##gff-version 3 ##date Wed Jul 24 05:56:15 CEST 2024 ## exported from the transgeneomics system molecule_59005469 mpicbg region 1 9630 . + . Name=pFlyFos;type=vector;start=1;end=9630;strand=+ molecule_59005469 mpicbg region 9631 29421 . + . Name=dmel-5.43-3L;type=genome;start=11165181;end=11184971;strand=- molecule_59005469 mpicbg region 29422 29494 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=3847;end=3919;strand=- molecule_59005469 mpicbg region 29495 30483 . + . Name=p2XTY1-SGFP-V5-preTEV-BLRP-3XFLAG;type=tag;start=1482;end=2470;strand=- molecule_59005469 mpicbg region 30484 46980 . + . Name=dmel-5.43-3L;type=genome;start=11148684;end=11165180;strand=- molecule_59005469 epicentre cds 1 107 0.0 - 0 Name=LacZ molecule_59005469 epicentre primer_bind 4 21 0.0 - 0 Name=CC2_rev molecule_59005469 epicentre misc_recomb 310 593 0.0 + 0 Name=attB molecule_59005469 epicentre cds 727 1386 0.0 - 0 Name=Cat molecule_59005469 epicentre cds 1605 1952 0.0 + 0 Name=redF molecule_59005469 epicentre rep_origin 2336 2953 0.0 + 0 Name=oriV molecule_59005469 epicentre rep_origin 2953 3007 0.0 + 0 Name=ori2 molecule_59005469 epicentre cds 3347 4102 0.0 + 0 Name=repE molecule_59005469 epicentre cds 4681 5856 0.0 + 0 Name=parA molecule_59005469 epicentre cds 5856 6827 0.0 + 0 Name=parB molecule_59005469 epicentre repeat_region 6900 7417 0.0 + 0 Name=parC molecule_59005469 epicentre misc_binding 7633 8031 0.0 + 0 Name=cos molecule_59005469 epicentre misc_recomb 8049 8082 0.0 + 0 Name=loxP molecule_59005469 epicentre promoter 8182 8416 0.0 + 0 Name=3xP3 molecule_59005469 epicentre gene 8417 9132 0.0 + 0 Name=DsRed molecule_59005469 epicentre cds 8452 9132 0.0 + 0 Name=DsRed molecule_59005469 epicentre terminator 9284 9334 0.0 + 0 Name=SV40 molecule_59005469 epicentre cds 9408 9630 0.0 - 0 Name=LacZ molecule_59005469 epicentre primer_bind 9559 9576 0.0 + 0 Name=T7 molecule_59005469 epicentre primer_bind 9610 9627 0.0 + 0 Name=CC2_fwd molecule_59005469 coding_transcript gene 24610 27988 . - . Name=CG14142;identifier=FBgn0036143;ensembl=FBgn0036143;id=50989323 molecule_59005469 coding_transcript gene 29091 32766 . - . ensembl=FBgn0036142;Name=CG7616;alias=FBgn 36142;id=51042317;identifier=FBgn0036142 molecule_59005469 coding_transcript mrna 29091 32766 . - . parent=51042317;Name=FBtr0076161;id=51042323 molecule_59005469 coding_transcript exon 29091 30789 . - . parent=51042323 molecule_59005469 coding_transcript three_prime_utr 29091 29418 . - . parent=51042323 molecule_59005469 coding_transcript cds 29419 30789 . - . parent=51042323 molecule_59005469 CLC misc_recomb 29495 29528 . - . Name=FRT molecule_59005469 CLC cds 29536 29607 . - . Name=BLRP molecule_59005469 CLC cds 29608 29628 . - . Name=TEV molecule_59005469 CLC cds 29629 29652 . - . Name=Precision cut site molecule_59005469 CLC cds 29653 29694 . - . Name=V5 molecule_59005469 CLC cds 29701 30417 . - . Name=SGFP molecule_59005469 CLC cds 30424 30483 . - . Name=2xTY1 molecule_59005469 coding_transcript intron 30790 30855 . - . parent=51042323 molecule_59005469 coding_transcript exon 30856 31202 . - . parent=51042323 molecule_59005469 coding_transcript cds 30856 31202 . - . parent=51042323 molecule_59005469 coding_transcript intron 31203 31268 . - . parent=51042323 molecule_59005469 coding_transcript exon 31269 31434 . - . parent=51042323 molecule_59005469 coding_transcript cds 31269 31434 . - . parent=51042323 molecule_59005469 coding_transcript intron 31435 31517 . - . parent=51042323 molecule_59005469 coding_transcript exon 31518 32354 . - . parent=51042323 molecule_59005469 coding_transcript cds 31518 32354 . - . parent=51042323 molecule_59005469 coding_transcript intron 32355 32414 . - . parent=51042323 molecule_59005469 coding_transcript exon 32415 32766 . - . parent=51042323 molecule_59005469 coding_transcript cds 32415 32429 . - . parent=51042323 molecule_59005469 coding_transcript five_prime_utr 32430 32766 . - . parent=51042323 molecule_59005469 coding_transcript gene 32923 35944 . + . alias=srt;alias=evi;alias=Evi;alias=wntless;identifier=FBgn0036141;Name=wls;alias=wntless;ensembl=FBgn0036141;alias=Evenness interrupted;alias=Srt;alias=Sprinter;alias=CG6210;alias=Evenness Interrupted;alias=evenness interrupted;alias=Wntless;alias=Evi/Wls;alias=Wls/Evi;alias=wls;id=50877215;alias=wls/evi;alias=sprinter;alias=Wls molecule_59005469 coding_transcript gene 35944 37589 . - . id=50630025;identifier=FBgn0052076;alias=CG32076;ensembl=FBgn0052076;alias=CG7624;alias=alg10;Name=Alg10;alias=Alpha 3 glucosyltransferase ##FASTA >molecule_59005469 GTGTTCCTAGGCTGTTTCCTGGTGGGATCCTCTAGAGTCGACCTGCAGGC ATGCAAGCTTGAGTATTCTATAGTCTCACCTAAATAGCTTGGCGTAATCA TGGTCATAGCTGTTTCCTGTGTGAAATTGTTATCCGCTCACAATTCCACA CAACATACGAGCCGGAAGCATAAAGTGTAAAGCCTGGGGTGCCTAATGAG TGAGCTAACTCACATTAATTGCGTTGCGCTCACTGCCCGCTTTCCAGTCG GGAAACCTGTCGTGCCAGCTGCATTAATGAATCGGCCAACGCGAACCCCT TGCGCTAGCGTCGACGATGTAGGTCACGGTCTCGAAGCCGCGGTGCGGGT GCCAGGGCGTGCCCTTGGGCTCCCCGGGCGCGTACTCCACCTCACCCATC TGGTCCATCATGATGAACGGGTCGAGGTGGCGGTAGTTGATCCCGGCGAA CGCGCGGCGCACCGGGAAGCCCTCGCCCTCGAAACCGCTGGGCGCGGTGG TCACGGTGAGCACGGGACGTGCGACGGCGTCGGCGGGTGCGGATACGCGG GGCAGCGTCAGCGGGTTCTCGACGGTCACGGCGGGCATGTCGAGGCCGCC CGGGCCGTCGACCAATTCTCATGTTTGACAGCTTATCATCGAATTTCTGC CATTCATCCGCTTATTATCACTTATTCAGGCGTAGCAACCAGGCGTTTAA GGGCACCAATAACTGCCTTAAAAAAATTACGCCCCGCCCTGCCACTCATC GCAGTACTGTTGTAATTCATTAAGCATTCTGCCGACATGGAAGCCATCAC AAACGGCATGATGAACCTGAATCGCCAGCGGCATCAGCACCTTGTCGCCT TGCGTATAATATTTGCCCATGGTGAAAACGGGGGCGAAGAAGTTGTCCAT ATTGGCCACGTTTAAATCAAAACTGGTGAAACTCACCCAGGGATTGGCTG AGACGAAAAACATATTCTCAATAAACCCTTTAGGGAAATAGGCCAGGTTT TCACCGTAACACGCCACATCTTGCGAATATATGTGTAGAAACTGCCGGAA ATCGTCGTGGTATTCACTCCAGAGCGATGAAAACGTTTCAGTTTGCTCAT GGAAAACGGTGTAACAAGGGTGAACACTATCCCATATCACCAGCTCACCG TCTTTCATTGCCATACGAAATTCCGGATGAGCATTCATCAGGCGGGCAAG AATGTGAATAAAGGCCGGATAAAACTTGTGCTTATTTTTCTTTACGGTCT TTAAAAAGGCCGTAATATCCAGCTGAACGGTCTGGTTATAGGTACATTGA GCAACTGACTGAAATGCCTCAAAATGTTCTTTACGATGCCATTGGGATAT ATCAACGGTGGTATATCCAGTGATTTTTTTCTCCATTTTAGCTTCCTTAG CTCCTGAAAATCTCGATAACTCAAAAAATACGCCCGGTAGTGATCTTATT TCATTATGGTGAAAGTTGGAACCTCTTACGTGCCGATCAACGTCTCATTT TCGCCAAAAGTTGGCCCAGGGCTTCCCGGTATCAACAGGGACACCAGGAT TTATTTATTCTGCGAAGTGATCTTCCGTCACAGGTATTTATTCGCGATAA GCTCATGGAGCGGCGTAACCGTCGCACAGGAAGGACAGAGAAAGCGCGGA TCTGGGAAGTGACGGACAGAACGGTCAGGACCTGGATTGGGGAGGCGGTT GCCGCCGCTGCTGCTGACGGTGTGACGTTCTCTGTTCCGGTCACACCACA TACGTTCCGCCATTCCTATGCGATGCACATGCTGTATGCCGGTATACCGC TGAAAGTTCTGCAAAGCCTGATGGGACATAAGTCCATCAGTTCAACGGAA GTCTACACGAAGGTTTTTGCGCTGGATGTGGCTGCCCGGCACCGGGTGCA GTTTGCGATGCCGGAGTCTGATGCGGTTGCGATGCTGAAACAATTATCCT