGCGGCGGTGAGATCC TCAAGATCCGTGGCCTCTGCCGCACCAGCTCTTCCAATGGCGGTGGATCC GGCTCAGTGGTCACGACCACACATCATCCCCATTCACTGGCCGGGCATCT GCATCCGCGAGAGGCTAGCACCATGTACATGTCGAATGGCACTCGAACCG CTTTGCCGCCCCCTCCGCCGCCGCCACAATCAACCATGTCGGCGCAACTT CAGGGAGATCTATATGCCAGCAAGCCGGGTGGATCGACACGTTTCGCTTT GGATCACCACCACCTGTCGTCACACCACAGCCACCTGAATCACCATAATC CCCAGCAGCAGTTTCGTGGACTTGGTGCCTCCGTGATGCCCAAGGACTCG CCTGTGATCATTAAGTCACCCAAATTGGCCGCCCACACAGGACTACTAAC CGTCGCGAGCAGCAGCAAGTTGGGCATTTCCGTCAACAAGGAGGTGGCCA TCGATCCGGAGGACAAATGCTGTTTCGCGGCACCCGGTCAGTTGGAGTCG CAGTCTCACCCACCACCACCAACCACCACAACGACAACAGTAGGAGGAGG AGGAGGATCAGTTGGAGGTTCAGGTGCCCCGCCATCGCAGCCCATTTCCA TTTGCACGGAGGTGGGCTGCAGCAGTTGTCCCCTGACCGCCGGACCAGGT GCTGACCAAGCGGAGACCACGCTGCGGCGGACAGAGTACGAGGAGCAGGC ACTTCGTGAGCGGAACGAGGTGGGCCTGGTCTTCGAGCGACGTCTGAGGA GGGAGAGCGCATGCGAAAGATGTGAGTAAGAGTACTCAGCACAGCTGCTA ATGATGACTAATCCCATGTTTTATTCCCCTCAGCTCGGGACTACTATGAA GCACCACACTTTGAGCACGTGGTATCCTCTCGCCTGGCAGCCACACCTCC GCCACCACCACAGCAGGCACCACCATCACATCCGCCGACCCTTCGACATC CGCACAACTTCCTCACCATCAAACAGGAGCCGACCGACTGGAGCAACAAC CCACCAAACGCCTCCAGTGCGTCCAACAACAACAATCTGGAGGAGTTGCC ATTGGCTTCGCCCAAGCAGCCACTCGACTTCAAGATGTCCGCCGTGAAGC TGGAGGTGAATAGGGATCGCGGAACACCCTCCGAGGAGAGCGAGGAGCAC ACGCTGCGCGACTATAACAACTTCAAGCAGCTGCTGGTCTGCGAGATCTG TCAGAAGTCCTTCGAGGACACCAAAATGCTGGTCCGTCACCTGGGCACAC ATGCCGGCGATCCCACGGGCGGCACGGAGAGGAATCTCCTGCCATCCAGT GCCAGCGGGAGCACCACATCCGCCTCCAGCAACCTCGCCCTGCGATCTGT TAAAACCTATGTGCCAAAGAAACGACGTCGCGTTTCGGTGAGTACTTGGA CAGCAACTCATCCCTTTAATAAATCCAAATCTACTGAAGTATGATTTTAA CTCGTAGTGATGATCGGTTACCAATATCTATTGGATGTATTAAAACCAGA TTATATATTGTGTTTTTCAGCAACAGGAGAACAATATGGATCACGATCAC GTAACTCTGCTCTGCGATTTGTGTTCCACGTAAGTGTTTGGAGTTATAGA AGCAAAATATATACTAACTCCCTTTCCCATGTGCAGATCCTTTGATACGC CGGCGGAGTGGGTGCGCCACATGAACAGCCAGCACACGGAGATCGAGTTG GCCATGTTCAACAGCAAGAAGGATGGCGAGCAGAAGGGGTGTGTGTCCTA AGGGCTAGCAAAAGCACACTGATGAACTCTGTTCACTTGCAGCCAGCAGC CACCGCCACCGCCGGCGACCAGCAGCTCTTCCACAGTGTCCAACAGCCAA ATGCAGCCAAAGTATCCCAGCTCCACCGCCACCAGATCGACGCACTCCCT CATGCTGCACAAGATGAGCAACAGCGATGCAGTGGCCACAACCACATCTC CTGGAGCATCCACCTCACCGAATGGCTAAGGCCAGCCATAGGGATCAACT TCAAAGAACCATTGGACCATTGGCGAATGAAGCTGAAGGATTCGAAACCG GATGCCCATGGATAAATTTGAAAACAGCCATATTCTTCATTCATTTTCAA AAATCTCAAGTCGTTCCAATAATCAAAAGTGAGATGGATGTTTATATGCA ACAGCAAGAACCGTGATCAAAATGCAACCAGTTTGCATATTTTATAGAGC AACAAACAAAATACAAATTGCGAACAAAAAAAAATTAACGAAACTATAAA CGAAACTTAGAATGGAAATCGTCAGGCAACGATGCAAAACAAGACAAAGC AAGAAATTCAGAAACGAAAGCAAAGCAACATTTAACTCCAGTGTGTAGAA TTTTTTTAAGTGTACGTATTTACTTAGTTTTAGCTATTTATCCCATGTAT TTACCGTAACAACAACGCGCAATTGATTCGGGAAAAAAAACGATACAGTT TAATCATTAAATTTTAATGTTTACCATTTGCGGACATTTTTAAAATGAAT TAAAAACTAAAAATTAATCATCCACTTGAGTTTTCAAAAGGATGCATCAA AAGAAATCCCATTTGTAGGACCAAAAGCAGCGAAAGGATCTTTTTACATT TTGATAAACAATTAATTCCAGCAGCAAGTGTAGTTGTCATTATTTATTAC TTTCCAATTTGGTTTTTCGAATGCAATTACTGATAACAACTATTTATCGC GACTCAATGATGTCAGCAACTCTGTTGTATATGTATTAATACTTTTTTGT ATTTTTTGTAAGGCATGAACGGAAATTTCGAGAACTTTTTTGTACATAGA TTAAGTTTGATTTCGAAAGTCCGCCGATCGAAACTTTTTACGAAAAGTTC