GAGAATAAATGCCTTGGCCTTTATATGGAAATGTGGAACTGAGTGGATAT GCTGTTTTTGTCTGTTAAACAGAGAAGCTGGCTGTTATCCACTGAGAAGC GAACGAAACAGTCGGGAAAATCTCCCATTATCGTAGAGATCCGCATTATT AATCTCAGGAGCCTGTGTAGCGTTTATAGGAAGTAGTGTTCTGTCATGAT GCCTGCAAGCGGTAACGAAAACGATTTGAATATGCCTTCAGGAACAATAG AAATCTTCGTGCGGTGTTACGTTGAAGTGGAGCGGATTATGTCAGCAATG GACAGAACAACCTAATGAACACAGAACCATGATGTGGTCTGTCCTTTTAC AGCCAGTAGTGCTCGCCGCAGTCGAGCGACAGGGCGAAGCCCTCGGCTGG TTGCCCTCGCCGCTGGGCTGGCGGCCGTCTATGGCCCTGCAAACGCGCCA GAAACGCCGTCGAAGCCGTGTGCGAGACACCGCGGCCGGCCGCCGGCGTT GTGGATACCTCGCGGAAAACTTGGCCCTCACTGACAGATGAGGGGCGGAC GTTGACACTTGAGGGGCCGACTCACCCGGCGCGGCGTTGACAGATGAGGG GCAGGCTCGATTTCGGCCGGCGACGTGGAGCTGGCCAGCCTCGCAAATCG GCGAAAACGCCTGATTTTACGCGAGTTTCCCACAGATGATGTGGACAAGC CTGGGGATAAGTGCCCTGCGGTATTGACACTTGAGGGGCGCGACTACTGA CAGATGAGGGGCGCGATCCTTGACACTTGAGGGGCAGAGTGCTGACAGAT GAGGGGCGCACCTATTGACATTTGAGGGGCTGTCCACAGGCAGAAAATCC AGCATTTGCAAGGGTTTCCGCCCGTTTTTCGGCCACCGCTAACCTGTCTT TTAACCTGCTTTTAAACCAATATTTATAAACCTTGTTTTTAACCAGGGCT GCGCCCTGTGCGCGTGACCGCGCACGCCGAAGGGGGGTGCCCCCCCTTCT CGAACCCTCCCGGTCGAGTGAGCGAGGAAGCACCAGGGAACAGCACTTAT ATATTCTGCTTACACACGATGCCTGAAAAAACTTCCCTTGGGGTTATCCA CTTATCCACGGGGATATTTTTATAATTATTTTTTTTATAGTTTTTAGATC TTCTTTTTTAGAGCGCCTTGTAGGCCTTTATCCATGCTGGTTCTAGAGAA GGTGTTGTGACAAATTGCCCTTTCAGTGTGACAAATCACCCTCAAATGAC AGTCCTGTCTGTGACAAATTGCCCTTAACCCTGTGACAAATTGCCCTCAG AAGAAGCTGTTTTTTCACAAAGTTATCCCTGCTTATTGACTCTTTTTTAT TTAGTGTGACAATCTAAAAACTTGTCACACTTCACATGGATCTGTCATGG CGGAAACAGCGGTTATCAATCACAAGAAACGTAAAAATAGCCCGCGAATC GTCCAGTCAAACGACCTCACTGAGGCGGCATATAGTCTCTCCCGGGATCA AAAACGTATGCTGTATCTGTTCGTTGACCAGATCAGAAAATCTGATGGCA CCCTACAGGAACATGACGGTATCTGCGAGATCCATGTTGCTAAATATGCT GAAATATTCGGATTGACCTCTGCGGAAGCCAGTAAGGATATACGGCAGGC ATTGAAGAGTTTCGCGGGGAAGGAAGTGGTTTTTTATCGCCCTGAAGAGG ATGCCGGCGATGAAAAAGGCTATGAATCTTTTCCTTGGTTTATCAAACGT GCGCACAGTCCATCCAGAGGGCTTTACAGTGTACATATCAACCCATATCT CATTCCCTTCTTTATCGGGTTACAGAACCGGTTTACGCAGTTTCGGCTTA GTGAAACAAAAGAAATCACCAATCCGTATGCCATGCGTTTATACGAATCC CTGTGTCAGTATCGTAAGCCGGATGGCTCAGGCATCGTCTCTCTGAAAAT CGACTGGATCATAGAGCGTTACCAGCTGCCTCAAAGTTACCAGCGTATGC CTGACTTCCGCCGCCGCTTCCTGCAGGTCTGTGTTAATGAGATCAACAGC AGAACTCCAATGCGCCTCTCATACATTGAGAAAAAGAAAGGCCGCCAGAC GACTCATATCGTATTTTCCTTCCGCGATATCACTTCCATGACGACAGGAT AGTCTGAGGGTTATCTGTCACAGATTTGAGGGTGGTTCGTCACATTTGTT CTGACCTACTGAGGGTAATTTGTCACAGTTTTGCTGTTTCCTTCAGCCTG CATGGATTTTCTCATACTTTTTGAACTGTAATTTTTAAGGAAGCCAAATT TGAGGGCAGTTTGTCACAGTTGATTTCCTTCTCTTTCCCTTCGTCATGTG ACCTGATATCGGGGGTTAGTTCGTCATCATTGATGAGGGTTGATTATCAC AGTTTATTACTCTGAATTGGCTATCCGCGTGTGTACCTCTACCTGGAGTT TTTCCCACGGTGGATATTTCTTCTTGCGCTGAGCGTAAGAGCTATCTGAC AGAACAGTTCTTCTTTGCTTCCTCGCCAGTTCGCTCGCTATGCTCGGTTA CACGGCTGCGGCGAGCGCTAGTGATAATAAGTGACTGAGGTATGTGCTCT TCTTATCTCCTTTTGTAGTGTTGCTCTTATTTTAAACAACTTTGCGGTTT TTTGATGACTTTGCGATTTTGTTGTTGCTTTGCAGTAAATTGCAAGATTT AATAAAAAAACGCAAAGCAATGATTAAAGGATGTTCAGAATGAAACTCAT GGAAACACTTAACCAGTGCATAAACGCTGGTCATGAAATGACGAAGGCTA TCGCCATTGCACAGTTTAATGATGACAGCCCGGAAGCGAGGAAAATAACC CGGCGCTGGAGAATAGGTGAAGCAGCGGATTTAGTTGGGGTTTCTTCTCA GGCTATCAGAGATGCCGAGAAAGCAGGGCGACTACCGCACCCGGATATGG AAATTCGAGGACGGGTTGAGCAACGTGTTGGTTATACAATTGAACAAATT AATCATATGCGTGATGTGTTTGGTACGCGATTGCGACGTGCTGAAGACGT ATTTCCACCGGTGATCGGGGTTGCTGCCCATAAAGGTGGCGTTTACAAAA CCTCAGTTTCTGTTCATCTTGCTCAGGATCTGGCTCTGAAGGGGCTACGT GTTTTGCTCGTGGAAGGTAACGACCCCCAGGGAACAGCCTCAATGTATCA CGGATGGGTACCAGATCTTCATATTCATGCAGAAGACACTCTCCTGCCTT TCTATCTTGGGGAAAAGGACGATGTCACTTATGCAATAAAGCCCACTTGC TGGCCGGGGCTTGACATTATTCCTTCCTGTCTGGCTCTGCACCGTATTGA AACTGAGTTAATGGGCAAATTTGATGAAGGTAAACTGCCCACCGATCCAC ACCTGATGCTCCGACTGGCCATTGAAACTGTTGCTCATGACTATGATGTC ATAGTTATTGACAGCGCGCCTAACCTGGGTATCGGCACGATTAATGTCGT ATGTGCTGCTGATGTGCTGATTGTTCCCACGCCTGCTGAGTTGTTTGACT ACACCTCCGCACTGCAGTTTTTCGATATGCTTCGTGATCTGCTCAAGAAC GTTGATCTTAAAGGGTTCGAGCCTGATGTACGTATTTTGCTTACCAAATA CAGCAATAGTAATGGCTCTCAGTCCCCGTGGATGGAGGAGCAAATTCGGG ATGCCTGGGGAAGCATGGTTCTAAAAAATGTTGTACGTGAAACGGATGAA GTTGGTAAAGGTCAGATCCGGATGAGAACTGTTTTTGAACAGGCCATTGA TCAACGCTCTTCAACTGGTGCCTGGAGAAATGCTCTTTCTATTTGGGAAC CTGTCTGCAATGAAATTTTCGATCGTCTGATTAAACCACGCTGGGAGATT AGATAATGAAGCGTGCGCCTGTTATTCCAAAACATACGCTCAATACTCAA CCGGTTGAAGATACTTCGTTATCGACACCAGCTGCCCCGATGGTGGATTC GTTAATTGCGCGCGTAGGAGTAATGGCTCGCGGTAATGCCATTACTTTGC CTGTATGTGGTCGGGATGTGAAGTTTACTCTTGAAGTGCTCCGGGGTGAT AGTGTTGAGAAGACCTCTCGGGTATGGTCAGGTAATGAACGTGACCAGGA GCTGCTTACTGAGGACGCACTGGATGATCTCATCCCTTCTTTTCTACTGA CTGGTCAACAGACACCGGCGTTCGGTCGAAGAGTATCTGGTGTCATAGAA ATTGCCGATGGGAGTCGCCGTCGTAAAGCTGCTGCACTTACCGAAAGTGA TTATCGTGTTCTGGTTGGCGAGCTGGATGATGAGCAGATGGCTGCATTAT CCAGATTGGGTAACGATTATCGCCCAACAAGTGCTTATGAACGTGGTCAG CGTTATGCAAGCCGATTGCAGAATGAATTTGCTGGAAATATTTCTGCGCT GGCTGATGCGGAAAATATTTCACGTAAGATTATTACCCGCTGTATCAACA CCGCCAAATTGCCTAAATCAGTTGTTGCTCTTTTTTCTCACCCCGGTGAA CTATCTGCCCGGTCAGGTGATGCACTTCAAAAAGCCTTTACAGATAAAGA GGAATTACTTAAGCAGCAGGCATCTAACCTTCATGAGCAGAAAAAAGCTG GGGTGATATTTGAAGCTGAAGAAGTTATCACTCTTTTAACTTCTGTGCTT AAAACGTCATCTGCATCAAGAACTAGTTTAAGCTCACGACATCAGTTTGC TCCTGGAGCGACAGTATTGTATAAGGGCGATAAAATGGTGCTTAACCTGG ACAGGTCTCGTGTTCCAACTGAGTGTATAGAGAAAATTGAGGCCATTCTT AAGGAACTTGAAAAGCCAGCACCCTGATGCGACCACGTTTTAGTCTACGT TTATCTGTCTTTACTTAATGTCCTTTGTTACAGGCCAGAAAGCATAACTG GCCTGAATATTCTCTCTGGGCCCACTGTTCCACTTGTATCGTCGGTCTGA TAATCAGACTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAG TCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGA CCACGGTCCCACTCGTATCGTCGGTCTGATAATCAGACTGGGACCACGGT CCCACTCGTATCGTCGGTCTGATTATTAGTCTGGGACCATGGTCCCACTC GTATCGTCGGTCTGATTATTAGTCTGGGACCACGGTCCCACTCGTATCGT CGGTCTGATTATTAGTCTGGAACCACGGTCCCACTCGTATCGTCGGTCTG ATTATTAGTCTGGGACCACGGTCCCACTCGTATCGTCGGTCTGATTATTA GTCTGGGACCACGATCCCACTCGTGTTGTCGGTCTGATTATCGGTCTGGG ACCACGGTCCCACTTGTATTGTCGATCAGACTATCAGCGTGAGACTACGA TTCCATCAATGCCTGTCAAGGGCAAGTATTGACATGTCGTCGTAACCTGT AGAACGGAGTAACCTCGGTGTGCGGTTGTATGCCTGCTGTGGATTGCTGC TGTGTCCTGCTTATCCACAACATTTTGCGCACGGTTATGTGGACAAAATA CCTGGTTACCCAGGCCGTGCCGGCACGTTAACCGGGCTGCATCCGATGCA AGTGTGTCGCTGTCGACGAGCTCGCGAGCTCGGACATGAGGTTGCCCCGT ATTCAGTGTCGCTGATTTGTATTGTCTGAAGTTGTTTTTACGTTAAGTTG ATGCAGATCAATTAATACGATACCTGCGTCATAATTGATTATTTGACGTG GTTTGATGGCCTCCACGCACGTTGTGATATGTAGATGATAATCATTATCA CTTTACGGGTCCTTTCCGGTGATCCGACAGGTTACGGGGCGGCGACCTCG CGGGTTTTCGCTATTTATGAAAATTTTCCGGTTTAAGGCGTTTCCGTTCT TCTTCGTCATAACTTAATGTTTTTATTTAAAATACCCTCTGAAAAGAAAG GAAACGACAGGTGCTGAAAGCGAGCTTTTTGGCCTCTGTCGTTTCCTTTC TCTGTTTTTGTCCGTGGAATGAACAATGGAAGTCCGAGCTCATCGCTAAT AACTTCGTATAGCATACATTATACGAAGTTATATTCGATGCGGCCGCAAG GGGTTCGCGTCAGCGGGTGTTGGCGGGTGTCGGGGCTGGCTTAACTATGC GGCATCAGAGCAGATTGTACTGAGAGTGCACGAGCTCGCCCGGGGATCTA ATTCAATTAGAGACTAATTCAATTAGAGCTAATTCAATTAGGATCCAAGC TTATCGATTTCGAACCCTCGACCGCCGGAGTATAAATAGAGGCGCTTCGT CTACGGAGCGACAATTCAATTCAAACAAGCAAAGTGAACACGTCGCTAAG CGAAAGCTAAGCAAATAAACAAGCGCAGCTGAACAAGCTAAACAATCGGG GTACCGCTAGAGTCGACGGTACCGCGGGCCCGGGATCCACCGGTCGCCAC CATGGTGCGCTCCTCCAAGAACGTCATCAAGGAGTTCATGCGCTTCAAGG TGCGCATGGAGGGCACCGTGAACGGCCACGAGTTCGAGATCGAGGGCGAG GGCGAGGGCCGCCCCTACGAGGGCCACAACACCGTGAAGCTGAAGGTGAC CAAGGGCGGCCCCCTGCCCTTCGCCTGGGACATCCTGTCCCCCCAGTTCC AGTACGGCTCCAAGGTGTACGTGAAGCACCCCGCCGACATCCCCGACTAC AAGAAGCTGTCCTTCCCCGAGGGCTTCAAGTGGGAGCGCGTGATGAACTT CGAGGACGGCGGCGTGGTGACCGTGACCCAGGACTCCTCCCTGCAGGACG GCTGCTTCATCTACAAGGTGAAGTTCATCGGCGTGAACTTCCCCTCCGAC GGCCCCGTAATGCAGAAGAAGACCATGGGCTGGGAGGCCTCCACCGAGCG CCTGTACCCCCGCGACGGCGTGCTGAAGGGCGAGATCCACAAGGCCCTGA AGCTGAAGGACGGCGGCCACTACCTGGTGGAGTTCAAGTCCATCTACATG GCCAAGAAGCCCGTGCAGCTGCCCGGCTACTACTACGTGGACTCCAAGCT GGACATCACCTCCCACAACGAGGACTACACCATCGTGGAGCAGTACGAGC GCACCGAGGGCCGCCACCACCTGTTCCTGTAGCGGCGGCGACTCTAGATC ATAATCAGCCATACCACATTTGTAGAGGTTTTACTTGCTTTAAAAAACCT CCCACACCTCCCCCTGAACCTGAAACATAAAATGAATGCAATTGTTGTTG TTAACTTGTTTATTGCAGCTTATAATGGTTACAAATAAAGCAATAGCATC ACAAATTTCACAAATAAAGCATTTTTTTCACTGCCCTAGGCATATGCGGT GTGAAATACCGCACAGATGCGTAAGGAGAAAATACCGCATCAGGCGCCAT TCGCCATTCAGCTGCGCAACTGTTGGGAAGGGCGATCGGTGCGGGCCTCT TCGCTATTACGCCAGCTGGCGAAAGGGGGATGTGCTGCAAGGCGATTAAG TTGGGTAACGCCAGGGTTTTCCCAGTCACGACGTTGTAAAACGACGGCCA GTGAATTGTAATACGACTCACTATAGGGCGAATTCGAGCTCGGTACCCGG GGATCCCACGTACAACGACACCTAGACCACTTTGTATTTGTGTGTGTCAT CATCGAGGAAATCCGGCGCCAAGTGCCGGCGCCTCTGCGGCTACTTTTTC GTTTTCAGCCAACTCATGTGATTTCCCCCATTTTCCATCCATTTTTCCCC TGTTCCGCATCCTGAAATGCGCTTTTTCCTTTTCCTCTGTTTTGCTTGCG ACTTTCGCAACAGCTCAGCTGTTGTCACCACACCACACCACCCCACTCCA CCGCCCGGGAAAATGCAATTTTAACTGGGCCCACGTTGTAGCCGTTTTTG GTTTTTCGACTTTTATTGGACCCGTATCCGCATTGCCATTTCTCACATTG TTTTCTGGCCATGCCTTGTAATTTAATTGGCAATTTGGACAGTTTTTCAC TTTCCAGCTTCTTTTGGCCAAGAGCCATGAACTTCGACCAAGTCTGGCGC AATCTCAATTTAAGCAAGACCAAATGAAAACAGTGTTTTTGTTCCATTCA TTTTGCCTTTAGCAATTTTGGCCAGAATGAAATCTTTTGTAAACTCAATT TGATTATATGCACTGGACACATCCCAGATTGCCAGCCATGTCTCCTCCTC ACGAAGAATATCAAACGATACCATTTAAAAGAAGACTGCCACTTTTTGCC AGGTAATGGAAGACAAACATGAGATGGTTTGATTTATTGCAGCTTTTCTC TGTGCGAGAAATTACAGGGAAAATGAAATATTGCACTAACTAAGGCAGTA GAGACTTTTAAGGGTATTTAGAAAACGGAGAATCTGAATAGAGTGACGTA GTGTATAGATTTCGAACTCGATATAAGAGGTCGATTTTTCTTTGTTATCG CATTCTTTTCATGGACTGCTTCCGGCCATTTCTAAACCTACAAAAAACTA ATGTGTTTTATCTTGAAGTTTCCCTGAGATTTGTCAACCATATCAGTAGT TTAAATTCGTGTGAAATCAGTGCAAAAGAACATTAATAATAAAATGTTTT GTTTAATGATTACCCATAAAAATATATTTTTTAATGAGTAAGCGTAAAAT TATATAAAAGTCATCAATTATATTTGAATAATAAAAAAAACAAAACACGT ATGTATGATGTAGTCACCGCTTTTGATTTCCATATATATATTTATTGGGT CGTTTATTTTCATTAAGTTTCGAGAATATTTCTCGTGATTTTCTTCCATA AAATCAATCTGAAAAACTGATTACTAATTGATGTGGGAATCGAACCGTCG GCTATCAACGAATCAAATTGGCTTGGTCGCTAATTAATTGTCTTAAGTGT TTTTAGCCGCTGGTGATTAAGAAAGGTGAATGTGATTTAACATGCAAATC ACGAAGAAAGTTTTAGTCACACCATTGATTATAACTTTTAAATAGTTGAG CCAACAAAAGAATTCTTGTGGGACGAACTTCAACTTACTATATCAGCTGT TGCGCCCACAAAAACAAAAGAACCAAAGGCGCACCCAAATTCACGCAACA GTTTTCCCAACTTATAGCTCCCCATTCACCACCCACAAAGTTCGATTGAT GATAGGCCTAGAATTTGGTAGTACCTGGTGGCAACAGTGGATTGGTAACC AACTTGGGCAATAGCGAAAATTGCGCAAAGTTCTAGGAAAATATACGAAA GTTTGAACAGCTGTGGATATAACAATTATATTTGACTTTCTATATGTTTA CTTGCTTAACCTTGCTGTCATTGTTAATTTATGTAAGCAGCTGCTGTGCT GCTTTTTCGAAATACAACTAAAAACTAGTTGATGCTAATGCTAAGGAAAT TAAATTAAAATTAACATCAAATTGAATACCAGTTTCTTATTTTTCTGCTG TTTTTAATACGAATTTCCTGCGGAAATGTTTATAAGTATTTCCGATTGTC CTTAATTCTCTCCACTGTGTCCTTTATTGGCATTAGCCTAATAGCTCATC GAATCGAGCCCAACCCAGACATGCCTAGATGAGCCATTAGTCGCAGCTCA CTAATTTGTTGTCATAAATTTTATGGATGTGCTGTAAAGTTGATTTTATG CGAGGCACACTTTCTCCCTTTATTCGCACGATATTCGGGAAAATTGGATC TGAATAGGTGGTATGGTTGTGTGGCAGATATGATTTGATAAATGCCCCAC TGTTTGACTCCATTATGGTTAAAAATCTCTGCCGCCACACCGATATGCGA TATGTAGCATGGTTATTAATCAAATTGATGGGTAATTTGCAATGAAGCTT ATCTATAGAGGTTTCCCTTTTTGGTTCAGTATATTGAAACCTCTGTACGA AGTAGCACACACCTTGTGTGAAAAATATGTTTACTGATAATTTTGCCATT TGCGCTGAGGCAAAGCTAAATATAGCAGATACTAAATAGAAGTGTTAAAA TTGTGTTAATTTCCATGGTATATTCAGCGTGAACAATGAATTTGACACAT GTTAGCTAAAACCAATATGATCGTATCATGTTCTGGTGGGTTATTTCAGT ATAAACAGAATCATGTTTAGTAAACACCCATTTAGTCGTTTATTAAACGC TGTTGTTAGTTGTATTTGTTCGGTGATTAAAATAAAATATAACTACGTGT ATTTGATGCTAAACTCTTTAAAGAAATTAGTGTGTTGAAATTTGTTTAAT ATTTTACAAAATATTGTGTGCCTGGTACTTTAAAAGCGCAAACTCTATAT TCGTATGCACATGCAATACTTCAATTTTGATGGATTGCATACATGCACTT ACTTTCCCACTTCAACAAGCACGAAGTGCAGGGAACTCCAAAAAAGTATA TATGTATATATGTACATATAGAAGCACCCGAGCGCGGCTCTTAAGAATTT GTGGCACGTTTCCATTGATTGCGTTTGAGAGCTGCCACCAAACCGGATAT AAATGACTCTATGCACTATAACTCACATGACCATAAAGGCATTCAGATAC GGCCACCTCCGTTCTTCGTCCGCTCGGGAAATCCATTCGTTAATCCATTA AATTTGAAATATGTTCTGGCGGGTGGTCGTTGTTGGCTCGAAGAATCCTG CTCGATCCTGGAAATCCCTTTCGCACTTAGATAAATGCCATGCGCTTGGG TAATGCCGATGTGTCAAGTTCGGGTTGAAGCTCCTCTTAAGCTTTGCAAC ACAAATCAAAATGCTAGCAACTTGCTGTTTCACCTCTGCCCTTTTCAAGC GAAGAACTTCCCAGAATTTTCTCTCTGCTTTGCCAGAAGAAATAGGGGAG CGTTGAAGTGTCTAAGAACAGCTATATTTCATTTAAATAAATAAGAAAAT ATTTCTCAAAAGGAAGTGCTGAATGTTACGATCTAAATTAAAAGAAATAT GCATTTTTTGCATTCCTCTAAAGTTTTTCTTTGTTAAAGCTATAAAAGAA ACCTAAAATACTTTCTCATGTTTATACAATTTGTGGAAACCTTAAACCAC TACAATTAAAATAAAATAAAATGCACTGGAAAGTTGTTATCTCAACAGGT AATTTTAGTAAGAACAACTTAAAAAAACGATTAAGTTCGCACTCCAACCG AAATGGTTGAAATAGCTGGTCCAGTTACCACGGCTCCCAAATGCACATGC CCCTAGTATTATGCAATTGTTTTCGCCAGACACAGACAGACACACGCATA CCAACAAACACTCTGAGCACCAATACAATGATGAAAAAAGAAGAAATTTC GTTGCCGGCGTCATTTTGATGGCTGTCCACAGTGGGATATTTCATTTGGC GCTTATGGCCGAAAATGGTTGAAATTGAATGGACCGAGATGGAAAATAGA AATAAAGGCGAGGCACTTTCATATCCGAAATAACTCCTAAATGCGTGTCC TTGCCGCAAAACGAGCTAGTGGTCGGACATTCAAAAAGCACTTTGAATTC CGCCATGCCACAAAAATTGCCAATTCAGTCGTTCATAGCGTGTTTTCACT TTAATTATTGAAAGTGTGATGGGGGTATAAATATGCAATGTTCTTTTACT TAGTATATCCTTAAAGAGTCCTTTGGGCATATCTCTTTAAAATGGACTTT GAAAGTTATTGCTTTTTAAGATTTTGAATTTGTATAATTTATTTGTAAGT AAAGTAAAGTGACTGCTTTTGTTACATTGTTTATTGGGAAATGAAACATA TCATTAACTATTTGCTTTAAAATTAATTTATATGCTGGTCTGTTTTTTTT TTTTTTATTAAATCTCAGGTTCAGCTCTTTGTACTAAAGAATTTCAAAAA GGCAATTGTTTATAAAGACCGAGAACATGTTTATCAACATTTTGTGCCAC AAGTCAGGCTCGATGAGGATGAGCTGTCAACGATACGTGACAAATGCCAA CATCTTTAATTCTGGTATTACAAAAAAAAAAAAAAAATAATAATAAAATA TTGTGATATTGCACTCTGACATTTGTGCCCCATTGTGTTTGAGCACTCGC CACCCACTGTGCCGCCCATTGTGGAGCTGTGTGGGTGTGTATGTGTGGGT GGATGGTTGCGTCCATTCAAGGACACGGCGTGGCACCGCTCTCGAATGGC ATCCGGGTGCTCGAGAGCCTGTGCCTGGTGCTCGCTGCAGCTCCTCGACG CCGCTCTCCATAGCCGTGGCAATGGCAGAGTGCTCCATTTCGTAACTTCC ACACCCATACACCCACACACAGCCAACATTTTCCGGCTTTCCCTTCGTCA GCACTTGGCACCCACTTGTGCGGTATTTGGTTTTCGCACTCCACCGCCCA CTACGCAGACTACACAGGAAAATTTAGCAATAAAAACAAGCAATTTCAAA AGTTTTTTAATATTCAATCACATTGTTGGATATGATATAATTCCTAATGA AGGTAATAAACTTAATGAAGGTGAACTGAATAGTTTGAAGTTCTGCTAAG AAAAGTGATAAAAGTACATGTTTGTCTGTTTTCTGAACATTTCTAACTAA TTTCTTTCTAACTTCAGTCCATTTAATTTCCAATAAAACTAAATGAATAT ACATGATGTGCCTGATCATTTTGCACAGTGCACATAACCATGCCCACTAA ATGTGCCCCGTCTGGCTGGGATGCATTCATATATGTATACTCACATCCAG TTGTTTCCATTTCCATTGCGGCTTTATTTGTTGGCCTCGGTGTGCTGAAA TTGTCATGTAAATGGGTTAAGTTCTGACATTAAAATGTGCCCGTCCAGAT