ATAAACTTAAAACTCTAAATGTACGTAGTAGTTCCGAGGTTCAATTAAAA ACAAAAATAAAGCTCCCCCCAAACCATGTAAAAACAAAATATATCTATAT TTACAAACAGGCGTGATTATTAACAAACTAAGTAGATGTACTATGTATAA TGCGGAGGAAATGATTGTCTCTTCCCACAAAACAAATCGCAAATGTAGTA AAGCGTTTTAAATCGAAATAAACGTCTGCGATGAGAAATCGTTTTTAAAA GCTAACGAAAACTAAGAGTCACGTCGCAAAAAGCTCGATTATTCTTATTC GCGTTAAAACACAAACAAAAAACTTTATATAAACAGAGCGCCGTCGAAGA GAAAACTCAGTTCGCATTTCACCGTCGACATTTCAACAGTTAAGCGAATT TGTTCAGTTCTGCAATTAAACAAAATGAGTTCTGGTAAACATTTGGCCAA AGGTAAGAGAGCAAGCAAAACCAGTTGTCGCCGCCGCCAAGAGAAACGCC CATGTCATTAGAGTGTTTATAGTATTATTTATAAAACAAGTTCTCCAACA TTCAGCGTAATTATCGAATAACGATTTTTATATTTCATAATGTTAAAGAA TATTGGCATGAATAACTGGGATTTTTTGGTTAAAAAGTTAGAAAGGTATA TTATTTGGTAAATTTCAATACGATCTTTATTCTTTTACAATTGTAGGTAA TGCATTAAATTAATTATTTGATTTGTAAAATTTACTTACATTTTTAGCTA TAGCTTTCACCCCGATATCAGATAACCCATAATATTTACACTCTAAAAGA TAACGTAGCTACAAAATTTGAGCTTTATCACGACTGGGCCCTATCAACAT TAACTTAAGTGCAATGACTTGCTAAACAAATAATAATACAGGGGTGGATT TTAGGGTTCCACAAGTGACTCATGAAGTTATTGATTTATTTGTATAACCT AAATTTAACTGGTAAATAAATTCTATCTTTAGGTTCCCCCAAGCCTGTAC TCCCTGACGATGGAGTCCTTCGCCTGTACTCCATGAGGTTCTGTCCCTAC GCTCAGCGGGCTCATCTCGTCCTGAACGCCAAGAATGTGCCCTATCACAG TGTCTACATCAATCTCACCGAGAAACCAGAGTGGCTGGTGGAAGTGAGTC CGTTGCTTAAGGTGCCTGCCCTGCAGCTGGTGGCGGAGAAGGGTGAGCCC TCGCTCATCGAGTCGCTGATTATTGCCGAGTATCTGGACGATAAGTACCC GGAGAATCCGTTGCTGCCCAAGGACCCATTGAAGCGGGCACAGGACAAGA TTCTGCTGGAACGTTTCAGCAGCATCACCAGTGCCTTCATAAACATCCTT GTGCAGGGCACCGGTCTGGAGGATTACTGGACGGCACTTGATATCTTTGA GGAGGAGTTGACCAAGCGGGGCACCCCATATTTTGGCGGCAACAAGCCGG GATTCGTGGACTACATGATCTGGCCCTGGTTCGAACGCCTCTCTGTAATC GAGTTGAAGTTGCAGAAGGAGTACAACTTCAACGAGAGTCGTTTCCCGAA GATCACCAAGTGGATTGCCCTCCTGAAGGCGGACTCGGTGGTGCAGTCCT TCTATGCCACTCCCGAGCAGCACAACGAGTTCTGGCGCACCCGCAAGGCC GGCAATGCAAACTACGATCTGCTGGCTTAGATCGGTACTGAAAATGAAAC TATTATATAACAAAGGAGATTTAATAATGTTCTAAAAACAATAAAAACTA AAATATTTTATGTGACAAAGAAATGAATTAAGGCTAGAAAGGCAAGAATT CCGTTCCAGATTCACAGAACGTGGTTCGAAAAACTTAGTTCTTAAAAAGT TTTGTTTTAAACAAATATTTTGGAGCAATATGCAGGTTGCAAGGGGGCTT CACTGTATCCACATGGCTTGGTATGTGTGTCAGCCGCAAGCCACCAAGTT CAGCCGCGTAAGCGAAGCCAACCGGCGAAGGGCAGTGAGCTGCACTTTAT AAATCACTCGAATGACAATCGCTATCACCACTTGCATCTCTGGACCCGAG CACGCACATCATGAGTAACGGCAGGCATTTGGCAAAAGGTGGGTAGAGCC AGGAAACCAGGATAATCATAATTGATAATAAATGCGCCCACTAGGCTCAC CCATGCCGGATGTTCCCGAAGATGGTATCCTTCGCCTGTACTCGATGCGC TTCTGCCCATTTGCCCAACGGGTGCATCTGGTCCTGGACGCCAAGCAGAT CCCGTATCACAGCATCTACATTAATCTCACAGACAAGCCGGAGTGGCTGC TGGAGAAGAATCCACAGGGCAAGGTGCCGGCTCTAGAAATCGTGCGAGAA CCTGGACCACCTGTGCTCACAGAGTCGCTACTGATTTGTGAATATCTGGA CGAGCAGTATCCATTGCGACCACTCTATCCACGTGATCCGCTGAAGAAAG TGCAGGACAAGTTACTAATCGAGCGATTTAGAGCGGTGTTAGGTGCCTTC TTCAAGGCATCCGATGGCGGTGATCTGGAGCCCTTCTGGAGCGGCCTGGA CATCTACGAAAGGGAGCTGGCTCGACGTGGTACGGAATTCTTTGGTGGCG AGCAGACGGGCATTCTGGACTATATGATTTGGCCCTGGTGTGAGCGCCTC GAGCTCCTTAAGTTGCAGCGTGGAGAGGATTATAACTACGATCAGAGTCG CTTCCCCCAGCTGGTGAGCAGGTCCGTGTATCCCAGGAGTGATGAAGTAC ATTAGTATACCATTTTTCAGACCCTTTGGCTGGAACGCATGAAACGAGAT CCGGCTGTGATGGCCTTCTACATGGAGGCCGAGGTTCAGGCGGAGTTCCT GCGTACACGGAGCCTGGGTCGACCCAATTACAATCTGCTGGTCAAGGATG CCTGATGCACTTGGTTTATTGAATTTTTCGCATGGAATGAATAAAACATA AATGCAGTCCATAACCGGTTCCAAAGATTTGATCTTGTCTAAACCAGTTG TCGTTCTATGGTGTACCCTTGAAGGCAATGTCGTACTGGGGATTTCCAAG GGTCTTCGATTTCTGGAACTCAGCATGCAACTGGACATCCAAAGCTGTCT TCTGCACAACCTCATCCTGGGTCATCAAATCGCGCCACTTGAGCTGTAAT GGATTTTTGATGAGATACATGCATCATCTTATGTTGGATTACTTAAACAT ACCAGCTTCTCAAATCGTTTTGTATCCAGCTCATACTTTTGCTCCGTATT GATCTTCATGCTGGGAAAACGTTCGAACCAAGGCCAAATCATGTAGTCCA CGATTCCAATGTGCTGGCCGGCAAAGTAGGGCGTTCCTCTTTTGCCCAAC TCCACTTCAAAAACATCCAAGGCATTCTCGAAGTTCGGTATGGCATCTTT CGGAGCGTTGGGATTACAAGTCAGCACAGGATAAATGGCACTGACCACTG GAGCAAAACGTTCGATTAGAATCTTGTCCAGCGCCTTCTGAAGCGGATCC GTGGGAAAGAGTCGCGTCTGGGGATATTGCTGGTCCAAGTACTCTGCTAT GATGAGCGACTCCACGAGGGTCGGTTGGTCCTTCACCCCAGTAAGCTGCA GGGCTGGCACTTTGCCCAGAGGACTGAAATCCTTGTACCATTCAGGCTTC TCAATCAAATCGACGTAGATCTTATGATGTTCAATATGTTTGGCGGCCAG CATCAGACGAACTCGGTGGCTGAAGGGGCAGAATGCCATGGAAAAGAAAC GAGGAACTCCATCTTCTGGCAGCTCGGGCTTGGTGGAACCTGTAAGATCA ATGTAAGCTTGATTAATTGGCAGGAATAAAAGCACTGACCCAAATCCCAG TTGAAAAGGTAGAAATAACATTTGATGGTCTACTTTATATATGGGTTTAA TATTTTTTTAAAAGCGGTTTCACAATGTTAGTTTAAGTATGTTGCTTCCT GTCATCCATTAATACATCCTTTACAAGGGCTGGAAGGCTACATCGTAGTC CGGTTTGTTCTCATGGCGGGTCTTCATGAACTTCGCATGGATTCGGGCAT CCAAAGCGGTGGCCTTGACAGCCTCATCCTGAGCCACCAGATCCCTCCAC TTCAACAAATTCTGATAGCGTGTCTTGTCCAACTCGTAGGGTTCATCCAG AGTGTACTTGAGGGCCGGGAATCGCTCGAACCAGGGCCAAATCATGTAGT CAGCAATGCCGATCTTGTTGCCTCCAAAGTATGGTGTTCCGCGCTTGGTG ATCTCCTGCTCGAAGACATCCAGAGCGGTCTCAAAGTTCTTGATGGCATC AGCGGGTGGATTCTTGGTGAACAGCACGGGGTAAATGGCGCTGACAGCGG GCGACAGGCGTTCGATGAGAATCCTGTCTAGCGCCTTTTGCAATGGATCC TTGGGGAAAAGGGAGCCCTCGCCCGGATACTGTTCATCCAAGTACTCGGC AATGACCAGGGACTCCACCAAAGCCGGTTGTCCAGGCAGATTTGGCAACT GGATAGCCGGCACCTTGCCCAATGGACTGTAGTCGATGTACCACTCTGGT TTCTCGCTAAGATCAATGTAAACCGTGTGATGTGGAATCTTTTTGGCGGC CAAAACCAAACCGGCACGCTGCGAGTACGGGCAGAATCTCATCGAATAGT AACGCAGGACTCCATCCTCGGGGATCTCCGGTTTGGGCGAACCTGTTGAA GGGTGATTTGTGACGTCAGCAGAAAGTTTTCCATTATGCTTTGGCTAAAA TTAAAGCTCTATCTCTGCGTAATTTACGCCTCTCAAAGTGGGGTCTAGAT AAAACTATGAAATCAATTGCCAACTTTTGCAGCGTCACTATCCCGATGAC CTTGAAGTGCCCCCAACTCACCCCTCTTGAAGTGCTTTTGCGGCAGGGCC ATTTTGTTAACAATTTTAAAATAATTCCCAAGACGTGAAATGTTGGTGGC AAAGTAGTTCCGATCGACTGACAACAAATAGAGGGATTCCGGTACCTTAT AAAGTGGTCGCAGTCGCCGGACGAGTGAATTTATCGAATATATTTCGATT GTTGAGCGGGTGAATTTAAAATTCTTAAGCTCATATTTAAGAAAATTGTT TGACCACATATTAAAGACTACAAACGACTACTCTAAGATAAGTATTTTCA TATCCATTTATCATTCATACCTTCATTAATCTAATTCTAAAACAAACGTA CTTACAACCCGTATAAACAATGAAAATGCAAAGATTTATTTTTCAATCAC AATAATGCTGCCGTAGTAGGTACATGTGTTACATGTTATATGTGCAAAAG GTACAATGCTGAAGTGGAAACGCCATCATCCCGTAGACTACCCCAATTTG ACACGTTTGGCCTCATTGCTAGAAACGAGAAATGGATCAGTCACACATTA TATGTATAATCTTCAAATCTTACTATAGCATATTATAATCGGCCTGGCCC GATCGCCGGGAGTTCATGTATTTGGCATGGGTCTGTCCATCCAGATAGAA ACACTTGACAGCACGATCCTGGATCATCAAGTCGCGCCACTTAATCTGCA GTAGAACAATCTCGGTAATTTAAAAGACATAATTAGAAAACCAATAGGAC CCACCAAAGTGGGAAAACGTTCCGGACTCAATTCGAATTTTTGTTCAAAA GTGTATTTCAGAGAGTCAAAGCGCTCGCACCAGGGCCACATCATGTAGTC AAGCATGCCTGGGCTGTCGCCACCAAAGAACTTGGTACAACGTCGCTTCA