TTTTCATTTGTGCTCTTGCTTTGACATTTGGCCAAAATGATTTCCCATTT CCGGGCGACCATGGGCGCCATGGTTCGTGATCCTGTTTCCGCATCCTTCT ATCCCCCCCCCCCCTTCACCACTCGGTTAACCCTACGTCCGTTATCCTGT TTATTCATTAAAAACCAAAGCCGAGAAAATGTCTGAAATTTCTGCCAACG GGCACAAAGAGATTTGCAGTATTTGTTGATAATTGCATTTTCTACTCTCT TTTGGTCTGACAAGGCATTCAAATTTAATAAAATGGCTTCTTCTGTTGAA ATTTGTAAGGATTTTCTAGCATGTTACCAATTCAACATTCATTAAAAATG TCATGACATTGAAATGAAATACATATCTTGTAAAAAAAAAAAATAAAGAC GCATCTATCGAGGATGTTGACAGCCAAGCAACAGAATATTTTATGTTTAT TTTCAGAAGGGAAATATAGCCTATATATAGGTCCAAATTCGAAATATATA TTAACCCGATAAGAAGTCATATAATTGTACCCTTGGTTAATAGTCTTAGT AATCAAATTTATTGCAATCATAAATATGAAATTGTGGGCAATTCCCTAAA CTCTGTCAAAAAAGTGGTATATCTATAAGCAATTAGTAGTACTATGTTGT AACATCATACATAAGTCTGTATAGATAAAAACAACATATGTTCCGATAAA TTGATTTAATGCATTCCATCTGCTTCGTTTTTTGAGCTGTATAGGCTTTA GTTGAAATTCCGTACTAACACCTACTGAGTGTATTATTAAAAGTATTTAT GAAATTTCCATTAAATATATAAATATAAATATATATTTAGCTTATAGACA CACTAATGGTGGCTTGCACTTCAACATTAACAACAGCTTAACAACTGATT TGCAAAATAGGTTTTTTTGTAACCGCGGGCGCACACTTTAATTGCATACA GATTGAAAATAATGCAAAACAGAAAAGAGTCGAGAACAAAACCAAATGCA ACTAAAACGATGAACAAAACGGCGCCCAACTTTGTTGGAATCATGCAAAG CACAGCACATTTCCAATTGGCCATTGAACTTTCATATCAAAAACAGCGAC ACCACCACCACCGGCGAAAATGGTTTTTAAAATGCTTAAACACGCGAGAC CCAACAGCCGCGCCCCATCATAATTGGAAAAGTCTGTAAGAATCGCCAAT GTTCGTACCCCAGGCGTACTATACGTACTATGTGTTGTCTACGTGCATAC TCGTATGAATGTGTAAATGTATGTGTGTGTATATGTGTATATGTATAAGT GCATGTGCTTGTAGGTCGGCGGGAAAACAACTTCCGCTACCAGCTGATAG CCAACCCTTCCCTTGCTCTCATTTCCCCAGGCTGTTGTTAACAACTTTGC GCAAATTACAATGGGAGCGTGGAAAGTGGAGTCGAAAGGGTTAGGAGGTC TTGGCTTTTGGCCACAGGTGAGATTAGCACAACAGCGGGAAAAACGCAAT CTATTAAAGCGATGCACTTATTAGGTATGTTACATGGATAGCTTTAATCA GGACATACATACATATGTAAGGCATAACTCATCTCACACTTACTCATTTT TAAACAATATAAAACTTTTGGTTTAAACTTCAGTATTTAACAAGCTATTG CACCCAAAACGAACTAAGAATCGGTTTTGAGATATGCTATCATAATAATA CAATTAGCAATAGCTGATAACAAATTTGGTATTGTCATTTGCGTTAGCAT TAAGATTTTCCGAACTTATTTTTCAGCGCTTTAGATGCGTCGCAATAAGC TAATTAAATTAAAACCTTAACGACAAAACCGAAATCAATCAAAATTTAGT TCGAAACCGTATCGAACTATTTTGTTTTTCAACCGCACAGCAATGAAATG ATAGCACAACATCAGTGACTCAGATAAATGCTTTTCGCCTTATCTCTTCT GAAATTAATTTTTTTTGTACGAATTTTTCTCTTGCGAAAAACGAAGAGCT GATAATGATGGATATGTTGGACATGTTTATTAAAAAAAAAAAACAATCAA AGTTGAGTGGCTTTTTCATGTTTCGGGTTATTGATAAACTTTAATAGGGG TATTATGTGTGTTCGTAAATATATAAAACGAAATTATTTAGCCTTTTAAA TATATTTTTTATGTCATCTTGGTTTTAAGAAAACTTTTGCTGATAGTTTC GTATTTACATTTTTAATTACCTTTGTCATAAGTTCTTATTTAACAACACT AACTTCCCTTTAATTTTCTACATTTTTTTCAGCTTTCCAATGCGACGAAT AGTTCTATGAAATGTAAGTTTTAGCTTCGCCATTCAGCTAAGTTGGAGTA CGATAGTAAAACCATTAACAAAAACCGATATCGCTGCCTAGTACTTATAT ACATATATATGTACATATATAGATGCCCATATGGATACATGGAGAGGCAA TTGCGATAAAGCCAGTATAAACATAATAACCATACAATTTCAGAATTCAT TGCGTACCGACCAGCACGCCCCATATCGTCGACCGTCCCGCCCCCTTACG ACGCTCCCTCCCCCCCTCGGGCCACGCCTCCGCCACCGTCACGCCCCCTT CCGCTCGACACAGCGTTGAAGGCAGATAGTCAGTAAATGGAATGGAATAA AATAAATCAAAACCGCAAAGGCAGCGAAACGGCGGAGTTGACAAACAAAA ATATTATACAAAATTCGAATGCGAACGAATGCTATCGAAAAACCAACGCA GCGTAACGCGGCCAACACGAAAGAAATCAAAACACCACTTGCAACACAGG CTGCAACTGCAACACAGGCTGCAAGCGCAACAGGACGAGAATTCCTCGAA CAGATCCAGCGACTAGGATGAAGGGCGGCAACTACACCAGCCTCGGCACG TGCAGTGGCATCAATGTCAGTGGCAACGTGGCCGGCACCCGCAAGATGTC ACTGGGCAAATCCATTAAAATGTACCTGACCATTTTCATCCTGACCACCT GCATTTATATGGCGCTCTATCAGTACCACATATCCCGTGAACCCTTCGCC GCCAGCGAGGTTGTCAAGGTGAGTTCATATCTGCACTGCGAGAAAATTCA AAATTAAATGAGAAATTTGAACGGGAGCATGGCATCAATATGTTGACATG ATCCACATATTTAGTTGATTGTAAAATGTACATCATATTATTTATATTTT GGAACAAAAAATCTAGCACTTTAAAAAAGAGTTTGTAGAAGAAATCCAAA TAAGATTTAAGATATGTTTCCCCTTTTTCTCTGCGTGACTTGGATAATGT TTGTTTACTTAAAAGTTGCCAGTTTTCTATTGCACCATATTCCTCTACAA ATTTCTTCATCACATATATTTCGTAATACCAGTTTCACCTAACATGATTT TGGCCTTTGAACGATATCGTTAGCAGATATCATTCTCTGGTTGCGAAAGT TTGATTAAACTAATCTAAAATATGGAACACTCATTGCTTGCCTTGGCCCA ATAACAAATGAAATCAAAAGTAAGTTTATACCTTTTAATTGGCATCTATT TAAGATAATGCCTCCTAATTGGTTAAAACGCTGGGCAGCAGTGAAATAAA TCGTGGGAACATGTACTGTTTACTTTGTTTAAAAATAACAATAGAACGTG AACGATATAAGCAACAAAACCATAAAGATAACTAAAAATCTCATGAAGAG AAATAAGGCAATAATAAAAGAAGAACATGTGTAGCTACAGATTGTGTATT TATACTTATAATTTACTCGTTTGAAGTGCAATAAAAAATGGATAGCAACA TAAACAGGTAGAAGCACGAAATAAAAAGTCAGGTGCTAAATAGAGTAAAG CAGAATTAAGATTAGAGTAAAACGTGCTTTTAAAATGAACTTTATATGGG TTAAACTTTGTGTTGAGAAAGGTGGCTCTTTTGTTTTTTACGATCCCAAA CTCACCGAAACAATAACTAGAGTAAATACTATTGAAATATTTTCTCTGTG TTCTTTTCTCCATTTCCCTCGATCTTCACTTACCCAATTATTGTGAACCA AACTGTAGCATCAGGAGAAATCATCTTCATACATCGCTTCATATTTGTGG TCACCCATTTCCCTGCTAATGGCCAATAGTTCCTCCAATACCAATAACAA TTCCACAACAACAAGCACCACAACAACAACAGCTCCAACGACACCAACAA CCACAACAACCACGACAGTGGGCAGTGTGGGCCAAAAACTGGGCGCATCC TCCATCTCCTCCATTCGCATGGTATCATTAGCGGCCACAATACCGTCATT TAAATCGACCTTATCGGAATCGCGATCGGTATCGTTGGGTGGCCATCAAA AGACTGCAACAGTGAAAACAAGCACCACAATCACAACAAGAACAACAGCC AGTGGCTTGGCCACAACCAAATTGTCAGCAACAACAAGAACAACAGCCAA AACAAGCGCCAAACTGTCCGCGGCAACCACGCCCACTGCCTCCCACATGG AAAACGGCTATAAGACTCGACCAACATTTGTTGCCGCATCCCTGCCCGTA AATATATTGACACAATCAAAGTCCTAGTCGAGCACGTAAAAAATGCACAG AGAAAAAATTCGAGCCAATAGCAAATATTAAATATCAAAATTTTGAAAAA TATGAATATATATTGAAATCATTCTGTAATATGAATTTATTGAAATTTAT AAATGATATTTAAATTGATTTCTTTACCCACATAATTGGAGAAACAAATA GATAAATTTAGATAAATTTCAAAAAGTATAAAAATTGTACAGTGCTGAAC AAAAAAAAAGTTTAAATAATGTAACTAAGTAATCCACAGTAGTGGCAGTA TTTCAACTTAAAGATACATTTATCTCACAACACCCACAAATAGTCAAATT TAGCATATTTATCGCTTTTTTCTCCCGCATTTCACTTTTTCCGTTTTAAT CTTTGAAAGTGCATTTCGATCTTATCTGCATATTATTTTCACTTGACGCG TGCATGTCTGGCTGCCTTTCATTATTCGATAACTGAACGTTGCACTTGTT GCCCCATTCAATAGCAACTGCAATGTTTTACCCTTAGCTCACTCTCTTAT CGCTTTTCCTCAGCCCGTTTTTTCCAATTTCCTAATTGCCCCATTGGTTG CTGGTCATAAATAAATTGAAATGGGCTAGTTATAATCATTTATATATAAT ATAAAGAGAAGAATTAGATTTCATAGACTAAAAAAAAGCGAATTAATGCT TGAGCATCTTAACTAAGATCGTATATTTAGTATCTATGCAAATATAGCGA CAAAATGTGCTGCTCCCCACATTTTGCGAACCAAGTTTGCTGCTCGTACG TTAATTATGGTCTCATTAAAGTCCAAAATGGATCTATATTACCAACCGAC TTGGCCATGCTAATAAACACAAAGGGACGCTGTGGCGTACAAATTACGCT GTTTATCTAACCGACTTTTGTTGGCCAGCATGTGCAAATTGGTTGCCAGC TATACGTATCACGATTTCTGGGTTAATCACATGCATTATATTAACCAACA AGCGGTGCCAGCTGCGGGTGTGCCACTGCAACTGGTGGCAAACAAAAAGA TACTCATTTACCATTTGGCATGAGCCTAATTTGAAAATTGCTCTACAGCA TTACATAGAACCCAAAAAAACCAAAACCGCATACAGCTGCAGTTGAATGC AATGGAAAAATATAGAAAAGTGAGTAGCATTGAATGCGGCTGTTGGGTTG GCTGTTGATCTAGATTCCAGATTTATGCAAAATTCAAGCCAATTGAAAAT ATTCACGCGCCAGTTGCATCCACTAACTGCGATTCCCCAGTGCCCTGCAC TCAATGTCAACGGTCAAGCCCATCAGCAAAGAGATAAAGTTGTTCAGGTG GCAATATAATATACCTTGTATATAATACAATTGCAGTTTAAACTTTCTGT TTGTCCACGTTTTTATTAATTTCAAAAGGTTCTCAAGCGAAGTTTTGAAA TTGATTGATATAATCTCGCAACTATTTTTAATTCACAAGTGGATTCAAAA GTCTAAAGATATAATGATATGTCTGCTTAATTTGATATGACCTTCCATAT AAGCAATCAAATGGGTATCTATTACTTGAAATAAGCTAATATTGTGATAG ACCAGCTACTTTGCATGCCATCCTACCCCTTGATCCTCACTATCTTTTTC CATTTCATTTGAATATCCGAGTTTATTTTGCAAAATGAATGCATTTATAT TTGCCACCGCCTTGCATGTGAGTGGGTGGGTGTTATGGGGTGGTATTGTT CTGTGGGTGCATGTGTGTCAACAATGGACAATTTGCGAAGTGAGTGCGCC AGTTTATTTATTTTCAACGTCAGTCGTTCAATGGGCCACTGGTTCACAGG CACCACATCATATCTGGCACGATGGGAATTACACTCGAAACAAAAGGGGG