GTTCCTCCTCATAAACGACCAATCCGGCATAGTGATCGGTGTCAACCAGC TGCTCGGGATTGTCGTGCAGCAACAGGTAGTAGAAGGCATTGATGAACTG TCCGAAACGTTCGATTAAAATCTTCTCCTGGGCTTTTTTAAGCAGATCCT TGGGATACAATGGCACCTCCGGATACTTTTCGTCCAAGTAGTCACAAATA ATGAGCGACTCGATCAGCACAGGATTTCCCTGTTCCTTGACCAGCTCCAG TGCCGGCACCTTTGTGGAGCTGCTCACCAGGGAGAACCACTCGGGTTTGT CGCGAAGATTGATGTAGATAGCGTGGTAGGGAATCTTTTTGGCATCCAGG ACCAGGTGCACACGGTGTGCATAGGGGCAAAAGCGCATCGAATACAGCTT TAAGATCCCATCATCCGGAAATACGGGCTTTGGCGAGCCTGCAATATATA TGCGCCTTTTAAATGTGAATTTGGAACTTAGTAACTTATACTAACCAATA GTTAAGTGCTGAGTATTGCTCATATTGGCAATACAATTTTTTCTGGAAAG GAACACAACCTGTTTTGCGGGTTATGACAATTATCGATATTTGACAGTAA ACGTTAAGGTGGCTCGATAACGTATTGTCTTTTTACAGGATTGATGTATT TTTAATCAATTATTATTTAATCGGTTTAAAAAAATCTATCTTAATCTTAA ATATTAATTTTTACAACTTTAATTTTTTTAAATATAATTCAGTCATCTAT TCATCTATTATTTAGGACTTTAATTTCAATAATTTATGGTTATATATCCA TAATAGACTATTTGCATCACTGCTCCAAATACATATTGTATATACATAAT TAATCTAAAATCAATTTATATTTATCGTTTTTAATATTTGCTGCAAGAGG TTACATTGATCGCCATCGATGTGTAGCGTTGATAGCAACGGAACACCGAT ACCTATCGCGGATGATTCGGTGTTTTTCCACATCCCTACCGCCTATCGAT AATTGTTATAACAAAATTGTTTTAGTTGCGGATTTCTTGTGTTTGGCGGT GTGAGCGAAAGAGAGATGGCTGCTGCGGCATATGTTTAGCGTGTCCGGAA AATGTTTACAGTAAGCTCGCCCTTGCGTAACTGAGCCCGTGTTGGTGTTG GTGGCCGCATCCCGTACTCCGTATCCCGTGCAAATCTCGCCGCTCCATGC GGACTCGCTTCGATTCGATTTCCCGTGCCAAACCGAGATTATTGCAACGT AATTGACACTCGGCGTAATCTCTACGGCCTCTTTCATTCACGCCCACCGC ATCGGCAAAAGCTATAGCTCCCAGAATCGTCCAGCATTATCTTCGATCCC GCAATAACTCTAGTGGGAATTGTGTGAGTGTGTGTTACAGTGTGCGATGT GCTAAACAGTCCGGCAAATTTACGGGTGAGTTAGTAGTGGGCTTGCATTA ATTATTCGCCTTTGTTTAATCTTGGCATAAGTTCGTTCAGAATGGAAAGT GCATGCGACGCGCCCCCATTCCACCTCCCACCGCCCAAAATCCACCCACC ACCACCCACTCGTATTTATTTATAGCGGGACATTTCCATGTGCGTGTGAT TTTGACACCCGCTCACTTACATCCATATGTATTTGTTGTACACACACATA CGCAGATGCACACGTAACTACACTGATATTCAGCACGTTTTTATGCTATT TTCGATCGACATCATCAATGTGTTCTATACATAATTCAGCGCAATTCTGA TACCATTTCCATGCTCGCTATCTTCAGAGCCTAATTACGCAAAATCAATG GAATTAGTGTTATCAAACGGGCCAGAATGCTTATCATCCACTGGCGGGGC TAGATAAGATTTCAAGGGGGAAGACAACGTGGATGAGTCTTCACATCGCG TATGCTTTATCTCTAGCATTCTCTCTATTTAAATCAATAGACTTATCCAA ACGATCATAGTTACAATTACAATCCACGTGTTCGACGTACACAGCTTACA TTTTGCGTAAATAAATACTCTTATCACCTTACACATAACGTCATTAGATT TTATATTTGTATTGCGCATTGAGGGATATGAAATATTTAAGTTGTATTCC GGATGCGTAACCCCCTTTGGAAGCCGTCACTGTTATCGCCACTGACCCAT ATATCAACATGTGTTCCTTTCGCACTTTTGGCTGCCTTCCACATAGTTCT GTTGTTTTTGTCTTTTTTTTTTTAGAAGTGTAGGTGGTGCATGAATCATA GATAGTGGTGCCGGTGGTGGCCAAAAGGGAAGCATCCTTATCGGGCGCGA ACTTTTCCATTTCTCCGCCAAACGCCCGCCGCCAATCAATTATTCATGAG CCAGCGTAATTTGCAAAAATTGATATGTATATTTGCAAATAAAAAAAAAT GCAATATCAGCTATGAATGCCTTGCAACCAGGCGCCAACAACTGAGGCAG CCAACCATTTCAGCAACCAACAACTCAATACGGAAAACAAACGTTTCTCG GCGATCCACGATCATTTCGATGCCCCCAGATGAATTATTTATCGCATATG GCCAGCCCTTCAACATCAGTTATGTGTCACTTGGTGGGTCGTACTAGCTG AATACTAAACCGGCCAGCCAGCCAGCGTACATAGTATGTAATTCAGCAGA CGGCGAGCATGGCAAGGTCAGAGCCTCGTTCCGTACGGATTTGATCCAAT CGGATTGGATCCGTAGCTGTCCATTCGGATTCCGAGACCGAGTCCGAATC TGAATCCGACGTGATTGACCTCAGCTTAGTCTAGTTGTGTGTACTTGGCT TCTACCCATCCAGAACTTCAGTTCCATGTGGCCATCACATGACGCGAGGT TTTTCATATCTTCCTAAACACACTGCTGAAATTTCACATCAAGCTTTGGC TTATGAAAAGGTAGAAACCAAAAAACAAAAAAAAAAAAAGATAATGCCCA AATTTGTGTGTGTATGTATGTGCTTGGATTCTTGGGTACACCTTTTCGCA GGTTATTTCGCTGAAGTTTCAGGTATGAATTTCGTGTTTGTGTTGCGGCC AAGATAAAAGATAAATTGCTCAGCAGGTAGAGAGACGATCTGGAGATGTA GATGTACGGTGGAAATTTCAGGCTAAACAAACTGTAGATTGTGCATAGTA GTTGTTCATAAATCTTGCGAGGAGTTCTACGAGTACGTTTCTAGATTTAA TTTCGCAGTTTAAGGTTGTGACATGTATAAAACGAGATATTATGCAGTGT CAGGGGCCTAAAAACGTGGAGATACCATGTATGTACATATCATGTGAAAT TTACTCATCAAGTTTTATCTATTGAACTTTGAGCGATCGCGTGTTCAATT TTAGGCTTTTTGTGCGGATGTCATGCGAAATTTGATTGTGCGATCGAAGC ATAAAATGTGGAATGGGTTCCAGGAATTTTGAGTATATGAAATTGAGATT TAATGTGAAATTTCATGATGTTGACTCATCGAAAAGTAATCAGAACGTTT TGGAATTTCACAATTTGCGAAATGAGACCCACCCTTATCCTGAAATTTCA GCATGGAGATCTTTTGCGATGCCAAACGAATTTATGTGGAGGTTCTATGT ATATGAAATTCATTTATGCTGACTCAGCTGCATAAGCTTTCCGCATCTAA AAAGGGTTACTCTGCGGAAATTTAATCCGTATGGGACAGCACTATTCGTT GGAGATATCATGCGAAATTTTGGTGTACACATGGAATTCAGAGAGCAGCG AGTTCAGTGACTTGCCGACTATACAATTACCACGAGAATTCGGAAAAAAC AGACGCGTGCGATTTTCGATATGGAGATGTTATGCGAACTAAAGTCGATT CAGCAAATCTAATCGTACGTTTTTGGTACAGTAGCCTCTCGATATGTACG ATTTTAAAGTGCAATTTTAAACAATAAAAACAAAGCAGTTTTTCCTAAAG TTTATTTATTTATTTATATTGAAAAAATAGTAAGTAAATTTAATAGAAGT ACTAATAGTACTTTCAGATTACATTTTTTTAAAATTCTCAGACCACCAGA TTGCAATGGTAAAATAATTAAATTATTGAAGGCTGGCCAAAAAATTATTT TTTTTTTAAATTAATTAGTTTGAATGGAATAAAAATAATAATACGTTGAT CTGCTAAAATATTGACGTTTTAATTAGATCTTAGTTCGAACCGCATTAAG TATTTTGGCTAAGAGCTCAAAATTAAGATGGAATCATTGAGTTCTAATTT TCGTTCTCGTCGACATTGGACATGGTACAGAATCAGCCACGCCCCGCCAA GTTAGCACGCCTTCGATGTGGGTATGCTTTAATGTGGTCCCCAGTCATAT GCACATCGATATATAATACACAAATATACATATATACAGACATACATACG TACACACTCACTCAATTAGCCAGCAATGAAACTGGCTTATAAATCGAACC GCAAGCGACGCGCGCCGCTCAGTTGCAAAGCGTTTGCAAAGCTCACTGGT GGTGAGGATCGCAGATCGGTTGGGTTTAGTGTTTCTTTCCCTTAAATCAT CTTTCAACTCGTTACGAAAAGCATTCAAGATATTTTAAAAAATATAAACA TATATGTGGTGTGGAAGAAAGTGAAATGAATTGATGGGCCCCGAATAAAA ATGCCCTATAGCATTGACGCCATCATAAAAACGAGATCGTAAAACATTTT CTCGCAGTGGTTCCATTCAAATCACGCGAACAGAATTTAAATGAGGCTTG ATTTAAAAAGAAAAAATAATAATAAAAATAACACAGCACTAAATACAAAT GAAACAGTCGGTCAATGGCGGCAGCACTTGACCAATTGACTGAGTTTGCT GGATTGATTGGGAATATTGCCGATGAATTGTGTTTGATCTGATTTGGAGA ATTTGTATGCAAATCGGAGCTTCGTTGATTGATTTTTATTGCCCTGAAAT TAAGTTTTTCGCAAATTTCCTTTGGCAGTTTGGCAGTTAATTTCCTCAAC AAGTGCCAGAGTTTCAGCTGCAGCAGCAGCAGCAGCAGCCTCAACCTTTA ACACTTAACCCCTTGCCAAGGCGACGTGTGTCCTTGTCAATGCCGCGGGT GCACGCCCACTTCCTGTGACCTTGACGCCATCATACCGCCATCATAACTT AATGCAACAACAATGACGTTTCTATTATTACCTATAGTGGTTTTGGCTTT CGCTTTTATTAAGTCGATAACCAGCGAGCCACCCATCCACCCACGTGTAT CTGTATCTGTGCCTGTGTCGTAAATTTTCGCCAAAGTTTTATCAATAAAT TGGATTTCAATGCAGGACCGTTGAACTAACTGCCATTAATGCGCAATTGT AAAATTGTCCGAGTCCCAACAAGTTGTTGTTGCAATCCCACTACAATAAC AAACTAATTTTCGGTTTGTTAGACGGGTGAAGGGGGAGGGGGGGTGGTCT TGGCTGGTTTTAGGAAAAATTCCAGTACCGCCTGGCGAATTTCCTTTTTG CCGCGTGCCACTCGCATTTTGCTCATCGAAGAAGCCGCATGGCATCCAAC AATTTGGCTCCCGACTAGGAGCAAAAAACAAGTTGGCCGATTAGCCGCAG TTAGTAAATATCAATGTGCTATCGTTATGTAACTTCTCATTCGATTTTCG TGCAGTGTAGTGTAGCGCTATTGAATCGAACATTTTGATTCTGACATTGA AAAGAGTCTATAGAAGAAGCCAGTTAAATATGAGATTGTGATTTGAAAAG