GGTGTAACCAATTAATATACAACCCAAAACGTCATGCAACATGCTTAACT TTTTCAGTTTAATAAGGTTCGAGAGCTGTCTTTAAGAACTTTTCGTTAAA TAAGGTCGTATTTACTTGCTTAGTTTTTAATTTGTTAACTTTCTTATATG TTATACTTAACCTTTATTTTTTCGAGTGCCTTTGACTAGCGAAAGGCGAC CTATATTGCTTAACCAGAGCCTGGGCAATCCGAGTTGGGGCAATGATGGG CGGATGTGGCTCGCTAGCTTTCGCCTAGTCAAGTCATTGGGCTGTAAATT AATTTGCATAATTGCTCATAAAAAGTAGCTGCTCACGCCGCATTACGCAC CACCCAATGGCACCTAACAAGGCACTCAGCCAAGCTGGCACCCCAATCAC CCAGCCACCTAGTCATCTAACTACCATCTAGACCTAACCAGTCCAAGTGC AGTGCACACACACATACGCCCCGTAGTCAGTTCGCAGCGTTAGATAACCT AATGACACTCAACTCAAAATGAACTCGACCCACAGCCGCCCCTGTACATA ATCACGCCCACCTACCGACGACCCGAGCAGCTGGCGGAGCTCACCCGGCT GGGATATACGCTGAAACATGTGGTGAATCTACTCTGGCTGGTCATCGAGG ATGCCAACAAGACGAATCCGCTGGTGGGCCACACTTTGGACCGCATCGGA GTGCCCTACGAGTACATGGTGGGTGAGTATTGGTTTCCTGCCCACATCGC CGCCCAGCCGCTGTGTCATGTCCGGGACACATTCAAGTGATATTTACGAG TCACTACATCGCACCCATTTCCACTTCCCCGTCCACTTCCACTTCCATTG CGCCACATCGGTAACCGTAGCGCCCATGCCGGAGAAGTACAAGCAGACGA AGAAGGCCAAGCCGCGTGGCGTCTCCAATCGGAATCGGGGCCTCGAGTAT CTGCGCGAGCATGCCACCGAGGGAGTGCTCTACTTTGCCGACGACGACAA CACCTACGACATTAGCATATTCGAGCAGGTAAGCCATTGGCAAGGAGCAG CAGGTGGCAGCGGGTGGTATGGCATGGTCTCCGACCCACCTGCTGGATAA AACACAATTTACACGAATTGGGGGTCAAAGGATGTCCATTTCGGATCAAT GGGGAATAGAGGCGAGCTACTGTTTTCACTTTTGTATAGCAAATTAAAGA AATTAAATGAGTGTGCTAAAGTGAAATATGTATGTTGATGCAAAATCATT TACAAAATAATAATTAAACAGGCTTAACTCAAAAAAAAAAAAAAAACTAC CTATTCCGTTCAGATGCGCTACATCAGCAAGGTGGCCATGTGGCCAGTGG GCCTGGTCACAAAGACCGGAGTGAGCAGTCCCATTATTCAGGCGGGCAAG CTGGTTGGCTACTACGATGGCTGGATCGGAGGACGCAAGTATCCAGTGGA CATGGCTGGATTTGCAGTGAGCGTCAAGTTCTTGAAGGAGCGTCCCAATG CCCAGATGCCCTTCAAGCCGGGATACGAGGAGGATGGGTTTCTCCGCAGT TTGGCACCACTTGACGATGCGGAAATCGAGTTGCTGGCGGACGAGTGCAG AGATGTGAGTAGTTTTATTAAAACTAAATATTTTATTAAAGAAGGCCAGT GTCATTTCAATTTATCACATAATGAAATAGCATTCGATATAATATAATGG CTTATCCATTTCATTTCCAGATTCTCACGTGGCACACGCAGACGAAGAAG AACGCACCCGCTCAGGCGCTGAACAGGACGCGCTACAAGAACACGAACCT GGAGCACATAGATAGGCTACTGGTGCGGCCATAGGGATATTTACTGTAGT TAGCTAGTTAGGATTAGCAAGGAGCTCGCCGTATCCAGGTTGGCTCGCTA GCATATTGACCGTGGCTCAGACGGATTGTACAGGTACAATCCGGCGCACG GAGATACCAATCAGAATTGATCAGATCATTAGTCGGTGTACATTATTATC ATAATCATATGATTAGTTAGGCTCTAAGCGCACACATACCTATGATAATT CTTTGCACCGTAGTCTTTGTTTGTTCGCACACCTAATCGAAACTTGAGTA AGCTATTGTATCATATCTCAGCGTCCATGACTACTTTGTAAATAATTTAA GATTAAAGTTGTTTTACGCTCTAAGTTGAAACGGAATTCTCAGCCATAAA AGCAAAAATCAGCAACGAATTGTATAAGATGTTCCTAGACCAAAGAAAAA GCCCCTCAAGTTTTGCATTCAGCAATGCCCCTGGGAAAATGCAATCACCT GCGACAGCCAGGACCTCCAACTGCCGTCTGCAGGATTCGTGCGAGGTCAG GGTCTGAACCACATCAACAATCAATTAGGGCAAGGTGTCAACAAAAAATG GTTGTTCTTCGAATTGTTCTGAAACCGGGGCAAGCGTTCAAATAATTTAT GCCGACATATGGATGAATGTTCGAGGCGGCACAGATAAGTCGTGCACGGA TGAGCCTCCTGCCCCGGCGAAACCAAACGGAATCGCGTGCTTCGTTTAAA TTGCACGAAATAAAAATTGGATACGAACAGGACGAAGGAGACATACCTAG TTTAAACAATGTAAGGGGTTTTGGGCCCTGCTCTAATGGGACTGAATGGC TTGAAAGTTTGGCATAATCAATTTCATCCTAAACGCTGCACGATTTTTTG TCGAATGAGAACTACTTTTTGTATACCTAAGATATGCGTTTTGTTCTTCG TCCGAAACGGGTTTCCAAAGCAAAACTTTTTCACTACTCATAAGTATGCT AAGTTAAGTTTATATAGAAATTTATATTCAAGTTATGAACTGCACTGAAA TCGCCTACATGTAAATACTAATCACCAAATATTGTAACCAAATTTTTACA AGTCCCGCTAAAGCAGGGAGATGCGCAGGGATTGGAAAAAACTCTGACAA ATGGTATTACGAGATTTATACAATTTATACAATTGAATATGGAATGCGAT GTGCCGCAAAGACATTAGTTAGGTACTTACAAAATCTTACAGAAATAAAA TAACAACCGAGTCTTGATGCAAACTCGAGTTAAGCAACTTAAACATTTTC CAAAAATATCTTACAATGTTTCAATGATTAACTACACAGATACCGAAATA CGTCTAAAACTATTCTCTTATTCAAGTAAACTACAACATAAAATGTTTAA ACCTGACAGGGCTAATAGCAAGGAACTTCAATCATTTTTAAACAAAATAC AAATACCTTTCAATAAATTGATAAACTTTTCTTAAAAATTTTCAAAGCAA TCGCACAATGGTTTTATTCCTTCATATAAAGAAATGTTACCAGTTTTTGG TTTTTTTTTAGGGGTTTACAAGTTCGTTTATTTGTAACATAATCTGGTTA GTATCGAAAATCGAAGCATGTTGGTGATCTACATAGATTTGGATAATATT ATATCTTCTAGTGGCTTCAGGCGGCAGCATCAATCAACTGGTTTAGAGTC CTGCAGTCGCTCTTCTCGTAAAGGGAGGCCTCATCCAGGCAGATTTCTGA TGGCTATGGCCACATTTCATAAATCTGCCTTTGCTCGTTCGGCATTAGAT TAGATACTTTGAATATTTTACGTGTATTTACCATCGCCGTTTTTGGTTCG AGATTCGGAATTTCAACCGTTCGTATCTTTTTCAAATACCAATTCGAATT TTTCCATCGGAAAGATAGCAACAGTAGAATTCAACTAATCTTTGTGCTAG TTAAATTATAATCTGGTGCATCGTCTAACAAGCTTACAATATGTGGCACT AATCTTGTTAAGTGCTTAAATCTATACGTTTTCTGGGTCTTTTCAAAACC CTAACACTACGAATTAAAGATATATTGTATCCGATTTCTCTTATTATATT GGTAATATGCAAAAAGATTTAATAGAGATATTTAAAAATATTTAAACTCC GTTTTCTGGTTATATTATTTGATGTTCTTACTGGTTTTTGGAACTTACTT GTTTGGTTTGAGAATCAAGCAGTTGAAATTCTTTTTTGCATTGGTCATTC GCCAAGAAAGTCGATTTATATCATAGACCAAGAGACAACATGACAAGCTC ACATGCTTAATAATTAATAAAAGGATTAAATTAAACAAAAATATATATAA AATAAATGTAGTACTAGTTCTTTGGTTTAAGTATCTGAGCTGTTAAAATT GATTTAATCTGATCCTAATTATTCACTTTCAAATTCAATTGGAAACGTAT CCTATAGGCAAATAAATTTTTACTTTTAAAAAAATAAATGTTATTGATCT AATTTTGTAAATAAGAGACATCCATTTCTAATCACTTTGATGATATCTCT TGCGCTTAAATGTGAATCGTTCTGACTTTAGCAAAGGAGTTCCTAAAGCA AACTGGATTCTGCATTCTACTGTGTGGTACTAAAAAGATAACTCAACATC GATGGCTGCACGTGAAAGCTTATAGTTGCCTCTTCCCACTTGGTACGAAT CAGACGCTGCAACGGCGTGTTGAGCGTCGACTCCTCCTTGGCGACCACAT CGTTACCACCGCTAGCGCCACTAGCAGCACCACCAACACCGCCGCTAGCG CCACCCACACCGCCGCCGGCAGCAGCACCTCCTCCACCGGAAACGGTCGT TGGCGACGTTGCGCCCCCGCCATCCTCCTTTCCGGACATCGAGGTACTCT CCGGCGTGATTGGTTGCCGCTCCAACATGACCAATGCCTGCTCGTTGTAC GTGCGATTGTCGATGGTCATCAGTATCTGATGACCGGAGCAGCTGTAGTA GTTAACATCGAAACGCGACTCCGCATGGTAATTGCGCAACAGATCCGGAT TCTTGTTAAAGATCACGCCAAAGTGACCCGTGCAGCTGGTTATCCAAATG GGATAGTTGGGCGTCTTGAGTCGCGAGCCCGGCTGACGGGACTGATTAAC TGCAGCCTTATATTTAATATATAATAAAAGATTTAATAGTAAATGCACAT AGTAAATATATGGATATAATATATGTAGGAGAAATCGAAATTGAAATTTT GAAATAAGGTTTTTGAAAAATTCCAAAATTAATTCCACTTACGCTAGCTG ACTCGATGTCCCAGAGCAGAAGACCAATCATGCATCGTTTAAGGACGCCG TATTGAGGAACCGCCTGAAAGAACCAAAGTAAACCCACTGCAGTTCAAGG AAAATCTTCCTAAATCCACTACCCACATAGCTACTCTCATCGCCCACATT TACAACACCATTATGAATATAGGGCGTGGCACGTCCCGTCAACAGCAGGG TGACAATCATCAGGGATCCCTCCTCGTGATTGCTCGACGTCAGGGGCGTG GATTTGGCGGAGTCCAGATCCGTTCGAACTCTGCAAAAACATTCGAAAGT ATTCACCGCCGAGGGGTACAATTAAATGGAATATAAATGGTTATCTGGAA CAGAGAATGGCATTTGCATGCACAGACACTTGGGCTCAATCTTACTTTCC CATGGATCGCGTGAGGACGGCGCTATATAGAAACAGCAGGGTGCCTGGGG TCTCCTCTTCTGTAAACTTTTAGGCATGTTAAGTGCAAACTGTTTGATCA AATGGCTGGGCAAGTAAGTAGTTAACTTTGTGGGTCTTACGTATTTAAAA TTTCGCTTCAAAAAGTATTCCAACTCATCGTTGGGTGACAGCGTGAAAAC ATAGAGCTGCAAATGGTAATTTGATTAGGACTTTATAAGTTTAGCATCAC ATTTGGCTTCGCATATTCTCAATTAAACTGTTATAAAAATGGTTACCATA TAAAAAGAAAGATTTCTTTTGTTTGATTTAATATAAGAAACCTAATTGAT AAACATAATAAATCTATCTAATCCGCGAAAATGCTTAAAAATCAATATGT CGTCTATAAATTGAATTTCAATTGGGAAATTATTAAAAAGTATAAAATCC ATATGTAATATTAAAATTTGTAAGTAATATCTTTTTACTATAAGTTTAAT TCCTTTCAATTTCTGAATTAAAATGTGATATTTTTTTAAAATTTTTATCA CGTATTGCTTTTATTAGATCAATAACGCTGACTTATGCAATTGTGGCACG TACCTTCTCGGTGACGGAATCATGAAAATAGCAGGCGCTGTGGTCCACGA ACACCTCGTCCTCCGACGGCAGCACCATGGTGACCTTGCCCTTGTCCGAA ATGGTGCGCAGTATCTCCAAGAGGGCGCAGAACAAGGCCTCCCTCTGCAT ATCGGCGGTGGCCAGGAGCGGGCTGAAATAAAAACACACACAAACACTCT GCAAAACCAAGTCGAAAAGCGGAAACGGAAATGGAAACGCACTCGGTAAG CGAAGCCACGCGACTGGTCTTCCGGGCGAAGAGCAGATACTTCAGGACGA ATCCCTGGACGACGGACAAGAGACCACGTGTGGCATTCCGGGGCGAACGA