CAAATGCTCTGATAAGAAGTAGGAATGTTAACGCAATGTGCATTAAATGG GGTTTCAAAGTGATAAAAAACTGAAGAAAATACAGTAGACTATTTAATTT TCGAACGGTTCGACACACTCAACTGTGGTTAGTTTCTAAAAAAAAAAATA TAAAAAAATGCATATCTAATTAAAGTGATCTATTATCCATTGCTCTACCG AAAGAACGAATGCAGCGAAATCGCCCATTTATGGCGATCTTGAAGCACCT AAAACCAGTTGTTCGTTGTCCCATATTTGGAGGTGTCGATCCACCAACGA ACGATCTTGAACTTCCGCTTTGGTTCGCTGGCTATTTTGGTTATGCAATG GGCAAATGGCCTTTGTAAATCGGTTCTGGCTTAATGAGTGTGGGATGGTA ATAAGGGGCTGACAGTGGAGCGGCAAACCCATAAATGATTCTTAATCAAA TAGAATTGTGTGTGTTGGCTTGATGTGTACTTGTTTTCGTTTTTGGCTAA TCTCCTGCTGACATTCCCATTCAATTTCAGATCGAACGAAATAAGCGAGT GAATTGACGACTGACTGATCTCGGCGGATATATAATGATTATAGCCAACA GTGCTGGGCAGTAAACCGAAACGAGAGTCAGAGTCAGTAGCATTAGTCCT AGGAGTGGAAGAGTGGAACGAAAGCAAGTCGGGCCTATAAAATGGCGCGT CACATAATGGCTGTATGCGTGGTGTGCCTACTCTGTGCACACCGTCTGCA CTGTCAGGATCACATCGAGAGTCTGCTGGGACCGGCGCGGGTCACGACCC ACAACAGCCAGGACCAGTTGAATGCCCGCGTCTACACGAACCTAAGTCCA TCCAGTGAAACCACCGATCGGCGACAGCAGCGATCCGCTTCTGGCGACGA CGACACCTTCAACTACAGCATCAGCCCGCCATCGAGAAGAGAAAAGCGCC ATGCTGGCCATGAGCATGGCCCCACATCCGAATCACGCGTCCCGCAGATC ACCCAGTACTATCTCGAGAAGCTGATGGCCCAGGATGAGCTGATGAACAG CAGCGGATTCGATGGCCTACTCCAGCAGCTCAGCCTCCACTCGTTGGCCA GTGGGGCAAGTGAGGGAACTGTGAGTATAGTGATGACTATTTCATATTTA TTGCTGATTAACTCCCGATTTTTTATTTACTTTAAAGTGCGTTCCTGGTA GTCGCCTTGTGCATCACGTCCAGCCCCACGATCATCACCATGCTCATCAT CACGAAGAAGAAGATCACAGTCTGCAGCTAAACAACTGCACGCTTATCCA GAATGGCACCACCTCCAACGTCATATGCCCATCCCTGCCCAACAACAACA CACACCCACTCGGCAAAGAGGCCAAGAACTTTACGCTGAGCGATAAGGAC TTGCTACATCTGTGTCCGATTCTCCTATATGAGCTGAAAGCCCAGAGCGG CGGATGCATAGAACCTGCTATCTTGTCCGACATTGATACCACTGAAGAAC TGCTGGAAGCAGAGAAGGACAAGGATATATTCTATGGTGCGATTTCAGAC TTAATTTTGAGGCCCATCCATTGTCCCTAACTAATCTGTTTTGTATTATT TGCAGTATGGATCTATGCTTTTATATCTGTGTTTGCCTGCGGCATTCTCG GCTTGGTAGGCGTGGCCATCATACCGTTTATGGGTTCCAGGTATTACAAG TACATCATTCAATATCTGGTAGCGCTGGCCGTTGGTACGATGACTGGCGA TGCCCTACTTCACTTGCTGCCTCATGTGAGTAAAGCTGATTATTGTGATG GGTTAGTCCGAAGCCATGACTAACATTAAACTTATAGTCTCTTGCAGGCC AGGATGAGCGGGGGATGATCATGAAAGGACTGGGTTGCCTAGGTGGCATC ATATTCTTTTACGTGATGGAGCATGCGCTGACTATGATCTCTGAGTGGCG CAAGAGCGTAGAGAAGAAGGAGACAAAGAAACCATCGCGGGCAAAGGTGA TGCGGGATCCGGACTCGTCGGTAAACAACTCCGTGGCCGGCGACAAGATC TGCAAGCAAAAGTACAGCTCCTATCCATATTGCTACGACGAGATCACCAT GAACAACAAGCAGAGTGAGTGGATGCACCTTCCCTTCGATGTAGCGGCGG GCGCTGGCGGAGATGCACCTTCAGTAGCGGAGCTACGTAACGGTGTGGGC GATCATGATGGATCCAATGACATGGCCGCCGCTGCCGAGTCCCTAATATC ACCGCTGCACACGAACTGCGTGGAAATGAATCACCATAATCACAACCACA AGCACAATAGCCACCAGCAGAATCATGAGGGCCAGGATAGCAACACAATT GTCACGGATCTTGACGGAAACGCCGTGTACGCAGTAAACAAGGCAAAGGA TAAGGACAGCCGGAACGATCATGTGACTGTGATCCTGCGGGAGCACGAGT CCTCGCATCACGGTCACAGTCATCGCCATGGACACGTCCATTCGCCGCCG GAAACGTTGAGCGCCGTGGCCTGGATGATTATCATGGGTGACGGTCTGCA CAATTTTACGGATGGCATGGCCATTGGTGCAGCCTTTGCGGAAAACATTG CCGGCGGCTTCTCCACATCGCTGGCTGTCTTCTGCCACGAATTGCCACAC GAGCTGGGTGACTTTGCCATCTTAATAAAAGCGGGCATGTCGGTAAAGTC GGCCGTCTACTACAACCTGTTGACTGGAGTCCTGAGTTTCATCGGCATGA TCTTTGGCATTGCCTTTGGACAATCGCAGGATGTGGCCCAGTGGATGTTT GCCGTGGCTGCGGGTCTGTTCATCTACATTGCCCTAGTCGATATGGTGAG TGGTCAACAGAAGGTGTACCCTTATACAATTACTTATTTATGATTTTGTT CTATTTGTCAGATGCCAGAGATCTCGGCCTCGCACAAATCACTGGGCCAG TTTCTGCTGCAGATTCTCGGCATGCTCAGCGGAGTGGGGATAATGCTATT GATTGCCCTTTACGAGGGCGATCTGATGAGCGCGTTCGGCACAGCGGGAG CCGCATCACACCAGCACGCGCACGAAGTGCATACCAATCAGGACCCGCTG GACGAGGTTCACACAAACCAAGATCCACTTGATGAATTCATGGTGTCCAA GGGCGAGGAGCTGTTCACCGGCGTGGTGCCCATCCTGGTGGAGCTGGATG GCGACGTGAACGGCCACAAGTTCAGCGTGCGCGGCGAGGGCGAGGGCGAC GCCACCAACGGCAAGCTGACCCTGAAGTTCATCTGCACCACCGGCAAGCT GCCCGTGCCCTGGCCCACCCTGGTGACCACCCTGACCTACGGCGTGCAGT GCTTCAGCCGCTACCCCGATCACATGAAGCAGCACGATTTCTTCAAGAGC GCCATGCCCGAGGGCTACGTGCAGGAGCGCACCATCAGCTTCAAGGATGA CGGCACCTACAAGACCCGCGCCGAGGTGAAGTTCGAGGGCGATACCCTGG TGAACCGCATCGAGCTGAAGGGCATCGATTTCAAGGAGGATGGCAACATC CTGGGCCACAAGCTGGAGTACAACTTCAACAGCCACAACGTGTACATCAC CGCCGATAAGCAGAAGAACGGCATCAAGGCCAACTTCAAGATCCGCCACA ATGTGGAGGATGGCTCCGTGCAGCTGGCCGATCACTACCAGCAGAACACC CCCATCGGCGACGGCCCAGTGCTGCTGCCCGATAACCACTACCTGAGCAC CCAGAGCGTGCTGTCCAAGGACCCCAACGAGAAGCGCGATCACATGGTGC TGCTGGAGTTCGTGACCGCCGCCGGCATCACCCTGGGCATGGATGAGCTG TACAAGCTCGAGGGCAAGCCCATCCCCAACCCCCTGCTGGGCCTGGATAG CACCCTGGAGGTGCTGTTCCAGGGCCCCGAGAACCTGTACTTCCAGGGCA TGGCCAGCAGCCTGCGCCAGATCCTGGATAGCCAGAAGATGGAGTGGCGC AGCAACGCCGGCGGCAGCGGATCCTCGGGAAGTTCCTATTCTCTAGAAAG TATAGGAACTTCGTCGACAGATTATAAAGACCACGATGGAGACTATAAAG ATCATGACATTGACTACAAGGATGACGACGACAAGTAATAACATAAGTGA AATTGTAACCAACCGCAGCGAATCTTGTAGCGTATTATGTGAATTGCAGC GAATCTTGTGTATTAACTGCATTTTTTCCGCCAAGCCTATAGAACCTCTT GAATTATTATTTTTTGTATAATTTCATTACATTGTTGTTTACATTATTAG TTCACAGAGTTAGACAAAACAGAACCACAGACACAGCCGGTTGGCGCTTA TCAAACGCATTTGTTATCCAGTTTATGAAACACACAACCTCACACCCACA CACAAGCGACGCAATTCATCAAACTCGTTTTATTTTCGTTCCTAATTTTG CTATTGAACTGCGTTCGAATCCATTTCACACCCAATTTAATGTAAGATGT CTTGAAATTGGCTAGGTTATAAAGTGATCTTGAATTTAGATGAAAACATT TGAAAAGCATGCCGTGATGCTGTCAAATGAGAAAAGGAAGTAACAAAAAA TGGATTGGATCTGGATCCCACAATCCTCTAATTACTGATCTTATACACGA AAGAGAACCTAAAAATTACGATATATTATATATAAATATACATATATATT GTAGGATATGTATACATACATATACTTTTTGTATTTTGTAGTCTAGAGTG CGCACGTTTACTTTATGCGAGTTTAACATTCTAAACCCAAAATAAAGGTA TGTCCACCGCTGTTATGATTTTCTACAGTACTTAACGACTTGAACGCATA TTTCCTCTTTCGGGAAATGTACACAAAACCCATTTAAGCTTAATTTATTA TCGTATTTGTAATAAATTGAAAAGATTATTATATTGCACCATCATGCATA ATTTAGATTTTCGCTACACTGTAGCGCCTTCGTTTAATTATAATTTTGTA ATAAATCAAGCTAAAACAAAGACTTTGATTTTGTTTTAATCGATTTGAGT TTTTCTTTTGATCGCGCACAGAACTAACACGAAAGTGATTGTGATTCAAA ATAAGTAACTAACATTTGTAAAATGGCGAAACTTGCGGCACGATCGCCCC TAATGACTATCCCCCACACACCGATCTGCACACAAAGCTATCACTTGTGT AAACTGAGCAACTAACAATATTTTATGAAGCCCACACTATGTGCTACCGA GGCATTAAAACCTATAATAATTCTAGCTGTAAGCTCTACGAAAACTACAA ACGGTAGGAAATCAGAAACAAAGAATAAAGATGTAAACATATATACACAC ACTGTGCTAACTGTGCTAAAGGAATTTTGGAGATATGGATGTAATACTAC TTTGGTGATATCACGCAAAAGGCAATTGAAACAACTAACGAAATAATTTT ACAATAACGTATTGATAAACATGTATCTATGTAAGCACATGCGAATGGCG CGTATTTTGCTATATTTATGTTTATTTTCTAACGGGACGTAAACACTTTA AATTTTCAAAATAAATGTTTTTCCACCTCAACATCATAAAGTGATAACAA GATCTTTTGAATTTGGTGGGCATTTGCGATATCGATATAAAATCTACCGA AATCGATAGCGATTGTATTGTCGCTGCCTGAATATTTTTTAGATCACTTG GTTCTTGTTTCTTAGAATGCATGGAAAAACTTTTATCTTATAGAATTTTA