AGACCGTAGGCCAGCTCCTCCTTGGGAGCACCAAACACAAAGGATGTCTG TAGCCATTCGGCTCGCATGGGAATTGCTGCCGTACCGAAAACCAAATTGC GCAGATCCTAAACGATGGCACAAAATCTACAGGATCACATTGAGTCCAAG TCCGGATAACTGCTAATTACCGTGGCCAATTCAGCGGTTATAGGCGTGCC GCCCTGCGTGATAAACTCTTTGTTCATTTTCGTTTTCTCTAATTAACTGC TGATTTCCGTTTCCGCTAGAGACCTTTGCTCCACTCTGCGACTCGTCGGC GAATGATTTCTCGTCGAGCACGGTTCCGGGCTCCAAGTCGAGCCTCAGAG GTGGAGGCTTTGGCAGACAGCTCCCAGGCATTTCACACTTCAGCATGGAT TTTTAATTTCATATTTAGCCGTGGGCGCACGGGGCGTATGCGCAACTAAA CAGAACCCTCTCAGGTGGCAGTTGGTTACAGTGGGATCATTTCGTTTTCA TTTCATTATTACTTACTAAACAGAAAATATCAGTGCTAAGTTTATTCTTG CAGTTCAGCGCAGCAATAGCTAAAGTATTTTATAAAATGTTTTTCACAAC TTAGAATGATTCTACCTTTTCTTTTTTTGTGGCCCACTGTGTTGGGTTTT AGGCTTAGGCTGAGAGGGTCGTTTGCTGTCTGTCAGTCAGCGAAAGTAAC TTTAAATGAAATTGAATTGAATTTAGTTCTGTGTGCGGCACACGAAACTC GATGTATGTGGCACAATAAGTGAAAGTGTTACGGCGGGACGCGATGGAGA CGAAGGCGGAGAAATGGGACATAGGACATGGGCTTGGCCATAGGTGGAGG TTACATTCAGCTTGAATCTGGCATGTTGCAGCCTGTCAGGGCGCTCCACA CAACCGGAAATATGTAGTTGACGCCCATTTGTGCCTATTCCGAGGCAAAG GAACACCTGTACCCCGGAGCAGGTTGCGAGTGTGTGTGCATTACTGGGTG TTAATATTCCATTGATACACCGGAAAGGCATTCCAGGACCCACCGCAGTA TGGCTCAGGCATTTTAAATTTAGACAGCACTCATGTTTCGGGCAGGCTAC CCCCGATTGATTTGTTGAATTTTTGGGAGGGCCTAAATGGAAGTGAAAGT GGCCCAATAACTGGCTGATTGGCTGTCTGGCTGGTTATAACCTTGGGCAA GTCAGCGTCAATTTTATTAAAGTCCCAAACTGGCATGCACACAGCGACTT AACACCAGTGAATTGCCACATTTTCTTGGCTTGGTAAATCGAAAATGCCC CGTGGTATCCGAAGTGATCAGGTGCAGCCAAACTGTTGAAGGGTAATCTT CCCGCCTGTCAGTAAACTCTGCTGTTGACTGGCAGTCATTACAAGTGATT AGTAAATTTATTCAGAAATCCTACACCTTAATAGCCAATTAAAAGTAAAG CATCATAAAGGCATAAATACTTCGCTCATCGCTTTAGAATAAACATGTGT TTACATACTATAAAAACTACTCATTCTCTGTCATATTATAAAATAATTAC ATTCATATTGTCATGGTTCGACGGGATTTTCGCCCATCAAGTTGAACACA TACAAGGTTACATATTTCTGAGAATAAGTTAGTGGAATAAAAATGATGTA TACAACATTTACATAAAAATGTACATTTTGAACTTATGATTTAGACGTAA AGCAAACGGTTAGCGTACTTACTTGTCGTCGTCATCCTTGTAGTCAATGT CATGATCTTTATAGTCTCCATCGTGGTCTTTATAATCTGTCGACGAAGTT CCTATACTTTCTAGAGAATAGGAACTTCCCGAGGATCCGCTGCCGCCGGC GTTGCTGCGCCACTCCATCTTCTGGCTATCCAGGATCTGGCGCAGGCTGC TGGCCATGCCCTGGAAGTACAGGTTCTCGGGGCCCTGGAACAGCACCTCC AGGGTGCTATCCAGGCCCAGCAGGGGGTTGGGGATGGGCTTGCCCTCGAG CTTGTACAGCTCATCCATGCCCAGGGTGATGCCGGCGGCGGTCACGAACT CCAGCAGCACCATGTGATCGCGCTTCTCGTTGGGGTCCTTGGACAGCACG CTCTGGGTGCTCAGGTAGTGGTTATCGGGCAGCAGCACTGGGCCGTCGCC GATGGGGGTGTTCTGCTGGTAGTGATCGGCCAGCTGCACGGAGCCATCCT CCACATTGTGGCGGATCTTGAAGTTGGCCTTGATGCCGTTCTTCTGCTTA TCGGCGGTGATGTACACGTTGTGGCTGTTGAAGTTGTACTCCAGCTTGTG GCCCAGGATGTTGCCATCCTCCTTGAAATCGATGCCCTTCAGCTCGATGC GGTTCACCAGGGTATCGCCCTCGAACTTCACCTCGGCGCGGGTCTTGTAG GTGCCGTCATCCTTGAAGCTGATGGTGCGCTCCTGCACGTAGCCCTCGGG CATGGCGCTCTTGAAGAAATCGTGCTGCTTCATGTGATCGGGGTAGCGGC TGAAGCACTGCACGCCGTAGGTCAGGGTGGTCACCAGGGTGGGCCAGGGC ACGGGCAGCTTGCCGGTGGTGCAGATGAACTTCAGGGTCAGCTTGCCGTT GGTGGCGTCGCCCTCGCCCTCGCCGCGCACGCTGAACTTGTGGCCGTTCA CGTCGCCATCCAGCTCCACCAGGATGGGCACCACGCCGGTGAACAGCTCC TCGCCCTTGGACACCATGAATTCATCAAGTGGATCTTGGTTTGTGTGAAC CTCGTCCAGCGGGTCCTGATTGGTATGCACTTCTTTCAACACATTCGGCT CCGGAGGTTGCATTATATCTTTCATTACGGTTCTCGCAGAGGCAGGAGCC CGACCCACTAGGTACAGGATGTTGAAGTACCAGTCGAGCAGATATAGCTT GAAGGCTGACAGAAACAGACAGTATTCGAAGTATATGCGTCCACTTAGCC AACGGATATATTGCACGGGAGACCTTCTATTGTGCTGCATATACAGGCAT TTCTGGGCATATCGCGCCATGACCCGAGGACGATTCACCACGTCTCCATG CTGATGACTAATGGCACGCACTGTGTTCAGATTACGCACCTAGTTCAATA GGTAATTATGTATCTTGGCTGATAACAAGTATATGCATATAGCTACAAAA CTTACCACGAACAACATGCTTCTGGGCATCTCCTTCAGGGTGCCCATGAT GTGCTCGAAATTATTCCTGGCTATCTCCTGCATGTGATCGATGTCCTCCT GCGTCAGTTTGCCGCGTATGCCACCACCTCGATTCCGGATGGGCTGCTGG AAAAGCACTTCGGCGAAGCGCATGTAGTCACCGATACCGATCTTCTCGGC GGCGGCCTGCATCCGATTCTCTTGGCGCAGAACGGTGGCCTCCCAGAATT CGCAGAGTGGACCTCGCACATTTTGAGGCAGTTCTTCGTAAAGTCCATGA TCCAGCAAGATGATGTCCGCACGCCCGTTTTTTCTATTTTTTCTCACAAA AACTTTAAAAAAAAGTGAGGATATTTAAATTAAAACATTTTAAGGGTAGT TTTCACTAGTTAACCCACTATTTCCTGGATGGGGATCGGCGTGCACGAAG CCAGTGTAGAAAATCTGTTCAGCAAAGGCCTCAAAGAGCTTCACATCGAT GTCCTTTAAGCTGAGTTTTTCTTTTTCAATCGTCTTAAGATCGCTGATCT TGCATCCATCCATCCACTCAAGAGTGAGCACGCGCTAAGAAAAACCGATT GTTAATTTAAGCATCCAGTTAATCAATGAACAATATTTTCTAACTTCTAA AACTTATGAAAACTCACCGTTTTAGTATACGACCAATGCACCTTGGGAAC GTGGACATAGCTGAACTTTTCCATATCCTTGGCGCAGCGTTCGGCATTTT GTCCCTCCTGCAAAAAGTTCAGCTCCAGCACCAGGTTCTTACGCAGGTCA TTCAAGATCCATCCAAAGTTGTAGTCCTTAAAGAAGAACTCGACAATGTC CTGAAGAAAGATGATGGTGCCTAGGTCGCTGATGAATCTCTTCTGCAGAT CGTTGTATTGCACCTTGACGGCCACCTGCTCGCCGCTGGGCAGCCTGGCT TTGAAAACCTGCGCCAAGCTGGCGGCCGCCACGGGCTGATAGTCGAACTC CTGGTATATCTCCTCGGGCAACTGGCCAAAATCCTTGCGAAAGACCTTCT GAACATCAGCTTGAGTGGTGGGCAGACATCTATCCTGCAGCAGGGACAGC GTGCTGGTGTATTCCACGGGCAGAATGTCATTGATGGCCGCGAATCCCTG GCCCACCTTGATGTACAGACCGCCGTTGAGCAGGCACGTCTCCAGCAGAC GCTCGGCACTCTTCTTGTGGAGCAGCTTCACCTTTGTTTCGTACTCCGGA TCGTTCTCGTCCAGCCGCAGATAGTCAGCGGCTATCAATCCGGCTGTTTT TAAGGATCGTACAAATCGCACGGAGGCGCCGCAGTAGGTGAAGTCATTTA CTATCCCATCGTAAGCCAGGCCACCTGCGCCGGCTGCCAAAAGACTAAAT CGCAATACAGGACGACCGCCTTTCTGGACATTCGCCTCTCGCAGGCCATT GAGTGCTCTTTTGCCTCGAATCCGTGTTCCGAGGCTCAGCAACTGCCGCA CACGCTAAGATTTTAGAATGTATTCTCTGCGATTAATAATGGACCTCAGC GTTGTAGCACTCACCTGGAGAGGTCGCATTTTCTGTCCGCCCGCTGCAAA GTTCACCCAATGTTTACTCTTTGGACACCTGTCGCAATATCAGCTGGAAA GGCCGAACAGCTGTTTGTAGACCCGCCGTGATGATAACAACAGCGCGATG ATGGGGCAACATCGTCATCGTCACCCGCTCATTTGGTTTCCGTTTCCGCG GTTTTAGAATTTCAAGTGTATTCGATTTACTAACTGCTTGAAAAGTGTCA TTCAAAAATACGAAAAGCACTCTTTTCATAGAAGAGCATTTGTTTCTGTA AACTTCCGCTTTACACTAGATTACGCAGCTCAAATTTGTTGCAATTGACT GATTTTATGTCTAAATAATAGTTCATATTCCAAAAAAGCACCATAAGCTA AATAAAATTAACAATCATTCATTAACATTTCACTAAACCGTTATTTTGGT TGACAAAACTAAATAAACTAAACATATACTGATGTTGGTATTTTGTTTAA GTACCGAAATCGTGTCTTTTTCAATCATCCGCGCAAGGTCACACTGCTTT GTTGATTCTTGATTAGGTTCTGCATTTTTTCTGTTTGCGGCGGCGGCGGC GCGTTTGAAGTATTGTTTTCAAGTGCAGCAGATTGTTTACTTTACGCCCA CCCAACTGTGTAAACAAATTCAGCGCAGGGCAGTAAACCAGTGAGCTCCA AACCTTCGAGCAACCAAGATGTCGGGCACCATACTGGAGAACCTGAGTGG CCGCAAGCTGTCCATATTGGTGGCCACTTTGCTGCTCTGCCAGGTGTTGT GCTTCCTGCTGGGCGGTCTGTATGCCCCCCTGCCCGCCGGCCATGTCACC GTGCTGGGATCGCTGTGCCGCGAGGATCACGCCCGCCAGAATGACACCAG TTTCCTGCTGTACTCACGCGGTGCAGGAGCCTGCATCCCAGTGACGCGAG AGGAGGTGGAGCAGGATTCAACAAAGATGGCCAATGAGTTGGTGCACGTT TTCCAGATGCCGCTGCCTCGTGACCTGCGCGACCTGGACTACTCCCGTTG GCAGCAGAATCTGATCGGTGTGCTACAGGTGGAGTTCGGCTATGATTCCT CGTCGGAGCTAAGGGAACCGCCCAGGGAACTTCAGTTGACAATCGACATG CGTCTGGCGTACCGAAATAAGGGGGATCCGGACAACGGCTGGAAGTTGTA CGCCCACGGCGTCGAGCATCGCTACCTGGATTGTGTCACTTCTCATGTGG GTCCCACAGAAACGCTGTACTCATGCGACATGATACCGCTTTTCGAATTG GGCGCATTGCACCACAGCTTCTATCTGCTGAACTTGCGTTTCCCGCTGGA CACACCGAGCCAAATGAACCTGCAGTTCGGCCATATGCACGATCTCACGC TGACAGCTATTCATCAGAACGGAGGATTCACACAGATTTGGCTGTTGCTT AAGACAATGCTGTTTCCATTCGTAGTGGGCATCATGATATGGTTCTGGAG GCGAGTGCATCTGCTGCAACGATCCCCCGCCCTGCTGGAGTATATGCTTA TCTATTTGGGAGCCGCTCTGACCTTCCTCAATCTACCGCTGGAGTACTTG TCGCTGGTCTACGAGATGCCGTACATGCTGCTGCTAAGTGATATTCGCCA AGGCATCTTTTATGCCATGCTGCTCACTTTCTGGCTGGTCTTCGCCGGTG AACACATGCTCATTCAGGATGCTCCGAACAAGTCGACCATTCGCTCGCGT TACTGGAAACATCTCTCGGCCGTCGTCGTGGGCTGCATCTCGCTGTTCGT CTTCGACATCTGCGAAAGGGGCGTGCAGCTACGCAATCCATTCTACTCGA TCTGGACAACGCCGCTGGGCGCTAAGGTGGCCATGACTTTCATTGTTCTG GCCGGAGTTTCGGCAGCCATTTATTTCCTCTTTCTGTGCTACATGATATG GAAGGTGTTTAGGAATATTGGCGACAAGCGCACCTCGCTGCCTTCGATGT CCCAGGCGCGACGACTCCATTATGAAGGTAAGATATCCATTTTCAAGTCC AATGGTTATTCAGATTAAACCATTATACGATTTAGACATTGAAACATGCT CGAAAACCCATTTGATTGAATTATTTAAAAATTCTTTAACCAAAAATATC TCATACATTATTCGTGTCAATATGCGTCTCCCATACTTAAATTTCATATC TTAATTAGTTTTGCGGGACACCCTTGTTTATTTTGAAACGTTTTTTCAGT TCCTTTAGACCAGAAAGTTGAAGATTGGGCCGGAATCGTATATTTTTACA CAAAAGCTTTTTTTTTTCAATTGCATAAGGCAAATGAAAGTAAAGGTATG ACAAAATAATTTTAACTATGATTCAATGTTGTATCCAGAAGCTCCACTGA AATAATACCGCGTTTTGCAAACTAATAAGTTCCAAATTTATTCACATCAG CCGATGTAAATTAGCATAAACAATAAATTGAATGAAGCTTTTTAGTATGC TAATATTAAAATCCAGTTTTAATAAGTTTAAATCTTAATTATGTCTAAAT TTCAGGTCTTATCTATCGCTTCAAGTTTTTGATGCTGGCCACCCTTGTAT GTGCAGCTCTGACCGTCGCCGGCTTCATTATGGGCCAAATGGCCGAGGGC CAGTGGGACTGGAACGACAATGTGGCAATTCAGCCAACTTCCGCCTTCCT GACCGGCGTCTACGGCATGTGGAACATCTATATCTTCGCCCTGCTCATCC TGTACGCGCCCAGTCACAAGCAATGGCCGACAATGCACCACAGTGACGAG ACCACACAGTCGAATGAGAATATAGTTGCCTCAGCAGCCAGCGAGGAGAT CGAGTTCAGTCACCTGCCATCGGACTCCAATCCCAGCGAGATCTCCTCAC TCACCTCGTTCACACGCAAGGTGGCCTTCGATTAGGCGGAAGGACTCGAA TTATTGTTTTCTAAAGGGTTGTGTGCCAAACTGAGATCACAATTTGGCCT GCAGCCGCAACGCTTAAAGTGTGTGCTCATTTAATTACCATAGTCAGTAG CATTTCTTGCCTAGTTTTGCATTCTGTGCATTCGACAACGCGATCAGCAT TATTACTTATCATTAACATATAGATTGTCTAGTTTTTCACAGCATGCTCA AAGTGTACGATTTTATCAAATGTATTTTTATGTATGCGCCTCGGCAGTAT TATCTATTGATGTCCAATTGTGCTAGCTTGTAAGTTTTAACATATATTAT CAAATAACATTTTATACGTGTAATAACGTTCAAGGGTGGTCCCATTTTTT TTGCTGAACAACATCTTGCCTCGGAAACTATATGTTTAACATTGAGATGA ATTAAAAATCGAATAGTGTATTAAAATGATATTATTCATATAGTTTCAAG TGCCAAATTGTCGACAGATTAAAAAAGAACTCATACTTACCACCCTATAA TATTTATCCAGAGGACTCTGCCCAGATTTTAAAACTAAAAACGTAGAGCA ATTTTGTATTCAAGTAGCAATGCATCGAATAAAAAGCAATATTGAAAATG TCGAACTGTTTTATTTCATAAATGCCCAAGACGTTATTGAATTGTTAAGG AATGCCGTTTAAAGGAACTACCATATGATCCTTTGAGGAGTGCGGTAGTT TTTCCAGTAGAACTCCTTTGTAAAGTACACGTAAAACGTGGCCACATTGA GCAGCAGATGAGCTCCGAGCTCCAGCCACTCGGCGTAACCCTTGCGAGTG TGCCGTGTGTTGAGTCGAAACAGAATGTACGGCACCAGGAAGTAGCGCAG CTCCAGGAGTCGCTGGAAGCACAGCACCAGGAATAGACTAAGTGGAAACA TTAACTTAAAGCTTTCCGGCATGTGACGTAGTCCGCAAAAGAGTACGCAA ATCGAGAGCAGATAAGCGGGCGCCATGGCGTAGCGGAACCACCAGAACCG TCCATAAAGTCGGCTCCATATATAGAATGTATAGTGTCTGTTGTCAGCCA GCAGGTAGGGATGCACTTCGGTGTTTAGGTGCACCACCACCAGTATGAGC AGCAATGCCAATAGGGACAGCACGCGATTCCTGCGTATTAATTCTGCTGC CGGACGAAACTGACGTATGGTGTTGGATATCCCAAAGCCAGCCGCAAAGA TGGCGAAGTAGAATAGCTGCGGCACATGCAAACTGGCCTCGTGGGCACTC TTGTCGCCCACCACAATGGAACCATTGATGAAGAGGAATCCCACGAACGG CAGAATGATCGAAGCGTAGAAACAGCACTTGGCCAAGATGCTCAGGATGC AATTGCACAGCAATTGGGGGCTGCTAACGAGTTGAAGCCACAACTGAAAA ATCACAAAAGTTTTAATGCTTATGCCAGTATACCAGGTGTACAAGACAAT GCCCCACCTCTTTGCCCATCAGTCGAACATTTTCCTTGGGAACGCGCCCA GTGCGGGCGCATTGATTGACCAACGTGTCCAGCACAGTCATTCCGGTGGC CATGCATACCCACACGATATTCGTCTGGCGCATAAGCACACTGGCAGCCC CAAAGACCGCCGCCGGCAGGTGCGCCTCCTGCTGCCAATAGTTGTAGAAC AGAAGCACCATGGTCAGCGACAAGGTGTCCGTGTAGTAAAGGTGGCTAAA GAAGTAGAGCGGCGGAAGCACGGACATGGTGATAGCCTCATGGGCGGCAT ATGAGTTGCCACCCGAGCCGGCCAGGATGCGCCGTCTGATCTTGTAGAGC AGCAGAATATTGATGCCGGCACCTGCTAGGCTGAGCATCCTCAGGCCCGT CACCGTGCACAGACTTAGGGGATTCAGGAGCAGGGCGATCAGATAGAGGC CCGGAAATGTTGTTATCTTGGGATCCCACTGTAAGGAAACTGGTTACGAT CTCCTTGGTCAAATTAGTAGTAATCCCTCATTTACCACATCGAATTCCTT GCGGCAAAAGGCCAATCCCTGCGGAATGTGGAACTCCTCGTCGATTACAT AGTCCGATGTGCCATTCACCCGCAGGAAAAGTGGCAGCGAGTACAGCACA AAGCCCACGGGCAGGATTAGTTTCCAGGACCCATTCATGGTAGGCGATCC TTTTGAGCCGACGCCTTCCAAACGAGAATGCTCCAATTGGATTTGTTTAT TTTTGGACTCAACCAGCCGGCAACGCGTGGAAATGGACTAACGCCTGGCT TGACATTAAAAAAAAATACTCAACTAAAATACCACAACATTCAATTGAGG TATGTTTGTAAGTATGTTTAAAGTTTAAACTTATCGAGCTGAAATTATTA CGTCGAAGGAAGTATTCGTTTGTACAAGAATATGGTCTGGGCCCTTGGTT ATCGTTTGTTTAATTTATAAAAGTGTCTCGAGATGCCTCGCCAGCTATCA CTGCTGGATCTAAACAATGACTGTTTGGCCAGCATTTTGAGATTCTTACC CGCAGAGGATCACTTGCACTTTGCACACACTTGCACCCGTTTGCGAAATG TCTTCACGGATTGCGGAAGGAGTCTTTACAGGAGTGTAAAGCTCACTGGA TCCCGGTAGGAGCTACTCTTAATGCGAGTAGTTGGGCATCTGGTGAAGGA TCTGTGCTTGCCATCGAACTGGAATGCCCATGTAGATTGGCTTAGCAAAA CCATCAACTGCCTAGCCAAGCTGGAGAACGTTACTCTGAACTTTGACCAT TTTCCAACAATTCACTCGACAGAAGCCATTTTTTGGACTCTGGAAAAGCT GCCCAACCTAAGAGGAATCAGAGTAGTGCAAAACAGTGCTTTCCACAACG TCTACAACAGGGCTCATGCACAAATGTGGATACCAAATTCCTATACGAAC TCTGAGAAACTTCTGGGGACTATTCAAAAAAGCAATCCCACCCGACACAT GATTGGGTGGTTATTAATCCAATACCGGTCAAAGGCCCTAGCAAACAGGT GATTCTTTTTCTCACCAATGAATTCGCGACACAAATCGATCGAGCTCGTG GAACCCTAAGTCTTGGCTTAAACTTTGTTCACCCAAGGATTTATGCCAGG GGTGCAGTGTCGGGTGGAAATAGGGACATTCAAATGTAGACCATTCTTGG TTTTCAACTTATCTAATACTTATCTAATACTATTCCAAACTTTAGTTCAA TGTCCCACCCAGATGCCAGTACAATAGTTAACTTTATAAGGTTTATTAAT CTTTAGGTATTGGAATATACACTTCGAACTTTAACATATAAGTACATACA AACAGAATGTTTAACAAACAGTACGACTTAATGACTACCAAATATCCAGG CCAAGAAGCAACTGGAGAATCTAAGTGACAATGCCTTTAAGTGGTATGGA ATGGTACATATATAAAAAGTGTGATTTGTATAGATTGCGTTCGTTTGTGT TTGATGTGAATAAGAGTGTGGTGTGGTGTGGTGTGGTGTGGTGGGGCTGG AGCTGGAGCTTTCGGTTCATCCGGCAACCGACGACTGGTCACAGGGAAAA CTCCACCTTCCGCTGTCGTTGCTACTTGTTCACACTCCGATAGATCATCG GTGCCGATCGGTCGTTGGTCTTGGTATGTCGCAACTTGACCGTGGCGAAC TGGGAGGCTCTGCAAAAGATCAATGATGTGTCCAATTGAGGAATGCGATC CCCAATCCTTGGGACCACTACTTACGGCTGGAAATACAACCGAATTCGGG GAATGGTGGGGCTAGCTGGGATACACGGGCTCGCTACAGGTCAGTAATCT ATGGAATAGTTGCGATATATACCGCGACTGCTAAAAACCAATTGACATTT ATGCATTATTCCGGCTAATCAGTGGCGAAATAAGGTTTGAGCTTAATCTT AAACAAAATACATTTAATGATATGCATGCAGGCACCGAAGCTCAAAGGAT TGAATGTTCAATGGGGAGGTCCTTGTTCTCTAAAGTTACCTCTGGCATGT ACAGAAATGGATTGACATTTTTCCATTGCCATCGTGGCTTGTCGTTGGCA AACACAAAATTGCAATAGCTTTTAAGAGTAATATATAAGATATGTACATA AAACGAACAAAACAGAATTTGCCTTAGACTAAGAAATTATACAGGGTAAA TAATGCTTAATTCGAAGGAAGGAGGAGACAAGGCGAACTGGAAAAGGTTT GGGATGCTGGGGATCACTCTTACGTAAGTTATCCTTTCCCCAGCCGCACT TTCCCTCCACTTTCACACTCCCTCTCTCTCTCTCTCTGCGCATTTTCTTA TCCGGTAAGAAGACGGCGAAATTATTGTATTATTTCATACACGCACCGAT CCCTAATCTTTTCATTACTTCAGCTTGGCACTAGCCGACTTCTGGCCATG CTGTTCCTGATCCCAGAAGTCGTACCATGGTCCGTAGCTCTTGTTTCCGG CCAAACCCTTTGAGTTCCGCTCCAAGGTGGCGCTGCTGTTGCCGATGTTA TTGCCAGCGGAGGTGGAGGACTTGAGCAGGCGTGTTCGCGGCAGAATGGT AGCCGTCGGAGCTCCCGAACTGGCCGTCGAATTGCGGGTCAGTGTGCTGT CCTGGTCCTTGGAGGAGCTCTTTTTCAGCGTATTGGTCGCCATTTGCTGA TGCTGCTGCTGGTGATGGCGCCGCATCTTGTCGTCCTTGCGCACCAGGTG ATCATTGATTACGATGCAATCGTAGGGATCGGAACTAGTCGACTTGAGTT CCGCATCGGAATCCTCCTCGTCCTCGCTGGTATAATACTGCTTGAGTATG TCCTGTCGCTTCACCGTCTTCATGACCAGTCCATGGCCGTGACTGTTGTT CTTGCCCTCGCCGTCAAAGAAGTTGTTCACATCGCTGAGCTTCAGGGTAC CGTGCTCATCGCTTTCACCCTCATCCGTGGATTGTGGAAACTGCTGCTGC TGCTGCTGCTGCTGGTTGCTTTTGGTGCGACTCAAAGTCAGGGATTTGTG CTGGGATCCGGTGCCGGAAACCTGTTTGTCTAACTTTCGATGTTGCTGCT GCTGATCCTGCGACTGACCACGTCGCATGGTGCTCATACGCTCCGCCTCC GTTGGCTCCTCAATGTCAATCTCAATGGTCTTCATGATTTTCATGCGGGA TTTGGGAGTATAGCTGCTCCTGTGCTGCTGCGCCTGTTGCTGCTGATGTT