AATTGTGATCTAAGCTGAAGTTAATTGTTATAGGATGGCTGGTTTTATTT AAGTTCAACATTTATATACGAAGGATGGCCTAAATAAATGTTCTAATCAA TTTATATTATATTACCTTAATTGTTAATGGTAGACAATACATAAAATAAT ATTTGATTTTAAATTATACAATGCTTTTAGAACATCCAGTGCGATACCAC CGCCTATCGGTGCCGGCTGGTTATCGATATCATCAGTTTGCACCATCGTC GCCCACCCACCACTAGTTGTCAACATATAATTGCAAAGATGCGGCCCACA TTCCTGGCCATTTTGTGCTTCCTGGCGTGGAATCCCAGCTCCGAGGCGAC CGGCAATCTGAGTCCTGGAGCCGTGGGCGTGCACCGTCGCTTCGAGTACA AGTACTCGTTCAAGCCGCCGTATTTGGCACAGAAAGACGGCACCGTGCCG TTTTGGGAGTACGGGGGAAGTGAGTACGAGTGGAAGACGCAGCTCCACGT CAGTTGTTTTGGCCCACTCGCTGCTGGTCTGCGGCCATGGGTGCGAGCGA GATGGCGCGAGGCGGCCAAGTGTACACGCAGGCACTTTGTTTGGATGTCG TTTTGACCACGGTTTCGGGTGTTTCTATAGCCACAACTTGTTGCTCCTCA TTTCAGATGCCATCGCCAGTTCGGAAAGTGTGCGCGTGGCGCCATCGCTG CGCTCACAGAAGGGTGCCATCTGGACAAAGTCACAGACGAACTTCGACTG GTGGGACGTGGAGATCGTGTTCCGGGTGACGGGACGTGGCAGGATCGGAG CCGATGGATTGGCCTTCTGGTACACCACGGAAAAGGGTGACTACAATGGG CCTGTGTTCGGATCCTCGGACCGCTGGAATGGTCTGGCCATCATGTTCGA TTCCTTCGATAATGACAACAAGCACAACAATCCTTACATCAGTGCCGTGC TCAATGATGGCACCAAGCTGTATGACCATGCCGAAGATGGAACCACTCAG CTCCTGAGCGGTTGCCTCAGGGATTTCCGTAACAAGCCCTTCCCTACACG GGCGCGAATCGAGTACTACAACAACGTGCTTACCGTCATGATCCACAACG GAATGTCCAACAACAACGATGACTACGAGCTGTGTCTGAGAGCGGATGGC GTCAATCTGCCCAAGAACGGCTACTTTGGCATTTCCGCCGCCACGGGCGG TCTGGCCGATGACCACGATGTGTTCCATTTCCTGACCACGTCGTTGCATG CCGCTGGACAAGTTCAGGAGCAGCCCAAGGTGGAAAACCAGGAGAAGCTT ACGCAAGAGTACAAGGAATACCAAGATAAACTGGAGAAACAGAAGCAGGA GTACAAGAAGGACCATCCCGACGAGGTAATTGCCACGCAGCCAGCTGATA AAGATGTCTTATCGCTAGTTTTGATAATCAACTTTCGTATAATCCCACAG CACAAAGACGAGGAGGACTGGGAGGAGTTCTACGAGTCGGAGAACCAGCG TGAGCTGCGTCAGATCTGGCAGGGTCAGAGCCAAATTGCCGATCACCTAC GCGAACTTTCCCGCAAAGTGGATGAGATTATTGGCCGCCAGGAGACCACG CTGTCGCTGGTCTCACGTAATGCTGGACAGGCTCTGCCTCCGCCCGCCGC CGGCGGAGTGCCACAGCAACAGCTGCCCGTTGGCGCAGTCAGCAGGAGCG ATGTAGATCTTCTGCTCACTAATCAGAACATGCTGCTCAGTTCCATCCGC GAGATTCGTCAACTGGTTGGCGATATCAATGTGCGCACTGATAACATTCA AACGAATCAGAAGCATGCGCCCACAGCACAAATCCAATCCACCGGCTATG ATGTACAAACGCTCATCGCCGAGATGCGCGATGGCATGAATCAGGTCAAG CAGGGCATCACCCACGTGGGCCAAAGGTGAGGAATACGCTCAAAGTCTAT TTTAAGTTTCCTAAAGCTGTTGTCATCGAAGTTATTCTGAGCTCGAATTA ATTTTAACCTTTTCAGCCATATTTATACTAATTTTTCGTATTCCACATTA TGAAATTAGAGTTTTAACAAGTTTGATTCAGAGGAACATGTTTATGAGTT TTAGACTATTATACTTTATTGTCATCTTTTAAGTACCTCCTTGATACTCA ATATGCATTCCCTTACCTTGCAGATTGGCAGCGCCACAGGGAGCAGCGCA GGTGGCCAATTGTCCCACGGGCAATTGCGTTGGAGTCACATTGTTCCTAA GCGTAACTGTTGTGCAACTGCTGCTAGTCTTCATCTACAACGTCTTCAAG TGAGTTCATGGAATCTTTAAGCGTGGATTCGAAACTAAACAATCTAACTT ATTATTCCTTGCAGAAACCGCAGCGAAGCACAGGCGAAAAAGTTCTATTA GGCGAATTCGCGACTTATTGGGATCGTAACGAATAACAAACACACAAGCA TACACCCACAGAAATCACGAGGAAACAGATTCGCACACCTGACTAGGCAG CAACTAAATTTAGTTAAAATGAAAGATTTAAGACTTCAGCGTAGCATGCT CTACCATTATGTGTAACTGTTTGTTTTTTAAATAGAAGTCTGTTTAAGAA GTCAGGTCACGAATACAAACTCAAGTCGTTACTTAATCAAAGCAAGAACA AGAAATTTGATCAATGATGTATGCCTCATGACAATGCCACGCAATACAAA ACGAAGAAACCGTCGAAGAAGCCACAAGACAAACTTCCCTTAGTAATAGC CAACAGAAGATGTTTCATATTTGTTTTAGCAAGTCAAGTCGAAAGTTTCA CTCCATTCTCAACTCTGCATATCATGTGTGCAGGCATTTATAAGAAGCAC AAGAAAATCTATCT