GCTGATGTTGCTGATGCTGCTGCGTCTGCTGCTGCAGTGGCGGTTGCTGT GGACTCACTCCGTAGATATTCTCATCCTCATCTCCATACAATTCAGTGCT GGTCAGGCTGTCCTTTCGTTCGCGCTTCTCCTGCGAGGAACTGGAGTTAT GCGACTTGGTCAGTGTACCATTGCGATCCTCCTCCAAACGCCGCTCCAAG TCATCCCGATCGCGCATCTCCTCCAGATTTGGAGCCGCCACCAGGTCGCG GTGTTGCCACAATGACATGCCGGCCAGTATATCTTCGCCATTGCGTCCGC CGCCAAATTTCCAGAACGATTTGGTGCGCTTCAGACCGGCGCTGGAAGCC TGAAGAATCTCGTCATCGGAGGCAATAAGATCGTATCGCATCTTTCCCAC TCCTCCGCTCTGCCGGCTCAGCCGATGCAGGCTCTTGTCGTCGATCTGAC TATCGACGCTATTCCGGAAGTTCCGGTTCAACGTCCACGAGGCCACATCC CTCGGCACCGTGTTGGTATGCGAATTGGTGTCCGCCCGGCGTCTTTTTAT TTATTTTTTTATTTTTTATTTCGGATTCGTGTCGCATAGTTTGAAGTGTT TTTTTTTTTTTTGAAGGTGTGTGGTTTCAAAGTGTTTGAGTGTGTGTTGT GGGTGCATATTTGGTTGGTTAACACAAAGGATGACAACAGGGCATAATGG CGATACATGGAATCAAACAAGAGCGGAAGAAAAGCAAACGAAAATAAATA AATTCAATCGAATAAGGCAATCTAAATAAATCAGGCATAAAACGTAATGA AATAGCTTGACAAGGACTTTAGTTTAATGGGCCATGTTGATCGGGATTAG TGACAGGTAGCTTATAGGCTTGGAGAACAAAAATCAGATGTATTTCCAAT ATTTACAATTAACTTAAACTCTTGCTCTCCAAGCCGCTTCATTTATATAT TATTTGATGATACTTTATGGGACGGACGTTATCTTTCAAAATAGATTACA AAATATGCGTGTGGTTCTTATAGAAAGGTTCCATAAAGTCCATCTTATAA GGTATCACACAAGGTTCCATTAAAAACCTACCGAATGGCCACTCTTTGGG TGGCTGGCTCCTCATCCGAATAGTCAACTTCCGGCTGTGGTGGAGGCTCG TTGGCGAATCCACTGTCATTGCTGCTATGCAGCGAGGTCTTGGCCGCCAC TCCGGATTTGCCCGATGGATGGTTCTTCGAGCTCTGTCGATAAAACCCAA TTAGATAATGTATAATCTAGTCAAAATATATTCCTACCTGAACGCCATTA AGTAGCTTTTGTTTGCGTCTTTCCACCGCCGCATTGACTCCTCCTCCGTT GGAGGCGCAGAAGCTTTGCGAGCTGTTCAGCATTCTGGAAGACTGGCTCT GCGGTCCATTGGGCACCGGAGCGGGCAGTGTGGGTGGCGGTCCCGGTCGC GGATTGGCCCCGGATCCGGGGCGGTACTTCTTCTGCTGCTTGATTGTGTC GCCGAACATCCGCGTGGGTGATGAATCCTCGGCACTGTGATTCCTTCGCC TGCGGTACGTTGCCTCATGGCTCTCCATCAGCTCCAGCTGCGCCTCGTAA TCCTGCTGTTGCTGATAGCTACGCAGACCACCTCCGCCAGAACCGGATCC TGATCCGCCACCATTTCGCTCATAGCTCATCAGCATGTTTTCGTATCGCC GACCACCGGAAGTGGTCACCTCTGCCACTTCCGCATTGGTGTAGGCCACC GGAAACCAGCCGAAGTGCTGTGTCCGCAGATTCTCACCGAATTGCCAGCC CTTGGCCTTTCCGCCCACCAAAGCAATGCGGTCGCCCTCCTCGAAGGACA ACTGGTTCTCGCCGGAGGGCATGTAGGCGTAGAGGGCCTTCACCAGAGGA CGCTGATCACCGCGCTGATCGTCGCCCAGAGTGGCTAGCTGCTCCTCAAT GATCTTGTGTTTGTTGGCTGTCAATGGAAGGGATATTTATGAATTAAATG AACATCAAATGTTCCAAAGCTTATATGCCCACCTGAGCTCTGTCCAGTGC CCACCAAAGCCAGATTGAAATCAGATTTGGCGCGTGGCAGCGAGTTCTGG GCATAGTGCGCTGGCCCAGTACCGCCCAATCCGGAAAGGTTCTCCCGTTC GTGCAGGGTGCGCATATCACCATAGGGGGCATCGATGCTGCGCGATTTCT TCAGCTGAGCTCCGTGACCCTGGAGGTGGTCATCGTCGCCGTCCTTAATT CGTTCCTGTTCAAAGAAATCATGTAAGTATTATTAAAATATTATTATTGA AAAAAATTTAAAAATTCGTTAATTCTATAAGGTATATTTATATCCAGAAT AGCCGAATGGTTTGTTAACAGAGTGATTAGCGCCCAATTGGCGACCGGGA TTGTTTTGGCCATAAAAATGGGCGTTGGGTTGGGCATTGTGATGACTCAC CAGGCGTCGCATGTTGCCGCTGGTGTTGTTGTTGCCGCTGCTGCTGCTGC TGCTGATGTTGTTGTTGTTGTGTCCGTTGCTGGTACTGTATCCACTTTCA TAGGCCGCCGGTGGAATGATCTCACGAGAAGCGGCAATCTCTTGCCAATT TTCGAAATTATTATCAATTACCGTCTTGCCGGTGGTGTGGTAGACCATCC AGTGTTTGGCGATCGAGCACTGGCGCTCCAAGACGAATCCGTACCGTCGT CGCTCCTGTGTCATGGCCTTTTCGCCCGGAACGGAAGTGGGAAAGAGTGG TAGAGTTATACACGGTAAGAAATCATAGATCATTTCTAAAATTATTTCAA TCTTTTGCGGTGCTTAGTAAAATCAGAACTTTAAGATAGGTAGCTATCAT GAACAAATTTGGAATTATAATACATTTAAAGCCTGCTAGCTAGTATTCAG ATCACTTCCACTACTTTGAAGACATTTTTTGTTTTTATCAGTGTAATCGA TCCGTCACTTTTTCAAGTACAGAATTCTTTTCCGCGAATGGGTGGATCAA GATTCGGCCGGCAGCCATATGAACTCACATTCTTGTAGCTCTGATCGCAG AACACATCCAGCTTTTTCTTCTGATCCTCGAGCAATTGGAGGCTCTGTGG GAAAGTAAGTAAGTTTTTTTTTTTTTTTTTTCGGTGGCTCTTGAGATCGT TTATATTCATATATGGTATGCATATGCATCCACTCACCCTAAGCTCCTTT TCGGTGTTCTCGGGCGTGGCCTTTTTCTTGCGCTGCTTCTTCATCGTGGA CACGGCCTTCTGATAGCTCTCCATTCGCACTTTGTGCTGCTGCAGGAACT TCTTTTGCTCATGCTGCACCACCTTTGTGTCCTTCTCCAGATTTGTCTCC AATGGCACCAATAGATCCACGTAGAAGGCTTTCAGCTAAAGAGAAGTCAA GTTTTGAATAGGCCTTCTTAGGTTAGAATTAACTTAAGTTCACATACAAT ATTCATCTGCTGATCCTGTATCTCCTTGTTCACATTCACAACGCTCATCA AAGCTGAACCTGTACAGAATAGTTGATATTAATGATCAATTTTTGTGGTT TTGGACTCATCCCACGCAATATCTTAGGCTTGACTTACCAATATCGCCCG TTCCGCTTTGCTGGGCGTTCATCGCAATCTTGGCCAATGCTTCATTGAAT AGACGCGAGGCGGTTGCGGCACCTGTTGCATGAAATGGCACGGAATGCAT TGCAAATTAGTTAACTGTACTGCACTTGCGGCAGTCGATTATGGTGTTAC TTTACAGTGGTGTATCTATAGACCAGCATAAAGCAGCACTGAAACTTACC GTGCAACGCCTTGAGGTAACTTTTGCCCGCTGCGATCAGCTGCCTGGCAC CCGGATTGAATCTATCCAGTATGTTCTGCAATTCGAAAAAAAAGCGATCG ATGGATATATTCATATATATATAGTATGAATTATCTTATCATATGATTAA TTAAATGCAATTTACTGGCCGGCATGCACCAACATTTCAATTTCATTAGC TATAAACAGTTTTCCTAGACCCCCCCCTCCCCCCTCTCAAAAGTTGGCTT AATGGTTTACCCCGGTTGGCCGCTGGCAGTAAAAGTCGGATTGTATAAGT TGATTTGAGACAATGTTGTGGTCAGGCAGCGACATCATTAGTTCCGTGTA GCCAACTGAACATACTCGCCATGCTAATTGCTCGTTTAGTAATCTCTCAT CTATGATTTAGTAGCGGTTACTACAAAATGAAAGTTATCTGTTGCATCGC CAAACATTTCAGGTAGATAAATCTTAAAGTACTATCGGTTGTCTATATAT ACATATGTATCTTAAAGTTTTCGAAACAAAGTTAATATTTGGCTAGAGAA TTAATAAAATTGCAGTTTATTGGTTGCAATTTAGTGTCTAATAGTAAAAC GTTTACAAAGAACAATTGGTAGTGACACATCTTGTGATTTATCATTTGCA AAACTCGGCAATAGCAAAGTCTACATACGATATAAGCTCATTTTGAATCT ATATCTGTACATGAGTCATTTGTTTTATCAAACAATTGATCTCGTCTAGG GCCTCGGTAGATGCAAAACGATGAACAATTAATTAACAACTTTGCACTTG AGCACAGATTTTGCATACAATTCGTGGAGTGAGCTTTGTGATGAAGCTGC GTTACAGCGACGAGATGACGTGAATGGATTGTCATGTGGAAGGGAAGTTG ACATCACCGGCCTGTTGACACCATAAAAGACCATAAATAATGACAAAGAA AACACTTTGGTCCTGGGCTTGGCCAAAAGTCGAGTTTTGGCGAGCGAACA ATGCCAAACACTTAACACGCAAGCCCAAAAGAAATACGAAGCTGAAAAAA TATTTGAATTCTCTTTGCGCACAAAGCATTCGCATTGTTCGAAAGTCACT CTTTTTAAATGTTCGTTAGGAACTATCACATGCTGCGTATAAGTATAATT GATTGTTGTTCTCGTGATAGCCGAGAAATACATTCGAATCACTTCCGTTC AACATTGACTACCGATTTCCATGGTCCACCAAGTAATTAGCAAGAAAATG TCAAAAACCCGAATGTAAATAACACATTCTGTGCGGAACAATTCGTTTCG CTTGTGCCATGTGTGTCATTTGGTTATTGCCAAATGTTTACGCCTCGACA TATTTACTTTTTTTTTTTTTTTTTTTTTTTGAAATTTATTGGCTACAAAT GTGGCAGCAAGGCATGGGAACGAATCGAGCCAGCAGCACTCGAGCTCAGA TACTTAGATATTCAGATACTTAGCTGCAAGGTCGTCTGCTTTTAACGATT CAACTTGGTGTTGAGTGTTTGCTTTTATGATCTACTAGCTGGCTGAATTA GTTTAAAGCATTACTCGATGATACAGATATCTGCTGCACGTAAAGCTGCA TTTCGCTGTATCTTCTAATGTTTATTTTACCGAAGTGCACTTGACTTTGC TGACCTCAGCGTAGTTTGTTTAATTTGGATACGGATACCTTAATAACACG CACAGATACAGATAGCCAAGCAATTTGGTGGATTCAAGTGCGTTTTCGAA GCGCTTGTGGCTCCAACGTTTATGAGTTTATCAATGTTAATTGTTTCGTT TTTCTACAATTTGTGGTGAGCACATTTTGTGGTTAATGCAATCAACTTAT TTGGGATTTACCTTAGGGCTTTCATAAAATAATTATACCCTTGAATGAAA TTATGACAACAGATTATAAAATCAGTGAGCAAAGTAAAGTGTATATATAT TGTAGCAATCAAAAGAAGTCAATAACAACGAGGTATTCTTTTTGTTTTGT TATTTTTAAGTATGCTCAGTTAGGATTTTTAACAACTATTTGAATTTATG AATGGTGTGAACATTTCCTTGAATTCTTTTTTCACTTATTTTAAACAGTG TACAACATGCATTTAAATCACCAAAGTACAAATCAGGTTTCCTTTAAATA CGATGGCTATCTGGCCGTGTAATTGGCCCAACTGCTTAACAAATTCCGGC TTCGGTTCGATCCAGCAATTAACATTTCTTCTTGCTCACCCACACTTGGC CGAAAAGCAATGACGCAATCGTTTATCAAGCCCGCGAATCAGCGACCCAC CGACAACACTTAACCCAAAATTAATTGAGGTAGTCGCTAGTTGCCCAGTA CTCAGTACTTAGAGTACTCAGCTCCGAATACACCCAGTTATAAAACGCAG GCTCAAAACCCGAGTGACTTGGTCTTAAATCGTCGCTTAACATAAATCGC CAGCAGTGAGCGCCACACATGTATAATTTTTTTTTTTTTAATTAAAACAG ATACTAAATGCAAAGCATAACACGAAAGCCTCGCCAGTGCTTAACAACGC CAACGAGGTGGAATGTTGGGCGGTACACAGTGAGAAATCTCGCAGAACTC AAATAAAATATATTGTGAAAATCATACATG